CN109385481A - Application and its selection of serpinA3 the and vitronectin gene in Soviet Union's ginger boar breeding - Google Patents
Application and its selection of serpinA3 the and vitronectin gene in Soviet Union's ginger boar breeding Download PDFInfo
- Publication number
- CN109385481A CN109385481A CN201811179396.5A CN201811179396A CN109385481A CN 109385481 A CN109385481 A CN 109385481A CN 201811179396 A CN201811179396 A CN 201811179396A CN 109385481 A CN109385481 A CN 109385481A
- Authority
- CN
- China
- Prior art keywords
- ginger
- gene
- soviet union
- boar
- breeding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to gene engineering technology fields, and in particular to the application and a kind of kit for breeding Soviet Union ginger boar of a kind of method of breeding Soviet Union ginger boar, serpinA3 gene and/or vitronectin gene in breeding Soviet Union ginger boar.Present invention firstly discovers that existing functional relationship between serpinA3 and vitronectin gene and Soviet Union's ginger boar food efficiency, by the way that serpinA3 and vitronectin gene is applied in the breeding of Soviet Union ginger boar, the high boar of feed efficiency can be selected, the economic benefit on Soviet Union ginger pig pig farm is improved.
Description
Technical field
The present invention relates to gene engineering technology fields, and in particular to serpinA3 and vitronectin gene is in Su Jianggong
Application and its selection in pig breeding.
Background technique
Soviet Union's ginger pig breeding goal is the new product boar of high litter size, excellent pork quality and high lean meat percentage, by multiple generations
Breeding, the pig have good appearance traits, breeding and production performance[1].Up to now, feed cost accounts for modern intensiveization poultry
The ratio of fowl breeding production totle drilling cost has been more than 50%, and feed efficiency has great shadow to the economic benefit of livestock and poultry large-scale cultivation
It rings.Feed-weight ratio (Feed/Gain, F/G) or heavy burder ratio (Gain/Feed, G/F), i.e. feed conversion rate are generallyd use both at home and abroad
(Feed conversion rate, FCR) evaluates feed efficiency.But have by F/G or G/F metrics evaluation feed efficiency
There is a following defect: first, feed usage amount should be the practical feed intake of pig, rather than general feed consumption, how quasi-
Really measurement feed intake is that the problem faced or even different hopper designs can all cause feed intake to fluctuate[2]；Second, weight is to feeding
Material efficiency has an impact, because the individual of different weight maintains energy needed for needing variant, maintains that low individual is needed to have more
High feed efficiency[3]；Third, Dietary ME have an impact to feed efficiency, because of feeding quality (stable Energy intaking)
There is uncertainty with energometry in daily ration[4-5].Therefore, feed efficiency not can accurately reflect using feed-weight ratio or heavy burder ratio.
Under normal circumstances, in order to improve feed efficiency, can start with from external environment nutrition regulation improves animal feed intake[6-7], such as
Focus on the digestibility of pannage raw material[8], concentration[9]And energy[10].But with the arriving of world resource crisis, pass through breeding section
Grain type pig or application molecular genetic means improve pig production performance, and improving feed efficiency from pig inside is necessarily becoming for future development
Gesture.
It reviews the past decades, pig breeding enterprise has almost reached the selection of the characters such as lean meat percentage, daily gain and the thickness of backfat
To selection limit, feed efficiency is improved by raising growth traits indirectly and has showed bottleneck.But pig individual maintains needed for basic metabolism
This variant physiological phenomenon of energy provides a new approaches for breeder, i.e., energy needed for reduction pig individual maintains can be into
One step improves feed efficiency.By remaining feed intake (Residual feed intake, RFI) index reflection feed effect needed for maintaining
Rate.Remaining feed intake is a kind of index for estimation animal and fowl fodder efficiency that Koch et al. was proposed in 1963, and being that livestock and poultry are practical adopts
The difference of appetite and the feed intake according to expected from its body size and the speed of growth.In other words, RFI is the practical feed intake of livestock and poultry
And the difference for prediction feed intake required for maintaining and increasing weight.
In practical breeding, the horizontal low individual of RFI is selected, under the premise of total feed intake is identical, individual is for maintaining
Required feed intake is fewer, then the feed intake for growth is more, and feed efficiency is higher[11-12].Therefore, ginger pig of reviving is not being influenced
Under the premise of initial growth, breeding and meat breeding objective, low RFI level individual is persistently selected to can be improved feed efficiency, reduce
Feeding cost reduces excrement and carbon emission, reduces environmental pollution while improving breeding enterprise productivity effect, guarantees economic benefit
With environmental quality cooperative development.
However, passing through or only by selecting the horizontal individual of low RFI, i.e. Phenotypic Selection, there is certain limitation.Example
Such as, the feed efficiency numerical value between the horizontal individual of the high RFI filtered out by Phenotypic Selection and the horizontal individual of low RFI it is variant but
It is not significant.This may be because the individual amount for selection is fewer, and Phenotypic Selection error is larger, it may be necessary to multiple generations
Can just there be notable difference, it is also possible to by multiple generations also without significant change.
The metabolic pathway of known complexity influences feed efficiency, is related to energetic supersession[13], lipid metabolism[14], anti-oxidant answer
Swash[15], immune defense[16]It is formed with insulin[17]Etc. physiology courses.Studies have shown that participating in actin filament assembling and being immunized to answer
Answer the serpin A3 albumen (serine protease inhibitor A3 or serpinA3) and ginseng of process
With blood homeostasis and the vitronectin (vitronectin) for regulating and controlling subcutaneous fat deposits in the metabolic pathway for influencing pig RFI
In directly play a significant role, influence feed efficiency eventually by adjusting energy utilization and establishing energy i (in vivo) balance.Therefore,
The relationship that serpinA3 and vitronectin gene is probed between ginger pannage efficiency of reviving, is excavated and two genoids of application are aobvious
Allele, while the low RIF level Soviet Union ginger pig of breeding are write, so that the grain-saving type Soviet Union ginger pig new lines cultivation for high feed efficiency mentions
For a kind of effective ways.
Summary of the invention
As described above, being that there is low RFI water by screening to the current selection of the Soviet Union ginger pig with high feed efficiency
What flat individual carried out.However, the selection, there are many defects, such as error are larger, not accurate enough, the breeding time is long, can
It can need to undergo multiple generations that could complete.Therefore, present invention contemplates that carry out Soviet Union ginger pig by using molecular genetic analysis
Breeding provides a kind of effective method whereby for the grain-saving type Soviet Union ginger pig new lines cultivation of high feed efficiency.
The present inventor is for the first time it was unexpectedly observed that serpinA3 and vitronectin gene and the feed efficiency for ginger pig of reviving are deposited
In significant correlation.More specifically, the inventors discovered that, there is the significant allele B of serpinA3 gene1And/or
The significant allele B of vitronectin gene2Soviet Union's ginger pig individual to have low RFI horizontal, and its feed efficiency can be improved
At least about 5% or more.Based on this discovery, the present inventor completes the present invention.
Therefore, in a first aspect, the method includes following steps the present invention provides a kind of method of breeding Soviet Union ginger boar
Rapid: i. carries out Genotyping detection to the serpinA3 gene and/or vitronectin gene of Soviet Union ginger boar；Ii. selection carries
There is the significant allele B of serpinA3 gene1And/or the significant allele B of vitronectin gene2Soviet Union ginger boar be left kind
With.
In second aspect, the present invention provides serpinA3 genes and/or vitronectin gene in breeding Soviet Union ginger boar
In application.
In the third aspect, the present invention provides a kind of kits for breeding Soviet Union ginger boar, and the kit includes: a)
For expanding the primer pair 1 of serpinA3 gene, and/or the primer pair 2 for expanding vitronectin gene；And it is b) sharp
With the operation instructions of this kit breeding Soviet Union ginger boar.
It is thus high feed efficiency by the invention it is possible to carry out more direct, breeding accurately and quickly to Soviet Union ginger pig
The ginger pig new lines cultivation of grain-saving type Soviet Union provides a kind of effective ways.Selection of the invention, which can select, has higher feed
The Soviet Union ginger herd boar of efficiency saves the pig raising period, improves the economic benefit on Soviet Union ginger pig pig farm.
Detailed description of the invention
Attached drawing is used to provide further understanding of the present invention, and constitutes part of specification, with reality of the invention
It applies example to be used to explain the present invention together, not be construed as limiting the invention.In the accompanying drawings:
Fig. 1 is Technology Roadmap of the invention；
Fig. 2 is that primer pair 1 expands allele SSCP figure；
Fig. 3 is that primer pair 2 expands allele SSCP figure.
Specific embodiment
The present invention is described in more detail below.It should be noted that Summary above and hereafter detailed
Thin description is only the specific purpose for illustrating the present invention, it is not intended that is limited the invention in any way.Without departing substantially from this hair
In the case where bright spirit and purport, the scope of the present invention is determined by appended claims.
As described above, being that there is low RFI water by screening to the current selection of the Soviet Union ginger pig with high feed efficiency
What flat individual carried out.However, the selection, there are many defects, such as error are larger, not accurate enough, the breeding time is long, can
It can need to undergo multiple generations that could complete.Therefore, present invention contemplates that carry out Soviet Union ginger pig by using molecular genetic analysis
Breeding provides a kind of effective method whereby for the grain-saving type Soviet Union ginger pig new lines cultivation of high feed efficiency.
Molecular marker assisted selection (MAS) is the general identification of one kind and utilization chromosomal region quantitative trait locus
The method that (quantitative trait locus, QTL) chain favorable allels promote cattle breeding, it is current full base
Because of the important householder method of a group association analysis (GWAS).There are recombination event generation and equipotential base between conspicuousness allele and QTL
The effect of cause may be different, therefore MAS implements to determine the positive-effect or negative effect of dominant allele first.Currently, MAS
Implementing more efficient method is to find and identify the neomorph of functional gene or known function gene, assesses it to different tables
The positives and negatives of type character, accuracy is more preferable, and MAS is that research single traits that current scientific research personnel is widely recognized as has efficacious prescriptions
Method.
The present inventor by unexpectedly being found at the genetic level for the first time using MAS technology, serpinA3 and
Vitronectin gene with Soviet Union ginger pig feed efficiency there are significant correlations.More specifically, the inventors discovered that, have
The significant allele B of serpinA3 gene1And/or the significant allele B of vitronectin gene2Soviet Union's ginger pig individual have it is low
RFI is horizontal, and its feed efficiency can be improved at least about 5% or more.Based on this discovery, the present inventor completes the present invention.
Therefore, in a first aspect, the method includes following steps the present invention provides a kind of method of breeding Soviet Union ginger boar
Rapid: i carries out Genotyping detection to the serpinA3 gene and/or vitronectin gene of Soviet Union ginger boar；Ii selection carries
The significant allele B of serpinA3 gene1And/or the significant allele B of vitronectin gene2Soviet Union ginger boar be left kind
With.
" the significant allele " addressed herein refers to allele relevant to lower feed consumption, in other words
Refer to and the horizontal relevant allele of low RFI.In other words, the Soviet Union ginger boar selected by the method for the invention, due to taking
With the significant allele B of serpinA3 gene1And/or the significant allele B of vitronectin gene2, will have low RFI water
It is flat, thus there is required high feed efficiency.
Herein, so-called " low RFI is horizontal " refers to that the RFI of -0.214Kg/d to -0.106Kg/d is horizontal.Low RFI is horizontal
Ginger boar of reviving has expected growth traits, the growth traits: including in the predetermined weight stage feed efficiency, averagely increase day by day
Weight and/or the thickness of backfat.More specifically, referring to when expected growth traits refers to the feed efficiency in the predetermined weight stage pre-
Determine the weight stage be 30-90KG when, feed efficiency 2.93:1-3.02:1；Refer to the predetermined weight stage in expected growth traits
When interior average daily gain, refer to when the predetermined weight stage is 30-90KG, average daily gain 650g/d or more；Expected
When growth traits refers to the thickness of backfat in the predetermined weight stage, when referring to that the predetermined weight stage is 30-90KG, thickness of backfat 1.8-
3.28cm.If the RFI level for ginger boar of reviving within the above range, is not unfavorable for saving the pig raising period, is also unfavorable for improving
The economic benefit on Soviet Union ginger pig pig farm.
In one embodiment, the significant allele B of serpinA3 gene1With sequence shown in SEQ ID NO 6,
The significant allele B of vitronectin gene2With shown sequence.
It can be known by sequence alignment, the allele A of serpinA3 gene1And B1Between and vitronectin
The allele A of gene2Respectively with its allele B2And C2Between, there is only a base differences.More specifically, equipotential
Gene A1123rd bit base A is in its allele B1Corresponding position be C；Allele A2306th bit base T is in its equipotential base
Because of B2Corresponding position be C, the 137th bit base G is in its allele C2Corresponding position be A.
It will be understood by those skilled in the art that in the present invention, in addition to using herein specially by SEQ ID NO
6 and the sequence itself that indicates outside, can also base difference described above, to be respectively provided with certain sequence therewith same using respectively containing
Source property such as 80%-100% homology (such as 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) and still to retain its functional
Sequence.So-called herein " still retaining its functionality " refers to: not having SEQ ID NO 6 and/or sequence in Soviet Union's ginger boar body
Itself and when there is its homologous sequence, the presence of the homologous sequence still be able to instruction Soviet Union ginger boar have it is described above low
RFI is horizontal.
In one embodiment, Genotyping described in step i uses PCR-SSCP typing.
PCR-SSCP typing is also referred to as polymerase chain reaction-single-strand conformation polymorphism (Polymerase Chain
Reaction-Single Strand Conformation Polymorphism) typing is sent out on the basis of round pcr
The method that one kind that exhibition is got up is simple, quickly, is economically shown in single base mutation (point mutation) in PCR reaction product.The party
Method has been used as the screening detection of oncogene and Tumor Suppressor Gene Mutations, the Disease-causing gene analysis of hereditary disease and gene diagnosis, gene
The fields such as drawing.
In SSCP measurement, double-stranded DNA (dsDNA) is denatured as single stranded DNA (ssDNA), each single stranded DNA all bases
In they internal sequence and show a kind of exclusive folded conformation, even if the DNA of same length is single-stranded because of its base sequence
The difference of different, even single base will form different conformations.These single stranded DNAs are gathered under the conditions of non denatured with non denatured
Acrylamide gel electrophoresis separation, the mobility and banding pattern of single stranded DNA both depend on temperature when its folded conformation and electrophoresis.
The single stranded DNA of equal length because of its base sequence difference, or even single base difference will form different conformations so as to cause
Mobility speed is different when electrophoresis.As in target DNA occur base substitution etc. change when if will appear swimming displacement, thus identify whether there is or not
Gene mutation.
In one embodiment, serpinA3 gene using primer pair 1 be SEQ ID NO 1 and SEQ ID NO 2 into
Row PCR amplification, vitronectin gene are that SEQ ID NO 3 and SEQ ID NO 4 carries out PCR amplification using primer pair 2.
It will be appreciated by those skilled in the art that other than primer pair listed above, serpinA3 gene
It can also be expanded using not heretofore described other primer pairs with vitronectin gene, as long as the primer can expand
Increase the significant allele of the two genes out.
In one embodiment, it is followed the steps below before carrying out the step i:
A1 the phenotypic data to breeding Soviet Union ginger boar) is measured, the phenotypic data includes: preliminary survey weight, knot survey weight, puts down
Equal daily ingestion amount, intermediate supersession weight, the thickness of backfat and average daily gain；
A2 remaining feed intake breeding value EBV) is calculatedRFIWith multiple selection index I；
A3 multiple selection index I) is selected to continue on for step i) to step ii) for the individual of 0.24-1.62.
In step a2), remaining feed intake breeding value EBV is calculatedRFIIt can be in the following way with multiple selection index I
It carries out:
Firstly, calculating remaining feed intake RFI using formula (1):
RFI=ADFI- (b1 × OnBW+b2 × OffBW+b3 × metaMidBW+b4 × ADG+b5 × BFA) (1)
For ginger boar of reviving, its remaining feed intake RFI is specifically calculated using formula (2):
RFI=ADFI+0.11323 × OnBW+0.11673 × OffBW-0.96405 × metaMidBW-0.30524 ×
ADG-0.02367×BFA) (2)
Wherein, ADFI indicates average daily gain, and OnBW indicates preliminary survey weight, and OffBW indicates that knot surveys weight,
MetaMidBW indicates intermediate supersession weight, and ADG indicates average daily gain, and BF indicates the thickness of backfat, wherein metaMidBW=
[(OnBW+OFFBW)/2]×0.75。
Then, using remaining feed intake RFI as objective trait, average daily gain ADG and thickness of backfat BF are constraint character, according to
As drag calculates separately RFI breeding value EBVRFI, ADG breeding value EBVADGWith BF breeding value EBVBF:
EBVRFI=ADFI-group-year-onage-OffBW-ADG-BF-e (3)
EBVADG=ADG-group-year-onage-e (4)
EBVBF=BF-group-year-offwt-e (5)
Wherein, ADFI, OffBW, ADG and BF are defined as above, and onage indicates the preliminary survey age, and group is measurement group,
Year is the measurement time, and e is random residual.
Later, calculated each breeding value calculates multiple selection index (I) according to formula (6):
I=-aEBVRFI+bEBVADG-cEBVBF (6)
Herein, for the weight of objective trait (RFI) and constraint character (ADG and BF), EBV is setRFI75% is accounted for,
EBVADGAccount for 15%, EBVBFAccount for 10%.It can further to define above for the formula (6) for calculating multiple selection index I as a result,
For following formula (7):
I=-0.75EBVRFI+0.15EBVADG-0.1EBVBF (7)
When the I of ginger boar individual is 0.24-1.62 if some breeding is revived, it is required to indicate that breeding Soviet Union ginger boar individual has
RFI is horizontal, and the individual is therefore selected to continue on for step i to step ii.
Above-mentioned steps a1) to a3), substantially constitute a kind of Phenotypic Selection method.By extraly introducing these steps
Suddenly, traditional Phenotypic Selection method can organically be combined with molecular genetic selection method of the invention, from there through
The horizontal individual of low RFI is selected in advance, then therefrom selection carries the individual of significant allele described herein, thus can select tool
There is the Soviet Union ginger boar of expected growth traits.
Traditional Soviet Union's ginger boar selection, being take feed efficiency character as secondary breeding objective, in combination with phenotype survey
Fixed preliminary development Soviet Union ginger pig breeding.This method has biggish error, and accuracy rate is not high enough.In addition, needed for this method
The breeding time wanted is long, notable difference is just had by multiple generations, even and if there will not be sometimes after multiple generations
Notable difference.However, whether the method for the present invention carries serpinA3 by individual relative to traditional Soviet Union's ginger pig selection
And/or the significant allele of vitronectin gene come carry out Soviet Union the breeding of ginger boar, even if this method is in low RFI individual zero
Accurately Soviet Union's ginger boar breeding can be also realized by the detection to significant allele from generation to generation.In this molecular genetic analysis method
On the basis of be further aided with traditional selection, it will thus provide more perfect Soviet Union ginger boar selection.
In second aspect, the present invention relates to serpinA3 genes and/or vitronectin gene in breeding Soviet Union ginger boar
Application.
In one embodiment, selection carries the significant allele B of serpinA3 gene1And/or vitronectin base
Because of significant allele B2Soviet Union ginger boar be left kind of a use.
In a specific embodiment, the significant allele B of serpinA3 gene1With sequence SEQ ID NO
The significant allele B of 6, vitronectin genes2With sequence.
It can be known by sequence alignment, the allele A of serpinA3 gene1And B1Between and vitronectin
The allele A of gene2Respectively with its allele B2And C2Between, there is only a base differences.More specifically, equipotential
Gene A1123rd bit base A is in its allele B1Corresponding position be C；Allele A2306th bit base T is in its equipotential base
Because of B2Corresponding position be C, the 137th bit base G is in its allele C2Corresponding position be A.
As described in this paper first aspect, it will be understood by those skilled in the art that in the present invention, in addition to using at this
In text specially by SEQ ID NO 6 and the sequence itself indicated outside, can also using respectively contain base difference described above, with
Be respectively provided with certain sequence homology such as 80%-100% homology (such as 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%)
And still retain its functional sequence.So-called herein " still retaining its functionality " refers to: not having in Soviet Union's ginger boar body
SEQ ID NO 6 and/or sequence itself and have its homologous sequence when, the presence of the homologous sequence still be able to instruction Su Jianggong
Pig has low RFI described above horizontal.
As described above, using serpinA3 and/or vitronectin gene carry out Soviet Union the breeding of ginger boar selected
Soviet Union ginger boar, due to carrying the significant allele B of serpinA3 gene1And/or the significant equipotential base of vitronectin gene
Because of B2, will have low RFI horizontal, thus there is required high feed efficiency.
In addition, the application can also be combined with Phenotypic Selection method, as described in the first aspect of the invention.More specifically,
Before application serpinA3 and/or vitronectin gene, the table addressed in first aspect present invention can be carried out in advance
Type selection method comprising step a1)-a3).
In the third aspect, the present invention relates to a kind of kit for breeding Soviet Union ginger boar, the kit includes: a) to use
In the primer pair 1 of amplification serpinA3 gene, and/or the primer pair 2 for expanding vitronectin gene；And it b) utilizes
The operation instructions of this kit breeding Soviet Union ginger boar.
In one embodiment, the upstream primer sequence of the primer pair 1 includes SEQ ID NO 1, downstream primer sequence
Column include SEQ ID NO 2.
In another embodiment, the upstream primer sequence of the primer pair 2 includes SEQ ID NO 3, downstream primer
Sequence includes SEQ ID NO 4.
When the method for first aspect through the invention carries out breeding to Soviet Union's ginger pig individual, reagent of the invention can be used
Box is achieved in quick, the accurate breeding to low RFI level Soviet Union ginger pig.
It is thus high feed efficiency by the invention it is possible to carry out more direct, breeding accurately and quickly to Soviet Union ginger pig
The ginger pig new lines cultivation of grain-saving type Soviet Union provides a kind of effective ways.Selection of the invention, which can select, has higher feed
The Soviet Union ginger herd boar of efficiency saves the pig raising period, improves the economic benefit on Soviet Union ginger pig pig farm.
With reference to the accompanying drawing and embodiment to the present invention carry out specifically with detailed description.
Embodiment
Assessment of the embodiment 1. to low RFI level Soviet Union ginger boar
One, phenotypic data measures
Select preliminary survey weight for the Soviet Union Jiang Houbei boar of 30KG, 56 altogether, feeding daily ration is referring to " bacon hogs raises skill
Art " in the standard (the macro Beijing bacon hogs breeding technology of period-luminosity: Golden Shield publishing house, 2008) that provides, it is 90KG that knot, which surveys weight,.
During phenotypic data is collected, preliminary survey age in days, average day are measured and recorded using boar Performance Measurement System or artificial feeding
Weight gain, average daily gain and feed consumption, and the thickness of backfat is measured using living body back fat instrument.Measurement result is shown in Table 1.
The measurement result of each character of table 1
Two, the fitting of RFI data model and calculating
Based on phenotypic data measurement result (referring to table 1), the optimal RFI of fitting pig is analyzed using multiple linear regression analysis method
Model finally estimates the remaining feed intake (RFI) of individual, and data model is by shown in formula (1):
RFI=ADFI- (b1 × OnBW+b2 × OffBW+b3 × metaMidBW+b4 × ADG+b5 × BF) (1)
Wherein, ADFI is average daily gain, OnBW is preliminary survey weight, OffBW is during knot surveys weight, metaMidBW is
Between metabolic body size, ADG be average daily gain, BF is the thickness of backfat, wherein metaMidBW=[(OnBW+OFFBW)/2] × 0.75.
For ginger pig of reviving, RFI data model is specifically by shown in formula (2):
RFI=ADFI+0.11323 × OnBW+0.11673 × OffBW-0.96405 × metaMidBW-0.30524 ×
ADG-0.02367×BF) (2)
Measurement result is shown in Table 2.
2 RFI measurement result of table
Three, the low RFI of Soviet Union ginger pig is horizontally selected
In the present invention, to the selection of low RFI level Soviet Union ginger pig, not only only account for RFI it is horizontal itself, it is also contemplated that it is flat
Equal daily gain and the thickness of backfat the two factors.For this purpose, the present inventor using RFI as objective trait, with average daily gain (ADG) and carries on the back
Fat thickness (BF) is constraint character, has calculated separately RFI breeding value (EBV according to such as dragRFI), ADG breeding value (EBVADG) and
Thickness of backfat breeding value (EBVBF):
EBVRFI=ADFI-group-year-onage-OffBW-ADG-BF-e (3)
EBVADG=ADG-group-year-onage-e (4)
EBVBF=BF-group-year-OffBW-e (5)
Wherein ADFI is average daily gain, and OffBW is that knot surveys weight, and at the onage preliminary survey age, ADG is average daily gain,
BF is the thickness of backfat, and group is measurement group, and year is the measurement time, and e is random residual.
EBVRFI、EBVADGAnd EBVBFCalculating carried out by GPS software, the results are shown in Table 3.
3 breeding value result of table
Then, it is calculated using formula (6) multiple selection index (I):
I=-aEBVRFI+bEBVADG-cEBVBF (6)
In the present invention, for objective trait (remaining feed intake (RFI)) and constraint character (average daily gain (ADG) and
The thickness of backfat (BF)) weight, setting RFI breeding value accounts for 75%, average daily gain breeding value accounts for 15%, and average backfat is thick
Account for 10%.It can further to define above for the formula (6) for calculating multiple selection index (I) as following formula (7) as a result:
I=-0.75EBVRFI+0.15EBVADG-0.1EBVBF (7)
According to the numerical value being calculated, select I value for the individual of 0.24-1.62, which is the individual of low RFI level,
Its RFI level is- 0.214 Kg/d to -0.106 Kg/d.Multiple selection index (I) the results are shown in Table 4.
4 multiple selection index of table (I) selection result
The individual selected using different multiple selection indexes (I), production traits result is as follows, wherein low RFI horizontal
Feed consumption of the feed consumption of body lower than the horizontal individual of high RFI.
The 5 height RFI individual production traits of table
| Low RFI (n=9) | High RFI (n=10) | |
| Feed consumption (Kg) | 179.6±2.64 | 185.2±3.27 |
| Average daily gain (g/d) | 655.3±4.32 | 671.2±2.83 |
| Average backfat thickness (cm) | 2.92±2.1 | 2.85±3.3 |
The screening for the allele that embodiment 2. has a significant impact feed efficiency
One, 220 parts of blood are acquired from the Soviet Union ginger pig boar used in embodiment 1, are extracted using Na-OH two-step method
DNA, the method is as follows: FTA card punches (diameter 1.2mm) sampling, and 200 microlitres of 20mMNaOH impregnate blood sample dot 30 minutes, exhaustion
Discoloration liquid is added 200 microlitres of 1 times of TE and is placed at room temperature for 5 minutes, and exhaustion raffinate follows the steps below after blood sample dot is dry.
Two, allelic gene typing is analyzed
The used primer of PCR amplification is as follows:
The amplimer of serpinA3 gene is to (primer pair 1) are as follows:
Upstream primer (SEQ ID NO 1): AGCCTCTTCACCCTTCTAGGCCG
Downstream primer (SEQ ID NO 2): GTAGAGGCTGAAGGCGAAGTCA
The amplimer of vitronectin gene is to (primer pair 2) are as follows:
Upstream primer (SEQ ID NO 3): AGGCAACTCCTCTTCTCTG
Downstream primer (SEQ ID NO 4): GCTTGCACTCGGCCACGTAGT
The PCR reaction system of above-mentioned two pairs of primers are as follows:
These two pair primer PCR reaction condition are as follows: 95 DEG C initial denaturation 5 minutes, 94 DEG C be denaturalized 30 seconds, annealing 30 seconds (annealing temperature
Degree: primer pair 1 be 58 DEG C, primer pair 2 be 60 DEG C), 72 DEG C extend 45 seconds, finally again 72 DEG C extend 10 minutes.
After PCR amplification, SSCP parting is carried out to the PCR product obtained through these two pair primer amplification, the specific method is as follows:
20 μ l PCR products and 60 μ l are denaturalized sample-loading buffer (98% deionized formamide, 10mM EDTA, 0.025%
Bromophenol blue, 0.025% dimethylbenzene blueness FF) mixing, 105 DEG C are denaturalized 5 minutes, and ice bath is 10 minutes cooling immediately, 10% (primer pair 1)
With 14% (primer pair 2) non-denaturing polyacrylamide gel under 10.5 DEG C of room temperature, 4.2 DEG C of SAPMAC method, 390V voltage electrophoresis 19
Hour, it develops the color and takes pictures after silver staining.It is detected as homozygous and heterozygous banding pattern sample to SSCP to be sequenced respectively, acquisition passes through these two pair
The allele that primer amplification obtains, in which:
First allele of serpinA3 gene (is designated herein as A1Allele) sequence it is as follows,
In: overstriking underscore part indicates exon:
Second allele of serpinA3 gene (is designated herein as B1Allele) sequence it is as follows,
In: overstriking underscore part indicates exon, and it is relative to A1Allele is only variant at the 123rd, changes into from A
C hereafter adds frame base in sequence:
First allelic sequences of vitronectin gene (are designated herein as A2Allele) sequence such as
Under, in which: overstriking underscore part indicates exon:
Second allelic sequences of vitronectin gene (are designated herein as B2Allele) sequence such as
Under, in which: overstriking underscore part indicates exon, and it is only variant at the 306th relative to A2 gene, changes from T
For C, i.e., hereafter add frame base in sequence:
The third allelic sequences of vitronectin gene (are designated herein as C2Allele) sequence such as
Under, in which: overstriking underscore part indicates exon, and it is only variant at the 137th relative to A2 gene, changes from G
For A, i.e., hereafter add frame base in sequence:
Three, significant allele determines
Significant allele determines that the specific method is as follows:
Using general linear Mixed effect model (GLMM) assessment allele presence/missing to the shadow of feed consumption
It rings.For objective trait feed consumption, the presence of allele and missing are respectively defined as 1 and 0.Consider allele effect
Answer, sex-effects and age effect are fixed factor, family effect is enchancement factor, and following model is cooperated to carry out least square
Difference analysis,
Yijkng=μ+Mi+Gj+Wg+Ck+Xn+eijkng
Wherein: YijkngFor objective trait；μ is community average；MiFor genotype, allele effect；GjFor age effect
It answers；WgFor sex-effects；CkFor family effect；XnFor second level or the above reciprocal effects of second level；eijkngFor random residual effect.
It analyzes result and uses " average+standard error ", wherein P < 0.05 is the level of signifiance, and P < 0.1 indicates the trend that has an impact,
P > 0.15 indicates no influence.
Analysis the results are shown in Table 6.From this table it can be seen that carrying B1Allele (178 ± 2.48Kg, P < 0.05) and B2
The individual of allele (176.1 ± 5.38Kg, P < 0.05), feed consumption are significantly lower.
Influence (weight stage 30Kg-90Kg) of 6 allele of table to pannage consumption
From the foregoing, it will be observed that judging individual allele B by carrying out SSCP detection to sample to be tested1And B2SSCP banding pattern, can
Allele B is carried with selection1And/or B2The individual of SSCP banding pattern, for cultivating.
The present invention is described in detail by generality explanation and specific embodiment above, but in the present invention
On the basis of, it can be modified or is improved, this will be apparent to those skilled in the art.Therefore, not
These modifications or improvements on the basis of deviation spirit of that invention, fall within the scope of the claimed invention.
Bibliography
[1] Jing Rongbin, propitious essay woods, Zhao Xuting wait Soviet Union's ginger pig new varieties culture and prospect [J], and pig industry is scientific, and 2016,33
(8): 129-132.
[2]Baxter MR.The Design of the Feeding Environment for the Pig[D].PhD
Thesis:University of Aberdeen,1986.
[3]Saintilan R,Merour I,Brossard L,et al.Genetics of residual feed
intake in growing pigs:relationships with production traits,and nitrogen and
phosphorus excretion traits[J].Journal of Animal Science,2013,91(6):2542-
2554.
[4]Patience JF,Rossoni-serao MC,Gutierrez NA.A review of feed
efficiency in swine:biology and application[J],Jouranl of Animal Science
Biotechnology,2015,6(1):33.
[5]Koch RM,Gregory KE,Chambers D,et al.Efficiency of feed use in beef
cattle[J],Journal of Animal Science,1963,22:486-94.
[6]Dehaer,LCM and Devries AG.Feed-intake patterns of and feed
digestibility in growing pigs housed individually or in groups[J],Proceeding
Science,1993,33:277-292.
[7]Vallimont JE,Dechow CD,Daubert JM.Heritability of gross feed
efficiency and associations with yield,intake,residual intake,body weight,and
body condition score in 11 commercial Pennsylvania tie stalls[J],Journal of
Dairy Science,2011,94(4):2108-2113.
[8]Liermann W,Berk A,Boschen V,et al.Effects of diets differing in
protein source and technical treatment on digestibility,performance and
visceral and biochemical parameters of fattening pigs[J],Archives of Animal
Nutrition,2016,70(3):190-208.
[9]Camara L,Berrocoso JD,Coma J,et al.Growth performance and carcass
quality of crossbreds pigs from two Pietrain sire fines fed isoproteic diets
varying in energy concentration[J],Meat Science,2016,114:69-74.
[10]Addah W,Dzewu RR,Alenyorege B.Effects of dietary restriction
followed by high dietary energy or protein on compensatory growth of Ashanti
Black x Large White crossbred weaner pigs[J],Tropical Animal Health and
Production,2015,1-6.
[11]Kennedy BW,Vanderwerf JHJ,Meuwissen THE.Genetic and statistical
properties of residual feed-intake[J],Journal of Animal Science,1993,71:3239-
3250.
[12]Cai W,Casey DS,Dekkers JCM.Selection response and genetic
parameters for residual feed intake in Yorkshire swine[J],Journal of Animal
Science,2008,86:287-298.
[13]Jegou M,Gondret F,Vincent A,et al.Whole blood transcriptomics is
relevant to identify molecular changes in response to genetic selection for
feed efficiency and nutritional status in the pig[J],Plos One,2016,11(1):
e0146550.
[14]Jing L,Hou Y,Wu H,et al.Transcriptome analysis of mRNA and miRNA
in skeletal muscle indicates an important network for differential residual
feed intake in Pigs[J],Scientific Reports,2014(5):11953.
[15]Vincent A,Louveau I,Gondret F,et al.Divergent selection for
residual feed intake affects the transcriptomic and proteomic profiles of pig
muscle[J],Journal of Animal Science,2015,93(6):2745-2758.
[16]Do DN,Starthe AB,Ostersen T,et al.Genome-wide association and
pathway analysis of feed efficiency in pigs reveal candidate genes and
pathways for residual feed intake[J],Front Genetics,2014,(5):307.
[17]Vigors S,Sweeney T,Oshea CJ,et al.Pigs that are divergent in feed
efficiency,differ in intestinal enzyme and nutrient transporter gene
expression,nutrient digestibility and microbial activity[J],Animal,2016,10
(11):1848-1855.
Sequence table
<110>Jiangsu Agri-Animal Husbandry Vocational College
<120>application and its selection of serpinA3 the and vitronectin gene in Soviet Union's ginger boar breeding
<130> CF180506S
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
agcctcttca cccttctagg ccg 23
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gtagaggctg aaggcgaagt ca 22
<210> 3
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aggcaactcc tcttctctg 19
<210> 4
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gcttgcactc ggccacgtag t 21
<210> 5
<211> 408
<212> DNA
<213>ginger pig (Sujiang Sus scrofa) is revived
<400> 5
agcctcttca cccttctagg ccgtttccca ctgggaaaag cagcagctgt tacagtgctt 60
gctggcaagg ctgaagggaa gctccgggta taacaatgca cacaggctcc ccaggagggc 120
gcatacccat acccatcgga ggtcacagag ccagctagtg gcacagagga ggcagcggga 180
ggctctcggg gcttggtctg gccctgcctg ctcagatgat ctttgctttt cagagtggag 240
acgatgtcac ccctcctggc tctggggctc ttgttggccg ggttctgtcc tgctgtcttc 300
tgccaccctg gtggcccaac aaaggccgct gaggacggag acaatgggat gcacgtggac 360
agcctcagcc tggcttccag aaacactgac ttcgccttca gcctctac 408
<210> 6
<211> 408
<212> DNA
<213>ginger pig (Sujiang Sus scrofa) is revived
<400> 6
agcctcttca cccttctagg ccgtttccca ctgggaaaag cagcagctgt tacagtgctt 60
gctggcaagg ctgaagggaa gctccgggta taacaatgca cacaggctcc ccaggagggc 120
gcctacccat acccatcgga ggtcacagag ccagctagtg gcacagagga ggcagcggga 180
ggctctcggg gcttggtctg gccctgcctg ctcagatgat ctttgctttt cagagtggag 240
acgatgtcac ccctcctggc tctggggctc ttgttggccg ggttctgtcc tgctgtcttc 300
tgccaccctg gtggcccaac aaaggccgct gaggacggag acaatgggat gcacgtggac 360
agcctcagcc tggcttccag aaacactgac ttcgccttca gcctctac 408
<210> 7
<211> 385
<212> DNA
<213>ginger pig (Sujiang Sus scrofa) is revived
<400> 7
aggcaactcc tcttctctgg ttccctcatc catgacctct catctctctg tcccttcctc 60
aggcatcaga acctagttta ccagacgtga ggccggaggt gctgccatgg cacccctgag 120
gccccttctg atgctggccc tgctggcatg ggttgctctg gctgaccaag gtgcgggagg 180
atatggatat tggtgaccat ttgggtcaat gtagggtggg taagtgtggc ctggcctggg 240
cggtgccagc tgtcatactc cctctccaca gagtcgtgca agggccgctg cacagacggc 300
ttcattgccg aaaggaagtg tcagtgtgac gagctgtgct cttactacca gagctgctgc 360
gctgactacg tggccgagtg caagc 385
<210> 8
<211> 385
<212> DNA
<213>ginger pig (Sujiang Sus scrofa) is revived
<400> 8
aggcaactcc tcttctctgg ttccctcatc catgacctct catctctctg tcccttcctc 60
aggcatcaga acctagttta ccagacgtga ggccggaggt gctgccatgg cacccctgag 120
gccccttctg atgctggccc tgctggcatg ggttgctctg gctgaccaag gtgcgggagg 180
atatggatat tggtgaccat ttgggtcaat gtagggtggg taagtgtggc ctggcctggg 240
cggtgccagc tgtcatactc cctctccaca gagtcgtgca agggccgctg cacagacggc 300
ttcatcgccg aaaggaagtg tcagtgtgac gagctgtgct cttactacca gagctgctgc 360
gctgactacg tggccgagtg caagc 385
<210> 9
<211> 385
<212> DNA
<213>ginger pig (Sujiang Sus scrofa) is revived
<400> 9
aggcaactcc tcttctctgg ttccctcatc catgacctct catctctctg tcccttcctc 60
aggcatcaga acctagttta ccagacgtga ggccggaggt gctgccatgg cacccctgag 120
gccccttctg atgctgaccc tgctggcatg ggttgctctg gctgaccaag gtgcgggagg 180
atatggatat tggtgaccat ttgggtcaat gtagggtggg taagtgtggc ctggcctggg 240
cggtgccagc tgtcatactc cctctccaca gagtcgtgca agggccgctg cacagacggc 300
ttcatcgccg aaaggaagtg tcagtgtgac gagctgtgct cttactacca gagctgctgc 360
gctgactacg tggccgagtg caagc 385
Claims (10)
1. a kind of method of breeding Soviet Union ginger boar, the described method comprises the following steps:
I. Genotyping detection is carried out to the serpinA3 gene and/or vitronectin gene of Soviet Union ginger boar；
Ii. selection carries the significant allele B of serpinA3 gene1And/or the significant allele B of vitronectin gene2
Soviet Union ginger boar be left kind of a use.
2. the method for breeding according to claim 1 Soviet Union ginger boar, the wherein significant allele B of serpinA3 gene1Have
Sequence shown in SEQ ID NO 6, the significant allele B of vitronectin gene2With shown sequence.
3. according to claim 1 to the method for 2 described in any item breedings Soviet Union ginger boars, wherein Genotyping described in step i
Using PCR-SSCP typing.
4. the method for breeding Soviet Union according to claim 3 ginger boar, wherein serpinA3 gene is SEQ using primer pair 1
ID NO 1 and SEQ ID NO 2 carries out PCR amplification, and vitronectin gene is SEQ ID NO 3 and SEQ using primer pair 2
ID NO 4 carries out PCR amplification.
5. the method for breeding Soviet Union according to claim 1-4 ginger boar, wherein in the advance for carrying out the step i
Row following steps:
A1 the phenotypic data to breeding Soviet Union ginger boar) is measured, the phenotypic data includes: preliminary survey weight, knot survey weight, average day
Feed intake, intermediate supersession weight, the thickness of backfat and average daily gain；
A2 remaining feed intake breeding value EBV) is calculatedRFIWith multiple selection index I；
A3 multiple selection index I) is selected to continue step i to step ii for the individual of 0.24-1.62.
The application of 6.serpinA3 gene and/or vitronectin gene in breeding Soviet Union ginger boar.
7. application according to claim 6, wherein selection carries the significant allele B of serpinA3 gene1And/or
The significant allele B of vitronectin gene2Soviet Union ginger boar be left kind of a use；Preferably, the significant equipotential base of serpinA3 gene
Because of B1With sequence SEQ ID NO 6, the significant allele B of vitronectin gene2With sequence.
8. a kind of kit for breeding Soviet Union ginger boar, the kit include:
A) for expanding the primer pair 1 of serpinA3 gene, and/or the primer pair 2 for expanding vitronectin gene；With
And
B) operation instructions of this kit breeding Soviet Union ginger boar are utilized.
9. kit according to claim 8, wherein the upstream primer sequence of the primer pair 1 includes SEQ ID NO 1,
Downstream primer sequence includes SEQ ID NO 2.
10. kit according to claim 8 or claim 9, wherein the upstream primer sequence of the primer pair 2 includes SEQ ID
NO 3, downstream primer sequence include SEQ ID NO 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811179396.5A CN109385481B (en) | 2018-10-10 | 2018-10-10 | Application of serpinA3 and vitronectin genes in Sujiang boar breeding and breeding method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811179396.5A CN109385481B (en) | 2018-10-10 | 2018-10-10 | Application of serpinA3 and vitronectin genes in Sujiang boar breeding and breeding method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109385481A true CN109385481A (en) | 2019-02-26 |
| CN109385481B CN109385481B (en) | 2021-07-23 |
Family
ID=65426890
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811179396.5A Active CN109385481B (en) | 2018-10-10 | 2018-10-10 | Application of serpinA3 and vitronectin genes in Sujiang boar breeding and breeding method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109385481B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110622911A (en) * | 2019-09-01 | 2019-12-31 | 吉林大学 | Selection method capable of simultaneously improving pig feed efficiency and growth speed |
| CN114742290A (en) * | 2022-03-30 | 2022-07-12 | 东北农业大学 | Method for predicting conversion efficiency of white feather broiler feed through plasma metabolite abundance modeling |
| TWI786916B (en) * | 2021-11-01 | 2022-12-11 | 基育生物科技股份有限公司 | Genomic estimated breeding value for predicting a trait and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858441A (en) * | 2017-11-14 | 2018-03-30 | 中国农业大学 | To pig up to the related SNP marker of 100kg body weight age in days characters and its application |
| CN108300789A (en) * | 2017-11-14 | 2018-07-20 | 中国农业大学 | With the relevant SNP marker of the multiple important economical traits of pig and its application |
-
2018
- 2018-10-10 CN CN201811179396.5A patent/CN109385481B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858441A (en) * | 2017-11-14 | 2018-03-30 | 中国农业大学 | To pig up to the related SNP marker of 100kg body weight age in days characters and its application |
| CN108300789A (en) * | 2017-11-14 | 2018-07-20 | 中国农业大学 | With the relevant SNP marker of the multiple important economical traits of pig and its application |
Non-Patent Citations (3)
| Title |
|---|
| B. M. PATTERSON: "Serpina3 and Vitronectin as Biomarkers for Feed Efficiency in Swine", 《MEAT AND MUSCLE BIOLOGY》 * |
| J. K. GRUBBS: "Identification of potential serum biomarkers to predict feed efficiency in young pigs", 《J ANIM SCI》 * |
| RONGRONG DING: "Genome-wide association analysis reveals genetic loci and candidate genes for feeding behavior and eating efficiency in Duroc boars", 《PLOS ONE》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110622911A (en) * | 2019-09-01 | 2019-12-31 | 吉林大学 | Selection method capable of simultaneously improving pig feed efficiency and growth speed |
| TWI786916B (en) * | 2021-11-01 | 2022-12-11 | 基育生物科技股份有限公司 | Genomic estimated breeding value for predicting a trait and its application |
| CN114742290A (en) * | 2022-03-30 | 2022-07-12 | 东北农业大学 | Method for predicting conversion efficiency of white feather broiler feed through plasma metabolite abundance modeling |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109385481B (en) | 2021-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fortes et al. | Finding genes for economically important traits: Brahman cattle puberty | |
| Taylor et al. | Candidate gene analysis of GH1 for effects on growth and carcass composition of cattle | |
| Sheng et al. | Genetic dissection of growth traits in a Chinese indigenous× commercial broiler chicken cross | |
| Tyulebaev et al. | The state of polymorphism of genes affecting the meat quality in micropopulations of meat simmentals | |
| CN101828539A (en) | Method for breeding Sujiang pig variety | |
| CN113699250B (en) | Molecular marker related to broiler feed conversion efficiency character and application thereof | |
| CN109371143B (en) | SNP molecular marker associated with pig growth traits | |
| CN109385481A (en) | Application and its selection of serpinA3 the and vitronectin gene in Soviet Union's ginger boar breeding | |
| Dzhulamanov et al. | Polymorphisms of CAPN1, CAST, GDF5, TG5 and GH genes in Russian Hereford cattle. | |
| CN105063021B (en) | The SNP marker related to label of pig fat deposition description and its application | |
| CN101792798A (en) | Method for breeding new variety of Sutai ETEC F18+ and disease resistant pigs | |
| CN109371144B (en) | SNP molecular marker associated with pig growth traits | |
| CN104946776A (en) | Chicken FABP4 gene molecular genetic marker related to good chicken slaughtering character and application of chicken FABP4 gene molecular genetic marker | |
| Zhang et al. | Whole genomic prediction of growth and carcass traits in a Chinese quality chicken population | |
| Teng et al. | Performance of whole genome prediction for growth traits in a crossbred chicken population | |
| CN110358840A (en) | The SNP molecular genetic marker of TPP2 gene relevant to remaining feed intake | |
| CN113699246B (en) | SNP molecular marker affecting pig feed conversion efficiency character and application thereof | |
| Sakar et al. | Determination of the relationship between Anatolian black cattle growth properties and myostatin, GHR and Pit-1 gene | |
| CN104911273B (en) | A kind of chicken FABP1 gene molecule genetic marker related to the excellent production traits of chicken and its application | |
| Dubovskova et al. | Use of genetic markers of meat productivity in breeding of Hereford breed bulls | |
| Kim et al. | Estimation of breeding value and accuracy using pedigree and genotype of Hanwoo cows (Korean cattle) | |
| CN104593363A (en) | Excellent slaughter trait molecular genetic marker of broiler chicken and application of excellent slaughter trait molecular genetic marker | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| Schiavo et al. | Genome-wide association analyses for coat colour patterns in the autochthonous Nero Siciliano pig breed | |
| CN101544979B (en) | Major gene for porcine intramuscular fat deposition and molecular marker thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |