CN109321667A - Polynucleotides, method and kit for the detection of pathogenic escherichia coli - Google Patents

Abstract

The present invention provides the polynucleotides, method and the kits that detect for pathogenic escherichia coli, specifically, the invention discloses the primer pairs and probe that can be used in pathogenic escherichia coli detection, when carrying out real-time fluorescence PCR detection to the DNA of aimed strain, with splendid specificity and sensitivity, and have good stability.

Description

Polynucleotides, method and kit for the detection of pathogenic escherichia coli

Technical field

The invention belongs to field of biotechnology, specifically, the present invention relates to detect for pathogenic escherichia coli Polynucleotides, method and kit.

Background technique

Escherichia coli (E.coli) is commonly referred to as Escherichia coli, is taken as the composition portion of normal the gut flora always Point, it is considered to be non-pathogenic bacteria.Until 20 middle of century, just recognize the Escherichia coli of some special serotypes to humans and animals There is pathogenicity often to cause severe diarrhea and septicemia especially to baby and cub, can be caused a disease according to different biological characteristics Escherichia coli fall into 5 types: enteropathogenic E. Coli (EPEC), enterotoxigenic E.Coli (ETEC), intestines invasion large intestine bar Bacterium (EIEC), enterohemorrhagic escherichia coli (EHEC), intestines adhesion Escherichia coli (EAEC).

Currently, the common detection method multiplicity in E. coli detection, differs from one another.Traditional detection method needs first to divide It is the method for identification bacterium general in the world then with classical method identification from being further cultured for.Time-consuming for this kind of cultivation, Sensitivity is low.Simply, conveniently, rapidly, but cross reaction is than more serious, false positive is more, sensitivity is relatively low for immunological method.

Therefore, in order to which enteropathogenic E. Coli is effectively detected, there is an urgent need in the art to develop specific good, sensitivity High, simple and convenient pathogenic escherichia coli assay method.

Summary of the invention

The purpose of the present invention is to provide a kind of polynucleotides, method and examinations for the detection of pathogenic escherichia coli Agent box.

In the first aspect of the present invention, a kind of primer pair for detecting pathogenic escherichia coli is provided, described draws Object is to being selected from the group:

Primer pair shown in SEQIDNO.:1 and SEQIDNO.:2；

Primer pair shown in SEQIDNO.:3 and SEQIDNO.:4；With

Primer pair shown in SEQIDNO.:5 and SEQIDNO.:6.

In another preferred example, the primer pair is selected from the group:

Primer pair shown in SEQIDNO.:1 and SEQIDNO.:2；With

Primer pair shown in SEQIDNO.:3 and SEQIDNO.:4.

In another preferred example, the primer pair are as follows:

Primer pair shown in SEQIDNO.:1 and SEQIDNO.:2

In another preferred example, the primer pair is used for real-time fluorescence quantitative PCR.

The second aspect of the present invention provides a kind of kit for detecting pathogenic escherichia coli, the kit Including primer pair described in first aspect present invention.

In another preferred example, the kit further includes probe sequence, the probe sequence such as SEQIDNO.:11 institute Show.

In another preferred example, the kit further include: Taq enzyme, dNTP, and/or Mg²⁺。

The third aspect of the present invention provides primer pair or second aspect of the present invention as described in the first aspect of the invention The purposes of the kit, the detection for pathogenic escherichia coli.

In another preferred example, it is described be detected as it is non-diagnostic or therapeutic purposes.

In another preferred example, described to be detected as fluorescence quantitative PCR detection.

The fourth aspect of the present invention provides a kind of method for detecting pathogenic escherichia coli, the method includes Step:

(1) sample to be detected is provided, and extracts DNA from the sample to be detected；

(2) obtained DNA is extracted using kit detecting step (1) described in second aspect of the present invention, to judge institute It states and whether has pathogenic escherichia coli in sample to be detected.

In another preferred example, the method is fluorescent quantitative PCR detection method.

It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist This no longer tires out one by one states.

Detailed description of the invention

Fig. 1 shows each primer pair for infection blood DNA probe Sensitivity testing result.

Fig. 2 shows the sensitivity technique result that pathogenic escherichia coli standard items are directed to using primer pair 1.

Fig. 3 show using primer pair 1 for infection blood sample in pathogenic escherichia coli DNA profiling it is sensitive Spend testing result.

Specific embodiment

The present inventor obtains by extensive and in-depth research and can be used in drawing for pathogenic escherichia coli detection Object to and probe, when carrying out real-time fluorescence PCR detection to the DNA of aimed strain, there is splendid specificity and sensitivity, and It has good stability.The present invention also provides the kits detected for pathogenic escherichia coli.

Before describing the present invention, it should be understood that the present invention is not limited to the specific method and experiment conditions, because this Class method and condition can change.It should also be understood that its purpose of the term as used herein is only that description specific embodiment, and And it is not intended to be restrictive, the scope of the present invention will be limited only by the claims which follow.

Unless otherwise defined, otherwise whole technologies used herein and scientific term all have such as fields of the present invention The normally understood identical meanings of those of ordinary skill.As used herein, in use, term in mentioning the numerical value specifically enumerated " about " mean that the value can change not more than 1% from the value enumerated.For example, as used herein, statement " about 100 " includes 99 Hes 101 and between whole values (for example, 99.1,99.2,99.3,99.4 etc.).

Although can be used in implementation or test of the invention and heretofore described similar or of equal value any method And material, place enumerates preferred method and material herein.

The meaning that there are the term as used herein " primer " those skilled in the art routinely to understand.

It is special that primer pair of the invention can be provided simultaneously with highly sensitive and height in pathogenic escherichia coli DNA Property, the delicately pathogenic large intestine angstrom in testing product, such as environmental sample, food, health care product, cosmetics so as to accurate Whether contain pathogenic escherichia coli in uncommon Salmonella content or blood sample, tissue samples, for infectious disease The diagnosis of disease.

The meaning that there are the term as used herein " probe " those skilled in the art routinely to understand, that is, a bit of single stranded DNA Or RNA segment, for detecting the nucleic acid sequence being complementary.Probe may be in liquid phase, can also be fixed in solid phase.

In the present invention, the target sequence of pathogenic escherichia coli primed probe design is as follows:

1tttttattttttaatgtatttgtacatggagaaaataaagtgaaacaaagcactattgca

61ctggcactcttaccgttactgtttacccctgtgacaaaagcccggacaccagaaatgcct

121gttctggaaaaccgggctgctcagggcgatattactgcacccggcggtgctcgccgttta

181acgggtgatcagactgccgctctgcgtgattctcttagcgataaacctgcaaaaaatatt

241attttgctgattggcgatgggatgggggactcggaaattactgccgcacgtaattatgcc

301gaaggtgcgggcggcttttttaaaggtatagatgccttaccgcttaccggg(SEQIDNO.10)

Table 1

The present invention also provides a kind of detection reagent for detecting pathogenic escherichia coli genomic DNA, the detection examination Agent includes other ingredients needed for primer pair and probe of the invention etc. implement PCR, such as Taq enzyme, dNTP, Mg²⁺Etc..

In a particular embodiment, the detection sensitivity of detection reagent of the present invention reaches 1fg/ μ L.

On the basis of primer pair or detection reagent of the invention, the present invention further provides a kind of pathogenic large intestines of detection The method of Escherichia genomic DNA, which comprises primer pair or detection reagent of the invention are utilized, to sample to be tested PCR is carried out, and detects pcr amplification product.

It include holding in the kit the present invention also provides a kind of PCR kit on the basis of primer pair of the invention Device and the primer pair according to the present invention in the container；And/or probe.

In a particular embodiment, standard control is also equipped in the kit.

On the basis of primer pair of the invention, the present invention, which provides, utilizes primer pair amplifies target product of the invention PCR method.

Main advantages of the present invention are:

Obtain one section of the present invention can be used in the primer pair and probe of pathogenic escherichia coli detection, to object bacteria When the DNA of strain carries out real-time fluorescence PCR detection, there is splendid specificity and sensitivity, and have good stability.

Combined with specific embodiments below, the further old present invention in detail.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.The experimental method of detailed conditions is not specified in the following example, usually according to conventional strip Part such as U.S. Sambrook.J etc. writes " Molecular Cloning: A Laboratory room guide " (Huang Peitang etc. is translated, Beijing: Science Press, 2002) Described in condition, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number be by weight It calculates.Experimental material used in following embodiment and reagent can obtain unless otherwise instructed from commercially available channel.

Material and method

1. sample processing reagent: (column purification recycling) includes Proteinase K 20mg/ml, and gram-positive bacteria need to add bacteriolyze Enzyme, pre-treatment buffer, combination buffer, washing buffer, elution buffer, column, collecting pipe, 1.5ml centrifuge tube.

2.DNA detection architecture:

2x Taqman mix: contain Taq enzyme, dNTP, Mg²⁺, the ingredients such as primer and probe of the present invention.

Standard items, negative Quality Control, DNA dilution

3. instrument: Roche 480 II.

4. experimental implementation and process

The purifying of 4.1 extracting genome DNAs (carries out) according to kit specification operating procedure

1) 20 μ l Proteinase K is added in 1.5ml centrifuge tube (specific volume is adjustable according to sample size).

2) sample is added, 200 μ l buffer GB are added, lashes mixing or oscillation mixes.

3) centrifuge tube is placed in 56 DEG C, until tissue digestion completely.

4) 200 μ l dehydrated alcohols are added in every hole, lash mixing or oscillation mixes, be placed at room temperature for 5 minutes.

5) 15 μ l bead suspension B are added in every hole, lash mixing or oscillation mixes.

6) centrifuge tube is placed on magnetic frame and stands 30 seconds, carefully remove liquid when magnetic bead adsorbs completely.

7) centrifuge tube is removed from magnetic frame, 500 μ l buffer GD is added, lashed mixing or oscillation mixes.

8) centrifuge tube is placed on magnetic frame and stands 30 seconds, carefully remove liquid when magnetic bead adsorbs completely.

9) centrifuge tube is removed from magnetic frame, 600 μ l rinsing liquid PW is added, lashed mixing or oscillation mixes.

10) centrifuge tube is placed on magnetic frame and stands 30 seconds, carefully remove liquid when magnetic bead adsorbs completely；

11) repetitive operation step 9,10, liquid feed removal are clean.

12) centrifuge tube on magnetic frame, dry 10-15 minutes by room temperature.

13) centrifuge tube is removed from magnetic frame, 50-100 μ l eluent TB is added, lashed mixing oscillation and mix, be placed in It 56 DEG C, is incubated for 10 minutes.

14) centrifuge tube is placed on magnetic frame and stands 30 seconds, be carefully transferred to DNA solution when magnetic bead adsorbs completely Collecting board, and saved in felicity condition.

4.2 detection

1) according to primed probe concentration, appropriate ddH2O is added, is diluted to 100uM；

2) by primer, probe dilution to 10* working solution concentration (working solution concentration: primer 0.3-1uM, probe 0.05- 0.2uM)；

3) PCR reaction system

4) PCR reaction condition

According to standard curve obtained, the amount of pathogenic escherichia coli DNA in sample to be examined is calculated.

1 specific detection of embodiment

For the conserved DNA sequences (SEQ ID NO.:10) of pathogenic escherichia coli, the present inventor devises tens of To primer, precious bioengineering (Dalian) Co., Ltd is transferred to synthesize the primer and probe of design, Master Mix is purchased from Roche Company.Laboratory apparatus includes: real-time fluorescence quantitative PCR amplification instrument (Roche II) centrifuge, thermostat water bath, incubator, day Equality.

Real-time fluorescence PCR detection:

It is detected, real-time fluorescence PCR detection body using the primer and probe of design (typical as shown in table 1) respectively The method and condition of system is as described above.

Test strain includes: that pathogenic escherichia coli, staphylococcus aureus, streptococcus pneumonia, kerekou pneumonia are white The narrow food sporangium of bacillus, pseudomonas aeruginosa, Acinetobacter bauamnnii, thermophilic malt, enterococcus faecalis, enterococcus faecium, mycoplasma pneumoniae, Legionella, tubercle bacillus carry out real-time fluorescence PCR detection after extracting the genomic DNA of each bacterial strain respectively using kit.

Table 2

Object bacteria

Primer pair 1

Primer pair 2

Primer pair 3

Primer pair 4

Primer pair 5

Primer pair 6

Primer pair 7

Primer pair 8

Primer pair 9

Primer pair 10

Pathogenic escherichia coli

+

+

+

+

+

+

-

+

-

+

Staphylococcus aureus

-

-

-

-

-

-

-

-

-

-

Streptococcus pneumonia

-

-

-

-

-

-

-

-

-

+

Bacillus canalis capsulatus

-

-

-

-

-

-

-

-

-

-

Pseudomonas aeruginosa

-

-

-

-

-

-

-

-

-

-

Acinetobacter bauamnnii

-

-

-

-

-

+

-

-

+

-

The thermophilic narrow food sporangium of malt

-

-

-

-

-

-

-

-

-

-

Enterococcus faecalis

-

-

-

-

+

-

-

+

-

-

Enterococcus faecium

-

-

-

-

+

-

-

-

+

-

Mycoplasma pneumoniae

-

-

-

-

-

-

-

-

-

-

Legionella

-

-

-

-

-

-

-

-

-

-

Tubercle bacillus

-

-

-

-

-

-

-

-

-

-

Note: "+" indicates that testing result is the positive, and "-" indicates that testing result is feminine gender.

Typical testing result is as shown in table 2, the results showed that in designed primer and probe, primer pair 1, primer pair 2, Primer pair 3, the specificity of primer pair 4 preferably, are capable of detecting when pathogenic escherichia coli, and to other bacterial strains without sun Property reaction.

Strain culturing number is as follows:

2 sensitivity technique of embodiment

(Guangdong institute of microbiology, strain number ATCC are purchased from for pathogenic escherichia coli reference culture 35150) sensitivity technique:

Extract the genomic DNA of pathogenic escherichia coli reference culture, extract Post genome DNA concentration adjust to Then 1ng/ul carries out gradient dilution detection (1ng/ul DNA, dilution 1/10/100/1000/10000/100000).

Table 3: Escherichia coli probe Sensitivity

Sample	Dilution (ng/ul)	CT
			Pathogenic escherichia coli	1	17.05
Pathogenic escherichia coli	0.1	20.05
			Pathogenic escherichia coli	0.01	23.8
Pathogenic escherichia coli	0.001	27.43
			Pathogenic escherichia coli	0.0001	30.87
Pathogenic escherichia coli	0.00001	34.39

For pathogenic escherichia coli in infection blood sample, (patient blood sample comes from the attached middle mountain of Fudan University Respiratory disease research institute of hospital) sensitivity technique:

The DNA in infection blood sample is extracted, extracting method is as follows:

1) 25ul Qiagen protease is added in 1.5ml centrifuge tube；

2) 200ul serum or blood plasma is added；

3) 200ul AL is added and cracks buffer, vortex 15s；

4) 56 DEG C of pre- 15min of temperature；

5) after of short duration centrifugation, 250ul dehydrated alcohol is added, vortex 15s is stored at room temperature 5min；

6) after of short duration centrifugation, all liq is transferred to QIAamp MinElute column, 6,000g, centrifugation 1min, abandoning Filtrate；

7) 500ul AW1 solution is added, 6,000g centrifugation 1min abandon filtrate；

8) 500ul AW2 solution is added, 6,000g centrifugation 1min abandon filtrate；

9) 500ul dehydrated alcohol, 6,000g, centrifugation 1min, abandoning filtrate is added；

10) the 2ml centrifuge tube renewed, 20,000g, it is centrifuged 3min；

11) the 2ml centrifuge tube renewed opens filter column pipe lid, filter membrane is dried；

12) filter column is transferred to 1.5ml centrifuge tube, 20ul AVE buffer, room temperature 5min, 20,000g centrifugations is added 1min；

Genomic DNA after extraction is expanded to (KAPA2G Robust HotStart in advance using specific primer ReadyMix PCR Kit),

Pre- amplification PCR condition is as follows:

PCR reaction condition

According to standard curve obtained, the amount of pathogenic escherichia coli DNA in sample to be examined is calculated.

Table 4: infection blood DNA probe Sensitivity

Gene	Name	Ct
			Primer 1	Infect blood	10.18
Primer 1	Infect blood	10.39
			Primer 1	Infect blood	10.34
Primer 2	Infect blood	18.2
			Primer 2	Infect blood	17.77
Primer 2	Infect blood	17.86
			Primer 3	Infect blood	25.79
Primer 3	Infect blood	26.18
			Primer 3	Infect blood	26.13
Primer 4	Infect blood	>35
			Primer 4	Infect blood	>35
Primer 4	Infect blood	>35

Experimental result

The preferable primer pair 1 of specificity, primer pair 2, primer pair 3,4 bonding probes of primer pair are surveyed in this example Examination, the results showed that

The detection effect of primer pair 1 is best, detection sensitivity highest, the target sequence of minimum detectable 1.77copy/ μ L, And occur without nonspecific band, to the pathogenic escherichia coli genome in reference culture and infection blood sample DNA is detectable.

Fig. 1 shows each primer pair for infection blood DNA probe Sensitivity testing result.

Fig. 2 shows the sensitivity technique result that pathogenic escherichia coli standard items are directed to using primer pair 1.

Fig. 3 show using primer pair 1 for infection blood sample in pathogenic escherichia coli DNA profiling it is sensitive Spend testing result.

Using Escherichia coli type strain, concentration is expanded from 1ng/ μ L, 10 times of gradient dilutions to 0.00001ng/ μ L, primer 1 CT value shows extraordinary linear relationship.Blood sample DNA Linear Amplifer is infected, it is linear with standard items (0.00001ng/ μ L) Amplify CT value to approach, illustrates the detection of the entirely appropriate infection blood of primer 1.

The detection sensitivity of primer pair 2 is lower, is able to detect that the target sequence of 0.0001ng/ μ L.

Primer pair 3 is able to detect that the target sequence of 0.001ng/ μ L to reference culture, but to infection blood sample Detection sensitivity is poor, is only capable of detecting the target sequence for being equivalent to 1000copy/ μ L.

Primer pair 4 is able to detect that the target sequence of 0.01ng/ μ L, but the detection for infecting blood sample is observed Non-specific band occurs, and to the accurate judgement of result, there are larger interferences.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Shanghai is stood upright Biotechnology Co., Ltd

<120>polynucleotides, method and the kit for the detection of pathogenic escherichia coli

<130> 00000

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 1

tggagaaaat aaagtgaaac a 21

<210> 2

<211> 18

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 2

atcgctaaga gaatcacg 18

<210> 3

<211> 21

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 3

tggagaaaat aaagtgaaac a 21

<210> 4

<211> 18

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 4

atcgctaaga gaatcacg 18

<210> 5

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 5

ggagaaaata aagtgaaaca aag 23

<210> 6

<211> 19

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 6

gtctgatcac ccgttaaac 19

<210> 7

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 7

ggagaaaata aagtgaaaca aag 23

<210> 8

<211> 18

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 8

cagtctgatc acccgtta 18

<210> 9

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 9

cctggtagtc cacgccgtaa 20

<210> 10

<211> 351

<212> DNA

<213>escherichia coli (Escherichia coli)

<400> 10

tttttatttt ttaatgtatt tgtacatgga gaaaataaag tgaaacaaag cactattgca 60

ctggcactct taccgttact gtttacccct gtgacaaaag cccggacacc agaaatgcct 120

gttctggaaa accgggctgc tcagggcgat attactgcac ccggcggtgc tcgccgttta 180

acgggtgatc agactgccgc tctgcgtgat tctcttagcg ataaacctgc aaaaaatatt 240

attttgctga ttggcgatgg gatgggggac tcggaaatta ctgccgcacg taattatgcc 300

gaaggtgcgg gcggcttttt taaaggtata gatgccttac cgcttaccgg g 351

Claims (10)

1. a kind of primer pair for detecting pathogenic escherichia coli, which is characterized in that the primer pair is selected from the group:

Primer pair shown in SEQIDNO.:1 and SEQIDNO.:2；

Primer pair shown in SEQIDNO.:3 and SEQIDNO.:4；With

Primer pair shown in SEQIDNO.:5 and SEQIDNO.:6.

2. primer pair as described in claim 1, which is characterized in that the primer pair is selected from the group:

Primer pair shown in SEQIDNO.:1 and SEQIDNO.:2；With

Primer pair shown in SEQIDNO.:3 and SEQIDNO.:4.

3. primer pair as described in claim 1, which is characterized in that the primer pair are as follows:

Primer pair shown in SEQIDNO.:1 and SEQIDNO.:2.

4. primer pair as described in claim 1, which is characterized in that the primer pair is used for real-time fluorescence quantitative PCR.

5. a kind of kit for detecting pathogenic escherichia coli, which is characterized in that the kit includes claim 1-4 Described in any item primer pairs.

6. kit as claimed in claim 5, which is characterized in that the kit further includes probe sequence, the probe sequence Column are as shown in SEQIDNO.:9.

7. kit as claimed in claim 5, which is characterized in that the kit further include: Taq enzyme, dNTP, and/or Mg^{2 +}。

8. the purposes of kit described in primer pair as claimed in claim or claim 5, which is characterized in that for causing The detection of characteristic of disease escherichia coli.

9. purposes as claimed in claim 8, which is characterized in that described to be detected as fluorescence quantitative PCR detection.

10. a kind of method for detecting pathogenic escherichia coli, which is characterized in that the method includes the steps:

(1) sample to be detected is provided, and extracts DNA from the sample to be detected；

(2) obtained DNA is extracted using kit detecting step (1) described in claim 5, to judge the test sample to be checked Whether there is pathogenic escherichia coli in this.