JP4876223B2 - Diphtheria toxin gene detection method using LAMP method and primer set used in this method - Google Patents

Description

The present invention relates to a diphtheria toxin gene detection method using the LAMP method and a primer set used in this method.

Diphtheria is an infectious disease mainly caused by the diphtheria fungus Corynebacterium diphtheriae, and is an important disease classified into two categories in Japan's Infectious Disease Law. As for diphtheria, the number of reports of patients has drastically decreased in Japan with the spread of vaccination, and there have been only a few cases in the past 10 years that have not been reported. However, it is a new memory to show that the outbreak of diphtheria in Russia in the 1990s (150,000 patients, 4000 deaths) is still far from being controlled. The importance of diphtheria surveillance and vaccination has been reaffirmed. In Europe, there have been reports of isolation of toxin-producing C. ulcerans from diphtheria-like patients. In 2001 and 2002, this bacterium was isolated and confirmed from two diphtheria-like patients in Japan. In recent years, molecular testing methods have been actively introduced in the diagnosis of various diseases, and an early and simple method is required for testing diphtheria. In addition, sporadic diphtheria has been reported in the Asian region.

Significance and Current Status of Diphtheria Toxin Gene Detection in Clinical Laboratory Sites Diphtheria toxin, the main virulence factor produced by diphtheria, plays an extremely important role in the pathogenesis of diphtheria. Whether the produced bacterium produces this diphtheria toxin is decisive for whether it is considered diphtheria as an infection.

Therefore, the current laboratory diagnosis (clinical test) is based on the proof of diphtheria toxin productivity of the isolated bacteria, and is based on the assumption that the bacteria are isolated from clinical specimens such as swabs. For this reason, it is often impossible to isolate bacteria and the diagnosis itself does not hold and end with `` suspicion of diphtheria '', and even if the bacteria is fortunately separated, until the diagnosis is confirmed through identification of the bacteria and proof of toxin production A period of nearly a week is required. Diphtheria is a type 2 infectious disease that requires isolation, and it is required to expedite laboratory diagnosis (clinical testing) from a public health standpoint.

Conditions to be provided for the new rapid diagnosis method and problems As described in the previous section, the condition is that the presence of “diphtheria toxin-producing bacteria” can be detected quickly. Attempts using molecular biological techniques have been made to satisfy this condition. PCR and real-time PCR methods targeting the diphtheria toxin gene have already been developed at the research level (PCR method: Nakao et al. J. Clin. Microbiol. 1997, 35 (7) 1651-1655 (Non-patent Document 1) Real-time PCR method: Mothershed et al. J. Clin. Microbiol. 2002, 40 (12) 4713-4719 (non-patent document 2).

As a molecular test for diphtheria,

Nakao et al. J. Clin. Microbiol. 1997, 35 (7) 1651-1655 Mothershed et al. J. Clin. Microbiol. 2002, 40 (12) 4713-4719

Laboratory diagnostic methods using PCR are sufficiently practical for use as a diphtheria DNA detection system, and are being used as an aid to current laboratory diagnostics. However, it is difficult to require special equipment such as a thermal cycler, and development of a simpler method that can be performed in a general laboratory is desired.

In recent years, the LAMP method (Loop mediated isothermal Amplification) that enables simple and rapid diagnosis has been developed as a genetic diagnosis method that replaces the PCR method, and its application research is being promoted in many infectious diseases. The LAMP method does not require a gene amplification device essential for PCR reaction, has an advantage that it can be determined in a short time, and further enables visual determination by adding a fluorescent dye to the reaction system. Therefore, it has been attracting attention as an inspection technology that can be introduced into laboratories such as hospitals where equipment is not sufficiently developed. However, since LAMP primers for diphtheria have not been developed with sufficient amplification ability to withstand practical use, it was necessary to design and evaluate LAMP primers that specifically detect diphtheria.

An object of the present invention is to perform simple, highly sensitive and specific detection of diphtheria toxin-producing bacteria. In order to solve this problem, the present invention provides a primer sequence that can highly amplify and detect a diphtheria toxin gene by the LAMP method, and provides a method for detecting the diphtheria toxin gene using this primer sequence. For the purpose.

Furthermore, an object of the present invention is to provide a kit for detecting a diphtheria toxin gene using the above primer sequence.

The present invention for solving the above problems is as follows.
[1] A primer set capable of amplifying at least a part of the diphtheria toxin gene by the LAMP method is prepared,
Extract DNA from the specimen,
The extracted DNA is subjected to an amplification operation by the LAMP method using the primer set,
After amplification procedure, during product confirms whether include amplified DNA, saw including that,
The primer set includes six DNAs having the base sequences of SEQ ID NOs: 1 to 6 shown in the sequence listing,
A method for detecting a diphtheria toxin gene contained in a specimen.
[ 2 ]
The method according to [ 1 ], wherein whether or not the amplified product contains amplified DNA is confirmed by measuring the turbidity of the amplified product or using a fluorescent dye.
[ 3 ]
A primer set comprising 6 DNAs having the nucleotide sequences of SEQ ID NOs: 1 to 6 shown in the sequence table, which are used for detecting a diphtheria toxin gene contained in bacterial cells in a specimen by the LAMP method.
[ 4 ]
A kit for detecting a diphtheria toxin gene contained in a specimen by the LAMP method, comprising the primer set according to [ 3 ].

The present inventors have set a primer set Cd # 16 in which six LAMP primers are combined with a gene region specific to diphtheria toxin (inside the region encoding the toxin A subunit of the diphtheria toxin gene (tox)). We designed a highly sensitive and highly specific diphtheria toxin gene detection system.

According to the present invention, the diphtheria toxin gene can be detected with high sensitivity and specificity. The LAMP method is a technique that can be introduced into a laboratory such as a hospital because it does not require complicated operations like the PCR method. Therefore, the present invention enables simple and quick diphtheria diagnosis at the clinical site. This is expected to enable a quick public health response through expeditious diagnosis of diphtheria, which is required to isolate patients under the Infectious Disease Law.

The present invention relates to a method for detecting a diphtheria toxin gene contained in bacterial cells in a specimen. This method includes the following steps.
(1) A primer set capable of amplifying at least a part of the diphtheria toxin gene by the LAMP method is prepared.
(2) DNA is extracted from the specimen.
(3) The extracted DNA is subjected to an amplification operation by the LAMP method using the primer set.
(4) After the amplification operation, it is confirmed whether or not the amplified DNA is contained in the product.

[Primer set]
In the method of the present invention, a primer set capable of amplifying at least a part of the diphtheria toxin gene by the LAMP method is prepared. Diphtheria is a bacterium belonging to Corynebacterium diphtheriae. In addition, LAMP primer was designed for this sequence. Use the LAMP primer design support software (PrimerExplorer Ver.3, Eiken Chemical) for design, and select 8 types of primer sets that the present inventors thought could be candidates from the designed primer sets did. The selected primer sets were synthesized, and the detection sensitivity and specificity of each primer set were examined using DNA purified from one type of diphtheria. As a result, the primer set of the present invention showed the highest sensitivity.

In the present invention, as a primer set capable of amplifying at least a part of the diphtheria toxin gene by the LAMP method, it is preferable to use a primer set consisting of the following four types of DNAs of SEQ ID NOs: 1 to 4.

FIG. 1 shows the design position of the primer set Cd # 16 for the diphtheria toxin gene of Diphtheria. LF and LB indicate loop primers, and the amplification region by the LAMP method is from F2 to B2c.

By using a primer set consisting of four types of DNAs of SEQ ID NOs: 1 to 4, a partial DNA of the diphtheria toxin gene can be amplified by the LAMP method. Although the minimum unit of DNA to be amplified is calculated to be 70 bp, in the LAMP method, DNA is amplified like a cauliflower, so that genes of various sizes other than 70 bp are actually amplified.

Cd # 16 # F3 # HPLC: AAAGGTTCGGTGATGGTG (SEQ ID NO: 1)
Cd # 16 # B3 # HPLC: CAATGAGCTACCTACTGATCG (SEQ ID NO: 2)
Cd # 16 # FIP # HPLC: TAACGCTTTCGCCTGTTCCCTGTAGTGCTCAGCCTTCC (SEQ ID NO: 3)
Cd # 16 # BIP # HPLC: GTGGAAAACGTGGCCAAGATCCTGACACGATTTCCTGC (SEQ ID NO: 4)

Cd # 16 # F3 is located in the tox gene ORF: nt 449-466, and Cd # 16 # B3: is located in the tox gene ORF: nt 672-652. Cd # 16 # FIP is located in the tox gene ORF: nt 552-533, 474-491, and Cd # 16 # BIP is located in the tox gene ORF: nt 584-603, 651-634.

In the method of the present invention, each of the four types of primers has the entire sequence shown above, and when the diphtheria toxin gene is present in the sample, the diphtheria toxin gene is reliably amplified regardless of the strain type. It is preferable from the viewpoint. However, even if each primer has a part of its bases deleted or substituted, or has other bases added, there may be those that function as a similar primer. That is, it has a base sequence having a deletion, substitution and / or addition of 1 to several bases in any one of SEQ ID NOs: 1 to 4, and at least a part of the diphtheria toxin gene is amplified by the LAMP method A primer set containing a DNA having a primer function that can be used as part or all of the DNA of the primer set can also be used in the method of the present invention.

The primer set of the present invention preferably further comprises the following DNA (loop primer) in addition to the four types of DNA.
Cd # 16 # LF # HPLC: CGCTAGAACTCCCCTCAGC (SEQ ID NO: 5)
Cd # 16 # LB # HPLC: GCGATGTATGAGTATATGGCTCAAG (SEQ ID NO: 6)

Cd # 16 # LF is located in the tox gene ORF: nt 514-496, and Cd # 16 # LB is located in the tox gene ORF: nt 604-628.

In the method of the present invention, even if the primer set does not contain the loop primer, at least a part of the diphtheria toxin gene can be amplified by the LAMP method. However, it is preferable to include the loop primer because the amplification time can be greatly shortened.

Even in the above-mentioned loop primer, there may be one that exhibits a function as a loop primer, even if one of the bases of each primer is deleted or substituted, or another base is added. That is, when the base sequence of SEQ ID NO: 5 or 6 has a base sequence having deletion, substitution and / or addition of 1 to several bases, and at least a part of the diphtheria toxin gene is amplified by the LAMP method A primer set including a DNA having a loop primer function as a part of the primer set can also be used in the method of the present invention.

The range of “1 to several” in the “base sequence having deletion, substitution and / or addition of 1 to several bases” as used herein is not particularly limited. , Preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 3, even more preferably 1 to 2, particularly preferably 1.

Each DNA constituting the primer set of the present invention can be appropriately obtained by a known DNA preparation method based on the base sequence.

Although this invention relates to the detection method of the diphtheria toxin gene using the said primer set, this invention includes the said primer set itself as invention. Furthermore, the present invention also includes a kit for detecting a diphtheria toxin gene contained in a microbial cell in a specimen by the LAMP method, comprising the primer set of the present invention.

The primer set of the present invention can be, for example, in a form containing the four or six types of primers (DNA) in an amount necessary for a single amplification of a gene by the LAMP method. The amount of primer (DNA) necessary for the gene amplification by one LAMP method is, for example, in the range of 5 to 40 pmol / reaction tube.

[DNA extraction]
In the method of the present invention, DNA is extracted from a specimen. Specifically, DNA is directly extracted from a strain in a specimen using a commercially available DNA extraction kit. Examples of the DNA extraction kit include QIAamp DNA Micro Kit (Cat. No. 56301, Qiagen). Alternatively, the DNA used as a template in the method of the present invention can be prepared by a simple preparation method in which the cells are boiled without extracting DNA from the specimen.

[Amplification by LAMP method]
In the method of the present invention, the extracted DNA (DNA template) is subjected to an amplification operation by the LAMP method using the primer set. The amplification operation by the LAMP method can be performed as follows, for example. A reagent (for example, Bst DNA polymerase, reaction buffer, dNTPs, primer set, distilled water) is mixed, dispensed into a reaction tube, and then a DNA template (extracted DNA) is added. Next, for example, incubation is performed at 65 ° C. The incubation time is, for example, in the range of 30 minutes to 90 minutes.

[Confirmation of amplified DNA]
In the method of the present invention, it is confirmed whether the amplified DNA is contained in the product after the amplification operation. When the diphtheria toxin gene is contained in the bacterial cells contained in the sample, the diphtheria toxin gene is amplified by the amplification operation. On the contrary, if the diphtheria toxin gene is not contained in the bacterial cells contained in the specimen, there is no DNA that can be amplified by the amplification operation.

Whether or not the amplified product contains amplified DNA can be confirmed, for example, by measuring the turbidity of the amplified product or by visual fluorescence detection. Specifically, the turbidity of the amplification product can be measured as follows. The turbidity of the final amplification product is measured over time with a real-time turbidity measuring device or with a turbidity measuring device. The fluorescent visual detection can be carried out by adding a fluorescent visual reagent for reaction, and visually observing the fluorescent color of the reaction solution by applying a UV lamp.

The present invention includes the primer set described in the above method. Furthermore, the present invention also includes a kit including the primer set of the present invention. What is contained in a kit can be the following things, for example.
1.Bst DNA polymerase
2. Reaction buffer
3.dNTPs
4.Primer set (primer of the present invention)
5. Control DNA (positive control)
6. Reaction tube
7. Manual

As described above, in the method of the present invention, the presence or absence of DNA by-products can be determined by turbidity measurement or visual fluorescence detection. In the case of detecting with fluorescent visual observation, a fluorescent visual inspection reagent can be included in the kit. When using a turbidity measuring device, the fluorescent visual detection reagent is not included in the kit.

Hereinafter, the present invention will be described in more detail with reference to examples.

Materials and Methods Strains and Reagent Diphtheria ATCC700971 (NCTC13129) were purchased from US ATCC. Other diphtheria strains used were those stored in the laboratory and purchased from ATCC.

A blood agar medium manufactured by Nissui Pharmaceutical Co., Ltd. was used. A BHI (Brain Heart Infusion) liquid medium was prepared from Difco (Becton Dickinson) and dissolved in purified water at 37 g / l and sterilized.

A LoopAmp DNA amplification reagent kit manufactured by Eiken Chemical was used for DNA amplification. Qiagen Genomic Tip-20 or 100 and Qiagen Genomic Buffer Set were used for total DNA extraction from colonies on blood agar.

Cultured cryopreserved bacteria were applied to a blood agar medium or suspended in a BHI liquid medium and cultured at 37 ° C. overnight to overnight for use in experiments. Cultures obtained by transplanting these cultures to the same medium were also used in the same manner.

DNA preparation
(1) Purified with Qiagen from colonies on blood agar colonies Bacteria cultured overnight at 37 ° C on blood agar plates are collected with a conical rod suspended in 2 ml of purified water, washed by centrifugation, and designated as a Qiagen kit. Total DNA was extracted according to Only lysozyme was used in a different amount (50 mg / ml). The obtained purified DNA was used as a template.

(2) Purification by cesium chloride-ethidium bromide density gradient ultracentrifugation
Centrifugal collection of cells cultured overnight at 37 ° C in 200 ml of BHI liquid medium, washed with physiological saline, freeze-thawed, and then B1 solution of Qiagen Genomic Buffer Set containing 27 mg / ml lysozyme The suspension was suspended in 11 ml and incubated overnight at 37 ° C. Further, 1 ml of Proteinase K manufactured by Takara Bio Inc. was added and incubated at 37 ° C for 1 hour. Next, 4 ml of B2 solution of Qiagen Genomic Buffer Set and 10 μl of Qiagen RNase solution were added and incubated at 50 ° C. for 1 hour to dissolve the cells. The obtained bacterial cell lysate was deproteinized by one chloroform treatment with two phenol / chloroform treatments, and a crude DNA fraction was obtained by ethanol precipitation. Purified DNA was obtained from the crude DNA fraction by cesium chloride-ethidium bromide density gradient ultracentrifugation by a conventional method. The obtained purified DNA was used as a template.

(3) Preparation of crude DNA from colonies on agar plates by boil method Bacteria on blood agar plates or BHI agar plates, cultured at 37 ° C overnight, scraped off colonies and suspended in purified water. OD600 was measured and appropriately diluted with purified water to prepare a suspension with OD6001 = 1. This suspension with OD = 1 was further serially diluted 10 times to prepare a suspension with OD = 0.001. These suspensions were heated with an aluminum block heater at 100 ° C. for 30 minutes, and the centrifuged supernatant was used as a DNA template.

Primer design Primers were designed based on the base sequence information of the diphtheria toxin gene obtained from NCBI using the web application "Primer Explorer Ver3" that runs on the Eiken Chemical Co., Ltd. website. The designed primer is located on the gene region corresponding to the diphtheria toxin A subunit and has the nucleotide sequences shown in SEQ ID NOs: 1-6. The primers used were all of the commissioned synthesis (HPLC purification grade) by Hokkaido System Science.

According to the instruction manual of “LoopAmp DNA Amplification Reagent” by DNA amplification Eiken Chemical Co., Ltd. by LAMP method. The amplified DNA was detected using a Eiken Chemical LA-320c real-time turbidity detector.

PCR
The sensitivity and specificity of the LAMP primer set were implemented by comparing with the existing PCR method (Non-patent Document 1). The presence or absence of gene amplification was confirmed by ethidium bromide staining after separating 5 μL of PCR products by 1% agarose gel electrophoresis.

LAMP detection system
The detection sensitivity and specificity of the LAMP primer set were evaluated using Loopamp DNA amplification reagent kit (Eiken Chemical). The LAMP detection system consists of 25 μl of reaction solution, 0.2 μM of each outer primer (F3, B3), 1.6 μM of each inner primer (FIP, BIP), 0.8 μM of each loop primer (LF, LB), 1 μl of Bst-DNA polymerase, 12.5 μl of 2 × reaction solution and 1 μl of DNA solution were contained and reacted at 65 ° C. for 1 hour. Then, the reaction stop process for 2 minutes was performed at 80 degreeC. A Loopamp reaction tube (Eiken Chemical) was used as the reaction tube, and the increase in turbidity associated with gene amplification was measured using a real-time measurement device (Loomamp LA-320C, Eiken Chemical). Table 1 shows the reaction composition of the LAMP detection system.

The sensitivity of the LAMP detection system using the primer set Cd # 16 is summarized in Table 2 below. Purified diphtheria DNA was serially diluted and the detection limit of the LAMP detection system was measured and shown in the table. It is the result of measuring the increase in turbidity using a real-time measuring device (Loopamp LA-320C, Eiken Chemical).

Amplification under normal conditions (64 ° C) using genomic DNA purified by CsCl density gradient ultracentrifugation from diphtheria C. diphtheriae strain ATCC700971 cultured in BHI liquid medium to various concentrations. As a result, it was revealed that if 10 or more copies of genomic DNA were present in the reaction solution, they could be detected by the LAMP method using the primer set Cd # 16 of the present invention.

FIG. 2 shows the results of LAMP amplification performed using the primer set Cd # 16 of the present invention using diphtheria DNA purified from CHI from BHI liquid culture as a template. The sensitivity was to amplify 10 copies in 15-30 minutes.

In addition, in consideration of simple use in actual clinical laboratory settings, detection was possible by suspending cultured cells in distilled water and using a supernatant heated at 100 ° C. for 30 minutes. In a colony on a blood agar medium, from a bacterial suspension suspended to OD600 = 1, in the case of cells cultured in a BHI liquid medium, from a bacterial suspension suspended to OD600 = 0.001 The diphtheria toxin gene was detected.

In order to demonstrate the specificity of the LAMP detection system for Corynebacterium bacteria, the detection results of the LAMP method using the primer set Cd # 16 and the PCR results using the DNA of 14 diphtheria and 2 corynebacterium ulcerans strains as templates The results of examining the specificity by comparing the detection results are shown in Table 3 below.

As shown in Table 3, for the genomic DNA purified from the C. diphtheriae 14 strain and the closely related Corynebacterium ulcerans 2 strain, an attempt was made to detect the diphtheria toxin gene by the LAMP method using the primer set Cd # 16 of the present invention. Diphtheria toxin gene was detected in 10 out of 14 C. diphtheriae strains, and not detected in the remaining 4 strains. Diphtheria toxin gene was detected in all 2 strains of Corynebacterium ulcerans. Since the detection results for these 16 strains were completely consistent with the detection results obtained by the conventional PCR method for the diphtheria toxin gene, the primer set Cd # 16 of the present invention is highly specific for LAMP detection. It was shown to be suitable for.

FIG. 3 shows the results of LAMP amplification carried out using the primer set Cd # 16 of the present invention using diphtheria bacteria DNA from a colony on a blood agar plate medium by the boil method as a template. The sensitivity was 1 OD (about 1 x 10 ⁵ cfu).

FIG. 4 shows the results of LAMP amplification performed with the primer set Cd # 16 of the present invention using diphtheria bacteria DNA from a colony on a BHI agar plate medium by the boil method as a template. The sensitivity was 0.001 OD (= 100 cfu). However, it is preferable to use it immediately after boiling.

Fig. 5 Preparation of diphtheria DNA by boil method from colonies on BHI agar plate medium Using DNA as a template, the results of LAMP amplification using the primer set Cd # 16 of the present invention and the results of PCR amplification are combined Show. Twelve strains of diphtheria (toxogenic and non-toxogenic) (toxogenic C. ulcerans) were used. The detection results agreed well with PCR.

The LAMP detection system using the primer set according to the present invention can be expected to be put into practical use as an in vitro diagnostic agent for diphtheria infection.

Explanatory drawing of design of LAMP method primer. The result of the LAMP amplification performed using the primer set Cd # 16 using CsCl-purified diphtheria bacteria DNA from BHI liquid culture as a template is shown. The result of the LAMP amplification performed using the primer set Cd # 16 using the Diphtheria bacteria DNA by the boil method from the colonies on the blood agar plate medium as a template is shown. The result of the LAMP amplification performed using the primer set Cd # 16 using the diphtheria bacteria DNA by the boil method from the colonies on the BHI agar plate medium as a template is shown. The results of LAMP amplification performed using primer set Cd # 16 and PCR amplification results are shown together using diphtheria bacteria DNA by the boil method from colonies on a BHI agar plate medium as a template.

Claims (4)

Prepare a primer set that can amplify at least part of the diphtheria toxin gene by the LAMP method,
Extract DNA from the specimen,
The extracted DNA is subjected to an amplification operation by the LAMP method using the primer set,
After amplification procedure, during product confirms whether include amplified DNA, saw including that,
The primer set includes six DNAs having the base sequences of SEQ ID NOs: 1 to 6 shown in the sequence listing,
A method for detecting a diphtheria toxin gene contained in a specimen. The method according to claim 1 , wherein whether or not the amplified product contains amplified DNA is confirmed by measuring the turbidity of the amplified product or using a fluorescent dye. A primer set comprising 6 DNAs having the nucleotide sequences of SEQ ID NOs: 1 to 6 shown in the sequence table, which are used for detecting a diphtheria toxin gene contained in bacterial cells in a specimen by the LAMP method. A kit for detecting a diphtheria toxin gene contained in a sample by the LAMP method, comprising the primer set according to claim 3 .