CN109321552B - Novel pullulanase, gene thereof, engineering bacteria and preparation method - Google Patents

Abstract

The invention belongs to the technical field of enzyme genetic engineering, and relates to a novel pullulanase, a gene and an amino acid sequence thereof and a preparation method thereof. Meanwhile, the novel pullulanase has better effect in the aspects of food industry and medical industry.

Description

Novel pullulanase, gene thereof, engineering bacteria and preparation method

The technical field is as follows:

the invention relates to a novel pullulanase, a gene, an engineering bacterium and a preparation method thereof, in particular to a recombinant expression strain for expressing the novel pullulanase obtained by a genetic engineering technology and a molecular biological means, and an industrial application of a pullulanase protein of the bacterium, belonging to the technical field of genetic engineering of enzymes.

Background art:

pullulanase (Pullulanase), also known as α -dextrin endo-1, 6- α -glucosidase, or pullulan 6-glucohydrolase. It was originally found to be named pullulanase because it can hydrolyze the alpha-1, 6-glucosidic bonds in pullulan. It can specifically cut the alpha-1, 6-glycosidic bond of branch point in amylopectin, and cut the branched chain structure to make the amylopectin form amylose.

Among the enzyme classification databases, pullulanases belong to glycosyl hydrolase family 13. It is widely found in animals, plants and microorganisms, and has a wide variety of types and different action modes. Pullulanases can be classified into three types according to their substrate specificity and product. The pullulanase I can directly hydrolyze alpha-1, 6-glycosidic bonds in pullulan, cut off a branch structure to form amylose and mainly generate panose. The pullulanase II can hydrolyze alpha-1, 4-glycosidic bond and alpha-1, 6-glycosidic bond in starch and glycogen, namely has the activity of pullulanase and alpha-amylase, and the product of the pullulanase after hydrolysis is mainly isoglucosyl maltose. The type III pullulanase can simultaneously act on pullulan polysaccharide, starch, amylopectin and the like, and hydrolyzes the pullulan polysaccharide to mainly generate maltose, maltotriose and panose. Although the three types of pullulanases differ in their hydrolytic properties, they share structural similarities, with four conserved regions.

The property of pullulanase to break down the branches determines its wide application in the food industry, and saccharifying enzymes and pullulanase are commonly used together to improve the saccharification rate and accelerate the saccharification process, and simultaneously play roles in beer brewing, alcohol industry and sugar-free production process, so that pullulanase is a promising new variety in amylase preparations and widely exists in animals, plants and microorganisms. The initial pullulanase is obtained by utilizing aerogenes Aerobacter aeroginosum fermentation, and has better enzymological characteristics. To date, a number of different sources and types of pullulanases have been discovered and studied. In recent years, low-temperature pullulanase is also relevant to research on low-temperature pullulanase, and the interest of low-temperature pullulanase is gradually increased along with the application of the low-temperature pullulanase in low-temperature wastewater treatment and low-temperature food industry. Unlike pullulanase type I, the strain sources of pullulanase type ii are more widely distributed among the extreme thermophilic bacteria and the hyperthermophiles, in contrast to the third class of pullulanase, which has been reported less.

Pullulanases fall into three broad categories, with certain differences in structural characteristics among the different types of pullulanase. Most pullulanases type I have a highly conserved 7 amino acid domain, YNGGYDP. This conserved region is presumed to be involved in substrate binding and catalytic activity of the enzyme, preserving long-term selective pressure. Pullulanase type ii is encompassed by two families of glycoside hydrolases, namely the GH57 family and the GH13 family. Pullulanase type ii also has 4 highly conserved domains. Unlike pullulanases of type i, domain ii of most pullulanases of type ii consists of two supersecondary structures, one of which is located between domain iii and domain iv. Pullulanase type i catalyzes α -1, 6-glycosidic bonds by forming glycosidic bond-the net retention of the enzyme intermediate in the anomeric configuration, the active center of pullulanase is the catalytic triad structure of Asp622-Glu651-Asp 736: asp-622 is the nucleophile for the enzyme, Glu-651 is involved in acid-base catalysis, and Asp-736 interacts with O3/O3 to stabilize the transition state intermediate. The active center structure of the catalytic triad of the II type high-temperature pullulanase enzyme molecule is formed by Asp597-Glu626-Asp703, but the catalytic mechanisms of the I type pullulanase and the II type pullulanase both accord with the catalytic mechanism of the glycoside hydrolase proposed by Koshland.

Natural strains isolated from nature have a low ability to secrete pullulanase, which limits the use of pullulanase. Therefore, genetic engineering technical means are required to be applied to research and development of pullulanase, and the yield of the pullulanase is improved so as to meet the requirements of numerous fields. Several tens of pullulanase genes have been heterologously expressed, and the main expression system is the E.coli expression system. Although some results are obtained in the research of pullulanase by genetic engineering technology, the expression level of pullulanase is not high in general. The pullulanase is expressed by a genetic engineering means, the expression level of the pullulanase is improved, and the method becomes a main development direction of basic research and application research of the pullulanase.

Bacillus belongs to gram-positive bacteria. The bacillus expression system has the following advantages: 1. the use of many bacilli in the fermentation industry has a long history, is not pathogenic, and does not produce any endotoxin; 2. has strong protein secretion capacity, and can directly secrete the protein into a culture medium (which is beneficial to purification); 3. no obvious codon preference; 4. mature fermentation process is provided, high density (in simple culture medium) can be achieved, and various proteins can be efficiently secreted; 5. the research on the microbial genetics background of the bacillus genus is very clear, the bacillus genus grows rapidly, and no special requirements on nutrient substances exist; 6. the fermentation process is simple, the bacillus belongs to aerobic bacteria, anaerobic fermentation equipment is not needed, and after the fermentation is finished, fermentation liquor and bacterial thalli are simply separated, so that the separation, purification and recovery stages of target protein can be carried out; 7. has stress resistance, and can be used for producing various thermostable enzyme preparations.

In the invention, an original pullulanase encoding gene is derived from pullulanase, belongs to bacteria, and is cloned and mutated in a pullulanase genome to obtain a novel pullulanase gene, and the novel pullulanase gene is expressed in a bacillus subtilis expression system, a bacillus amyloliquefaciens expression system and a bacillus licheniformis expression system to respectively obtain a bacillus subtilis high-stability pullulanase recombinant strain, a bacillus amyloliquefaciens high-stability pullulanase expression recombinant strain and a bacillus licheniformis high-stability pullulanase expression recombinant strain, and after the recombinant strains are fermented, the high-stability pullulanase can be obtained through corresponding treatment, and the novel recombinant pullulanase can be used for hydrolyzing amylopectin.

The invention content is as follows:

the invention aims to overcome and avoid the defects of the existing industrial production of pullulanase, provides a novel bacterial pullulanase and a coding gene thereof, and simultaneously provides an engineering strain for expressing the novel bacterial pullulanase gene.

The technical route for realizing the purpose of the invention is as follows: the genome of the pullulanase is used as a template, and the conserved sequence of the pullulanase mature peptide gene of the pullulanase is analyzed according to the reported pullulanase mature peptide gene of the pullulanase, so that amplification primers P1 and P2 of the pullulanase mature peptide gene are designed, wherein an upstream primer P1 and a downstream primer P2 are used for amplifying target genes expressed in bacillus subtilis, bacillus amyloliquefaciens and bacillus licheniformis, and restriction enzyme cleavage sites EcoR I and Not I are respectively introduced into the upstream primer and the downstream primer. After constructing a recombinant vector by enzyme digestion, connection and the like, randomly mutating a wild type pullulanase gene by using an error-prone PCR technology to obtain a pullulanase mutant and a coding gene pulm thereof, connecting the pullulanase mutant and the coding gene pulm with a pBSA43 vector, constructing a recombinant plasmid pBSA43-pulm and transforming Escherichia coli JM109 to obtain a recombinant strain JM109/pBSA 43-pulm. And successfully expressing the correctly verified recombinant plasmid pBSA43-pulm in bacillus subtilis, bacillus amyloliquefaciens and bacillus licheniformis respectively to obtain a recombinant strain for producing the high-stability novel pullulanase, and further optimizing a fermentation process to obtain the high-yield high-stability novel pullulanase.

In order to achieve the above purpose, one of the technical solutions provided by the present invention is: a novel bacterial pullulanase, the amino acid sequence of which is shown in SEQ ID No: 2 is shown in the specification;

the pullulanase coding gene is pulm, and the base sequence is shown as SEQ ID No: 1 is shown in the specification;

the coding gene sequence of the wild pullulanase is shown as SEQ ID No: 3, and the corresponding amino acid sequence is shown as SEQ ID No: 4, respectively.

In order to achieve the above purpose, the second technical solution provided by the present invention is: reconstructing a recombinant vector from the genes, efficiently expressing the recombinant vector in bacillus subtilis, bacillus amyloliquefaciens and bacillus licheniformis to obtain a recombinant strain for producing the high-stability novel pullulanase, and further optimizing a fermentation process to obtain the high-yield high-stability novel pullulanase;

the host cell for expressing the novel bacterial pullulanase is bacillus subtilis, bacillus amyloliquefaciens or bacillus licheniformis, and the expression vector is pBSA 43;

further, the bacillus subtilis is CGMCC 10787;

further, the bacillus amyloliquefaciens is CICC 10079;

further, the bacillus licheniformis is CGMCC 10785.

The experimental procedure of the present invention is summarized as follows:

1. the process for obtaining the novel pullulanase mutant coding gene comprises the following steps:

(1) connecting a wild pullulanase gene pul with a vector pET-22b (+), constructing a recombinant plasmid pET-pul, and randomly mutating the wild pullulanase gene by error-prone PCR (polymerase chain reaction) to obtain a pullulanase mutant encoding gene pulm; (2) and (3) storing the plasmid pET-pulm containing the pullulanase mutant coding gene.

2. A novel pullulanase constructs a recombinant strain (Bacillus subtilis CGMCC10787/pBSA 43-pulm) for expressing the novel pullulanase and a preparation process of the novel bacterial pullulanase, and comprises the following steps:

(1) after the pullulanase gene pulm is connected with an escherichia coli-bacillus subtilis shuttle plasmid pBSA43, a recombinant plasmid pBSA43-pulm is constructed, escherichia coli JM109 is transformed, and a recombinant strain JM109/pBSA43-pulm is obtained;

(2) transforming the recombinant plasmid pBSA 43-palm into Bacillus subtilis CGMCC10787 to construct recombinant strain CGMCC10787/pBSA 43-palm;

(3) fermenting the recombinant strain to prepare the novel high-stability bacterial pullulanase;

(4) preparing the novel pullulanase with high stability.

2. A novel pullulanase, a recombinant strain (Bacillus amyloliquefaciens CICC 10079/pBSA43-pulm) for expressing the novel pullulanase and a preparation process of the novel bacterial pullulanase are constructed, and the preparation process comprises the following steps:

(1) connecting the pullulanase gene pulm with an escherichia coli-bacillus amyloliquefaciens shuttle plasmid pBSA43, constructing a recombinant plasmid pBSA43-pulm, and transforming escherichia coli JM109 to obtain a recombinant strain JM109/pBSA 43-pulm;

(2) transforming the recombinant plasmid pBSA 43-palm into bacillus amyloliquefaciens CICC 10079 to construct and obtain a recombinant strain bacillus amyloliquefaciens CICC 10079/pBSA 43-palm;

(3) screening the obtained recombinant strain by kanamycin, and determining enzyme activity of pullulanase to obtain the recombinant strain producing high-stability pullulanase;

(4) fermenting the high-yield recombinant strain to prepare high-stability novel bacterial pullulanase;

(5) preparing the novel pullulanase with high stability.

3. A novel pullulanase constructs a recombinant strain (Bacillus licheniformis CGMCC 10785/pBSA43-pulm) for expressing the novel pullulanase and a preparation process of the novel bacterial pullulanase, and comprises the following steps: (1) connecting the pullulanase gene pulm with an escherichia coli-bacillus licheniformis shuttle plasmid pBSA43, constructing a recombinant plasmid pBSA43-pulm, and transforming escherichia coli JM109 to obtain a recombinant strain JM109/pBSA 43-pulm;

(2) transforming the recombinant plasmid pBSA43-pulm into Bacillus licheniformis CGMCC 10785 to construct recombinant strain Bacillus licheniformis CGMCC 10785/pBSA 43-pulm;

(3) screening the obtained recombinant strain by kanamycin, and determining enzyme activity of pullulanase to obtain the recombinant strain producing high-stability pullulanase;

(4) fermenting the high-yield strain to prepare high-stability novel bacterial pullulanase;

(5) preparing the novel pullulanase with high stability.

Has the advantages that:

the invention obtains a novel pullulanase mutant through error-prone PCR and screening, and the coding gene of the mutant is a section of new base sequence through sequencing. Compared with the wild type gene, the gene homology of the sequence is 87%. The amino acid homology was 91.24%. Compared with wild enzyme, the mutant enzyme has 50% raised enzyme activity, and has raised heat resistance and pH tolerance.

The novel recombinant pullulanase prepared by fermenting the novel pullulanase recombinant strain expressed by the bacillus subtilis, the novel pullulanase recombinant strain expressed by the bacillus amyloliquefaciens and the novel pullulanase recombinant strain expressed by the bacillus licheniformis has the following advantages: when the novel pullulanase enzymatic properties are determined by taking pullulan as a substrate, the novel pullulanase expressed by 3 hosts has similar enzymatic properties, the optimal reaction temperature is 60 ℃, the optimal reaction pH is 5.0, the thermal stability is good below 60 ℃, and the stability is good at the pH of 3.5-10.0. But the secretion expression amounts of the three are different. The highest expression quantity is the engineering bacteria taking bacillus amyloliquefaciens as a host, the highest enzyme activity can reach 3200U/ml, and the highest enzyme activity can reach 3130U/ml in the expression host of bacillus licheniformis; and the engineering bacteria taking the bacillus subtilis as a host can only reach 2980U/ml.

Description of the drawings:

FIG. 1 is a PCR amplification electrophoresis chart of the mature peptide gene of the novel pullulanase of the present invention;

wherein: m is a DNA Marker, and 1 is a pullulanase mutant gene pulm;

FIG. 2 is a restriction enzyme digestion verification map of recombinant plasmid pBSA 43-palm of the present invention (corresponding to step 2 in example 2);

wherein: m is DNA Marker, 2 is recombinant plasmid pBSA 43-palm through EcoR I and Not I double enzyme cutting picture, 1 is recombinant plasmid pBSA 43-palm through EcoR I single enzyme cutting picture;

FIG. 3 is a graph showing the results of the measurement of the optimum reaction temperature of the novel pullulanase of the present invention (corresponding to step 1 in example 6);

FIG. 4 is a diagram showing the results of pH determination of the optimum reaction of the novel pullulanase of the present invention (corresponding to step 2 in example 6);

FIG. 5 is a chart showing the results of the heat resistance test of the novel pullulanase of the present invention (corresponding to step 3 in example 6);

FIG. 6 is a graph showing the results of the pH tolerance test of the novel pullulanase of the present invention (corresponding to step 4 in example 6).

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present patent and are not intended to limit the present invention.

Example 1: obtaining of novel pullulanase mature peptide gene of pullulanase

1. The wild pullulanase mature peptide gene is derived from the pullulanase wild screened by the laboratory of the applicant, and the gene (shown in SEQ ID NO. 3) can be amplified through gene synthesis or PCR. The extraction steps of the genomic DNA of the pullulan longwild bacillus are as follows:

(1) inoculating and streaking the strain in an LB solid plate from a glycerol tube, and standing and culturing for 12h at 37 ℃;

(2) selecting a single colony from a plate for culturing the thalli, inoculating the single colony in a liquid LB culture medium containing 5mL, and culturing for 12 hours at the temperature of 37 ℃ at 220 r/min;

(3) subpackaging the bacterial liquid into a sterilized 1.5mL microcentrifuge tube, centrifuging at 12000r/min for 1min, collecting thalli, and discarding supernatant;

(4) resuspending the precipitate in 200 μ L precooled solution I (OMEGA genome DNA extraction kit), repeatedly blowing and stirring with a gun head, mixing well, adding 50 μ L50 mg/mL lysozyme, and water-bathing at 37 deg.C for 1 h;

(5) adding 20 μ L of 10% SDS and 10 μ L of proteinase K, and water-bathing at 65 deg.C for 2-3 h;

(6) adding 250 mu L of newly-prepared solution II (OMEGA), tightly covering the pipe orifice, and gently turning 1.5mL of EP pipe up and down for 6-8 times to fully crack the thalli in the EP pipe;

(7) adding 350 mu L of precooled solution III (OMEGA), immediately and gently turning over a 1.5mL EP tube for 6-8 times, wherein white flocculent precipitates appear in the EP tube;

(8) centrifuging at 12000r/min for 10min, transferring the supernatant to another EP tube, adding equal volume of Tris saturated phenol/chloroform (1: 1) mixed solution, mixing well, centrifuging at 12000r/min for 10min, and transferring the supernatant to another EP tube;

(9) repeatedly extracting for 2 times, and then extracting for 1 time by using chloroform with the same volume to remove trace phenol;

(10) adding 2 times volume of anhydrous ethanol, mixing, and standing at-20 deg.C for 30 min. Centrifuging at 12000r/min for 10min, and collecting precipitate;

(11) washing the precipitate with 70% ethanol for 2-3 times, and discarding the residual liquid;

(12) air drying for 20-30min, sterilizing with 30 μ L ddH₂Dissolving and precipitating O;

2. through NCBI gene bank search, according to the reported pullulanase mature peptide gene of the pulullan bacillus longye, the conserved sequence of the pullulanase mature peptide gene is analyzed, and the amplification primers of the pullulanase mature peptide coding gene are designed as follows:

upstream primer P1(SEQ ID NO. 5):

5’—CCGGAATTCGATGGGAACACCACAAACATC—3’

downstream primer P2(SEQ ID NO. 6):

5’—AAGGAAAAAAGCGGCCGCCTATTTACCATCAGATGGGCTTAC—3’

the upstream primer P1 and the downstream primer P2 are used for amplifying target genes expressed in bacillus subtilis, bacillus amyloliquefaciens and bacillus licheniformis, and the upstream primer and the downstream primer are respectively introduced with restriction enzyme sites EcoR I and Not I.

The amplification template is genome DNA of the pullulan degrading strain, and the amplification reaction conditions are as follows:

the amplification conditions were: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 45s, and extension at 72 ℃ for 3min for 30 cycles; extension at 72 ℃ for 10 min. And (3) carrying out 0.8% agarose gel electrophoresis on the PCR amplification product to obtain a 2700bp strip (figure 1), recovering the PCR product by using a small amount of DNA gel recovery kit, and carrying out double enzyme digestion and purification recovery to obtain the novel pullulanase mature peptide coding gene pul of the pullulanase of the invention.

Example 2: mutation of pullulanase gene

1. The wild type pullulanase gene is connected with a pET-22b (+) vector.

And (3) connecting the purified pul with a pET-22b (+) vector, then transforming the recombinant plasmid into Escherichia coli DH 5 alpha, and successfully verifying that the wild type pullulanase gene is cloned to the pET-22b (+) vector to construct the recombinant plasmid pET-pul through EcoRI and NotI double enzyme digestion.

2. Error-prone PCR: the recombinant plasmid pET-pul constructed above is taken as a template, and the reaction system is as follows:

ddH2O	21μL
		recombinant plasmid pET-pul (5 ng/. mu.L)	1μL
Upstream primer P1 (10. mu. mol/L)	2μL
		Downstream primer P2 (10. mu. mol/L)	2μL
Taq DNA polymerase	0.5μL
		10×Taq buffer	5μL
dATP(10mmol/L)	1μL
		dGTP(10mmol/L)	1μL
dTTP(10mmol/L)	5μL
		dCTP(10mmol/L)	5μL
MgCl2(25mmol/L)	10μL
		MnCl2(10mmol/L)	1.25μL

After the system is constructed, error-prone PCR reaction is carried out, and the program is set as follows:

a. pre-denaturation at 95 deg.C for 5 min;

b. denaturation: 30s at 95 ℃;

c. annealing: 45s at 70 ℃;

d. extension: 90s at 72 ℃;

e.b-d for 35 cycles;

f. extension at 72 ℃ for 10 min.

After the PCR reaction is finished, carrying out EcoRI and NotI double digestion on the PCR product and the vector plasmid, purifying and recovering, connecting the error-prone PCR product with the vector plasmid pET-22b (+) which is also subjected to double digestion, transferring the error-prone PCR product into E.coli BL21(DE3) through transformation, and coating the error-prone PCR product on the vector plasmid containing Amp^rThe transformant was obtained by static culture in an incubator at 37 ℃ for 12 hours in a solid plate of LB (100. mu.g/mL).

3. MutationsScreening of the body library: add 200. mu.L of Amp in each well of 96-well plate^r(100. mu.g/mL) of LB liquid medium, and then, a single clone of each transformant was picked up with a sterilized toothpick into a 96-well plate, as much as possible so that just a small amount of the strain was stained each time. Transferring the 96-well plate to a shaking table for culturing at 160r/min and 37 ℃ to OD₆₀₀Reaching 0.6-0.8, at which time IPTG was added to a final concentration of 0.5mM, followed by low temperature induction at 16 ℃ and cultivation at 160r/min for 16 h. Centrifuging at 4000r/min for 10min (at 4 deg.C), collecting 50 μ L of centrifugated supernatant, and detecting enzyme activity to obtain mutant with enzyme activity.

4. The enzyme activity detection method comprises the following steps: adding 1mL of 0.5% pullulan solution (pH4.5) into 1mL of appropriately diluted enzyme solution, placing in a test tube, keeping the temperature at 60 ℃ for 30 minutes, immediately adding 3mL of DNS reagent, boiling in boiling water for 7 minutes, cooling, adding 10mL of distilled water, mixing uniformly, adding 1mL of 0.5% pullulan into the inactivated enzyme solution which is boiled for 5 minutes, reacting for 30 minutes as a control, and determining the optical density value (OD) according to the same operation of a standard curve₅₅₀). The determination of the enzyme activity is three parallel experiments, and the results are averaged.

Under the above conditions, the enzyme activity which produces a reducing power equivalent to 1. mu. mol of glucose per minute is one enzyme activity unit.

Calculating enzyme activity: enzyme activity (U/mL) ═ OD × K value ÷ 30 ÷ 180 × n

In the formula:

OD- -the difference between the optical density values of the sample and the blank;

180- - -molecular weight of glucose;

k- - -the slope of the standard curve;

30- -enzyme reaction time;

n-enzyme dilution factor.

Through the construction and screening of the error-prone PCR library in the steps, the mutant enzyme is finally obtained, and the amino acid sequence of the mutant enzyme is shown as SEQ ID No: 2 is shown in the specification; the base sequence is shown as SEQ ID No: 1 is shown in the specification; compared with the wild type gene, the sequence has 87 percent of gene homology and 91.24 percent of amino acid homology and the enzyme activity is improved by 50 percent compared with the wild type through the comparison of a sequencing result.

5. Determination of enzymatic Properties of mutants

After repeated experiments of enzyme activity are carried out on the mutant, the enzymatic property of the mutant is measured.

(1) Novel pullulanase optimum reaction temperature determination

Taking a pullulanase finished product (9360U/mL), and measuring the enzyme activity at different temperatures. The optimum reaction temperature was determined to be 60 ℃ from FIG. 3.

(2) Novel pullulanase optimum reaction pH determination

Taking a pullulanase finished product (9360U/mL), diluting to corresponding times by using acetic acid-sodium acetate buffer solutions with different pH values (0.2 mol/L of acetic acid and sodium acetate solution are respectively prepared, and a proper amount of the two solutions is prepared to the required pH value), preparing a substrate by using the corresponding pH buffer solution, measuring the enzyme activity, and determining that the optimal reaction pH value is 5.0 according to a graph 4.

(3) Novel pullulanase heat resistance test

Taking a pullulanase finished product (9360U/mL), diluting a sample by 2 times, sucking 2mL of diluted enzyme solution into different test tubes, respectively placing the test tubes into water bath pots with the temperatures of 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃ and 70 ℃, accurately preserving heat for 2 hours, quickly taking out the test tubes, cooling the test tubes in an ice water bath, continuously diluting the test tubes to the corresponding times by using a buffer solution with the pH value of 4.5 after cooling, measuring the enzyme activity, and determining that the test tubes have good thermal stability below 60 ℃ according to a graph 5.

(4) Novel pullulanase pH tolerance test

Taking a pullulanase finished product (9360U/mL), diluting by 25 times with acetic acid-sodium acetate buffer solutions (0.2 mol/L of acetic acid and sodium acetate solution are respectively prepared, and a proper amount of the two solutions is prepared to the required pH value), standing at room temperature for 24h, shaking up, continuously diluting by a buffer solution with the pH value of 4.5 to corresponding times, measuring the enzyme activity, and determining that the stability of the pullulanase at the pH value of 3.5-10.0 is good according to a graph 6.

Example 3: construction of novel high-stability pullulanase recombinant bacteria of bacillus subtilis

1. Construction of expression vector pBSA43

pBSA43 is prepared by cloning into a strong bacillus constitutive promoter pBE2 with Escherichia coli-Bacillus subtilis shuttle cloning vector pBE2 as skeletonMover P43 and a levansucrase signal sequence sacB enabling direct secretion of the recombinant protein into the culture medium. It carries Amp^rGenes that can utilize ampicillin resistance as a selection marker in E.coli; also has Km^rThe gene can be used as a screening marker in bacillus subtilis and bacillus licheniformis by utilizing kanamycin resistance.

2. Construction of novel pullulanase expression vector pBSA43-pulm

The novel pullulanase gene (pulm) which is amplified by PCR and recovered by double enzyme digestion of EcoR I and Not I is connected with a bacillus subtilis expression vector pBSA43 by the same double enzyme digestion by ligase, the connection product is transformed into escherichia coli JM109 competent cells, positive transformants are selected by Amp resistance screening, transformant plasmids are extracted, single and double enzyme digestion verification (figure 2) and sequencing are carried out, and the correct recombinant strain JM109/pBSA43-pulm is determined to be obtained.

3. Recombinant expression vector pBSA43-pulm transformation bacillus subtilis

mu.L (50 ng/. mu.L) of pBSA 43-palm recombinant plasmid is added into 50. mu.L of Bacillus subtilis CGMCC10787 competent cells and mixed evenly, then the mixture is transferred into a precooled electric rotating cup (1mm), and after ice bath for 1-1.5min, electric shock is carried out once (25uF, 200 omega, 4.5-5.0 ms). After the shock was completed, 1mL of recovery medium (LB +0.5mol/L sorbitol +0.38mol/L mannitol) was added immediately. And after shaking culture for 3h at 37 ℃ by a shaking table, coating the resuscitate on an LB plate containing kanamycin, culturing for 12-24h at 37 ℃, selecting positive transformants, and performing single-enzyme and double-enzyme digestion verification to obtain the bacillus subtilis recombinant strain CGMCC10787/pBSA 43-pulm.

Example 4: construction of novel high-stability pullulanase expression recombinant bacteria of bacillus amyloliquefaciens

1. Construction of novel pullulanase expression vector pBSA43-pulm

Connecting a novel pullulanase gene (pulm) which is amplified by PCR and recovered by double enzyme digestion of EcoR I and Not I with a bacillus amyloliquefaciens expression vector pBSA43 which is subjected to double enzyme digestion by the same ligase; transforming the ligation product into escherichia coli JM109 competent cells, and selecting a positive transformant through Amp resistance screening; extracting positive transformant plasmids, performing shake tube culture at 37 ℃, extracting plasmids, performing single and double enzyme digestion preliminary verification, and naming the recombinant plasmids with correct enzyme digestion verification as pBSA 43-pulm; the positive clone which is verified by enzyme digestion is sent to Beijing Hua Dagenescience and technology GmbH for sequencing so as to further ensure the correctness of the target gene and finally determine to construct and obtain the correct recombinant strain JM109/pBSA 43-pulm.

2. Recombinant expression vector pBSA43-pulm transformed Bacillus amyloliquefaciens

mu.L (50 ng/. mu.L) of pBSA 43-palm recombinant plasmid was added to 50. mu.L of Bacillus amyloliquefaciens CICC 10079 competent cells and mixed well, and then transferred to a pre-cooled electric rotor (1mm), and after ice-cooling for 1-1.5min, electric shock was applied once (25uF, 200. omega., 4.5-5.0 ms). After the shock was completed, 1mL of recovery medium (LB +0.5mol/L sorbitol +0.38mol/L mannitol) was added immediately. And (3) after shaking culture for 3h at 37 ℃ by a shaker, coating the resuscitate on an LB plate containing kanamycin, culturing for 12-24h at 37 ℃, selecting positive transformants, and performing single-enzyme and double-enzyme digestion verification to obtain the recombinant bacillus amyloliquefaciens strain CICC 10079/pBSA 43-pulm.

Example 5: construction of novel high-stability pullulanase expression recombinant bacteria of bacillus licheniformis

1. Construction of novel pullulanase expression vector pBSA43-pulm

Connecting a novel pullulanase gene (pulm) which is amplified by PCR and recovered by double enzyme digestion of EcoR I and Not I with a bacillus amyloliquefaciens expression vector pBSA43 which is subjected to double enzyme digestion by the same ligase; transforming the ligation product into escherichia coli JM109 competent cells, and selecting a positive transformant through Amp resistance screening; extracting positive transformant plasmids, performing shake tube culture at 37 ℃, extracting plasmids, performing single and double enzyme digestion preliminary verification, and naming the recombinant plasmids with correct enzyme digestion verification as pBSA 43-pulm; the positive clone which is verified by enzyme digestion is sent to Beijing Hua Dagenescience and technology GmbH for sequencing so as to further ensure the correctness of the target gene and finally determine to construct and obtain the correct recombinant strain JM109/pBSA 43-pulm.

2. Recombinant expression vector pBSA43-pulm transformed Bacillus licheniformis

mu.L (50 ng/. mu.L) of pBSA43-pulm recombinant plasmid was added to 50. mu.L of Bacillus licheniformis CGMCC 10785 competent cells and mixed well, and then transferred to a pre-cooled electric rotor (1mm), and after ice-cooling for 1-1.5min, electric shock was given once (25uF, 200. omega., 4.5-5.0 ms). After the shock was completed, 1mL of recovery medium (LB +0.5mol/L sorbitol +0.38mol/L mannitol) was added immediately. And (3) after shaking culture for 3h at 37 ℃ by a shaker, coating the resuscitate on an LB plate containing kanamycin, culturing for 12-24h at 37 ℃, selecting positive transformants, and performing single-enzyme and double-enzyme digestion verification to obtain the bacillus licheniformis recombinant strain CGMCC 10785/pBSA 43-pulm.

Example 6: expression and preparation of novel pullulanase in bacillus subtilis recombinant strain

The bacillus subtilis recombinant strain CGMCC10787/pBSA43-pulm obtained in the embodiment 3 is inoculated in 5mL of LB liquid culture medium (containing kanamycin and 50 mu g/mL), cultured at 37 ℃ and 220r/min overnight, transferred into 50mL of fresh LB culture medium according to the inoculum concentration of 2%, cultured at 37 ℃ and 220r/min for 48 hours to prepare a high-stability novel pullulanase crude enzyme solution, the pullulanase is used as a substrate to determine the enzyme activity of the novel pullulanase crude enzyme solution (under the conditions of pH4.5 and 60 ℃), the pullulanase fermentation liquor after the fermentation of the novel pullulanase recombinant strain expressed by the bacillus subtilis can reach 2980U/mL, and then flocculation half-frame filtration, ultrafiltration concentration is carried out to obtain an ultrafiltrate, and spray drying is carried out to prepare the novel pullulanase preparation.

Example 7: expression and preparation of novel pullulanase in bacillus amyloliquefaciens expression recombinant strain

Inoculating the bacillus amyloliquefaciens recombinant strain CICC 10079/pBSA43-pulm obtained in the example 4 into 5mL of LB liquid culture medium (containing kanamycin and 50 mu g/mL), culturing at 37 ℃ and 220r/min overnight, transferring into 50mL of fresh LB culture medium according to the inoculum concentration of 2%, continuously culturing at 37 ℃ and 220r/min for 48 hours to obtain a high-stability novel pullulanase crude enzyme solution, measuring the enzyme activity of the novel pullulanase crude enzyme solution (under the conditions of pH4.5 and 60 ℃) by using pullulan as a substrate, allowing the bacillus amyloliquefaciens to express the novel pullulanase recombinant strain to ferment until the enzyme activity reaches 3200U/mL, then filtering by adopting a flocculation half-frame, performing ultrafiltration concentration to obtain an ultrafiltrate, and performing spray drying to obtain the novel pullulanase preparation.

Example 8: expression and preparation of novel pullulanase in bacillus licheniformis expression recombinant strain

Inoculating the bacillus licheniformis recombinant strain CGMCC 10785/pBSA43-pulm obtained in the embodiment 5 into 5mL of LB liquid culture medium (containing kanamycin and 50 mu g/mL), culturing at 37 ℃ and 220r/min overnight, transferring into 50mL of fresh LB culture medium according to the inoculation amount of 2%, continuously culturing at 37 ℃ and 220r/min for 48h to obtain a high-stability novel pullulanase crude enzyme solution, measuring the activity of the novel pullulanase crude enzyme solution (under the conditions of pH4.5 and 60 ℃) by using pullulan as a substrate, allowing the fermentation broth of the pullulanase expressed by the bacillus to reach 3130U/mL after the fermentation of the novel pullulanase recombinant strain, filtering by adopting a flocculation half-frame, performing ultrafiltration concentration to obtain an ultrafiltrate, and performing spray drying to obtain the novel pullulanase preparation.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.

Sequence listing

<110> Shandonglongket enzyme preparations Co., Ltd

Tianjin University of Science and Technology

<120> novel pullulanase, gene, engineering bacteria and preparation method thereof

<130> 1

<141> 2018-10-11

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2787

<212> DNA

<213> Artificial sequence ()

<400> 1

gatgggaaca ccacaaacat cattgtccac tattttcgtc ctgctggtga ttatcaaccc 60

tggagtttat ggatgtggcc aaagggcggg gacggggctg aatatgattt taatcaacag 120

tctgattcct atggtgcggt tgcaagtgca gatattcctg gaagcccaag tcaggtagga 180

attatcgttc gcactcagga ttggaccaaa gatgtgagtg ttgaccgcta catagattta 240

agcaaaggac atgaggtatg gcttgtccaa ggaaacagcc aaattttcta caatgaaaag 300

gatgctgaga ccgccgcaca acccgctgtc agcaacgcat atttagatgc ttcaaatcaa 360

ctgctggtta agcttagcca gacgttaaca cttggggaag gcgcaagcgg ctttacggtt 420

catgacgaca cagcaaataa ggatattccg gtgacatctg tgtcggattc cagtacaggc 480

caagatgtaa ccgctgtttt agcaggtacc ttccaacata tttttggagg ctccgattgg 540

gcacctgata atcacagtac tttattaaaa aaggtgacta acaatctcta tcaatttaca 600

ggagatcttc ctgaaggaaa ctaccaatat aaagtggctt taaatgatag ctggaataat 660

ccaagttacc catcggacaa cattaattta gcagtccctg ctggtggcgc acacgtcact 720

ttttcgtata ttccgtccac tcatgcagtc tatgatacga ttaataatcc taatgcggat 780

ttacaagtag atgacagtgg gctcaaaaca gatctcgtga cggttactct aggggaagat 840

cccgatgtaa gccataccct atccattcaa acagagggat atcaggcaaa gcaggtcata 900

cctcgtaatg tgcttgactc atcacagtac tattattcag gagatgatct tgggaatacc 960

tataccaaaa aggcaactac ctttaaggtt tgggcaccta catccactca agtgaatgtt 1020

cttctttata acagtgcaac tggcgccgta acaaaaacgg ttccgatggc agcatccagt 1080

aatggtgttt ggaaagcaac agtcaaccaa gatcttgaaa attggtatta catgtatgag 1140

gtaacaggcc agggctctac tcgaaccgct gttgatcctt atgcaactgc gattgcacca 1200

aatggaacaa gaggtatgat tgtggaccta tctaaaacca atccggccgg ctgggagagt 1260

gacacacata ttacaccaaa gaatatagag gatgaagtca tttatgagat gcatattcgt 1320

gacttctcca ttgattctaa ttcgggtatg aataataaag ggaagtactt agctcttacc 1380

gaaaaaggaa caaagggtcc tgataatgta aaaacaggtg tggactcgtt aaaacagctc 1440

ggtattaccc atgttcagct tcagcctgtc tttggattta acagcgtgga tgagacagat 1500

ccaacccaat ataactgggg ctatgatccg cgcaactata atgttcctga gggtcagtat 1560

gcgactaatg caaatgggac aactcgaatt aaagagttta aggaaatggt tctttcactc 1620

catcgcgacc acattggggt taatatggat gttgtttata atcatacctt tgctacgcaa 1680

atctctgact ttgataagat tgtgccggaa tattactacc gcacagatga tgcaggtaac 1740

tacaccaacg gctcgggtac aggtaacgaa attgctgctg aaaagccaat ggtacaaaaa 1800

tttattattg attcacttaa gttctgggtc aatgagtatc atattgacgg cttccgtttt 1860

gacttaatgg cgctacttgg aaaagacaca atgtctaaag cctccgagca gcttcacgag 1920

atcgatccag gaatagcact ctacggcgaa ccatggacag gtggaacttc tgcacttcca 1980

actgaccagc ttttaacaaa aggggctcaa aagggtttgg gagtggccgt atttaatgac 2040

aatttacgaa atgcattgga cggcagtgtc tttgattctt cagctcaagg ctttgcaaca 2100

ggtgccacag gtttaacgga tgctattaaa aatggtgttg aagggagtat taatgacttt 2160

acctcttcac caggcgagac gattaactac gttacaagtc atgataacta taccctctgg 2220

gacaagattg cccaaagcaa tccaaacgat tctgaagccg atcgaatcaa aatggatgag 2280

ctcgctcaag cagtcgtcat gacctcgcaa ggagttccat tcatgcaggg cggagaagaa 2340

atgctccgta caaaaggtgg caacgacaat agctataatg caggagatgc agtgaatgag 2400

tttgattgga gccgaaaagc tcaataccca gatgttttca actattatag cgggctgatc 2460

catcttcgtc ttgatcaccc agccttccgc atgacaacag ctaacgaaat caatagccac 2520

ctccaatttt tagatagccc tgataataca gtggcatatg aaatatcaaa tcatgcgaat 2580

aaagacatat ggggaaatat cattgttgtc tataacccaa ataaaactgc agcaaccctt 2640

aatttgccga gcgggaaatg ggcgattaat gccactaccg ggaaaattgg agaatccacc 2700

cttggtcaag cagaggggag tgtccaagtc ccaggcatat caatgatgat ccttcatcaa 2760

gaagtaagcc catctgatgg taaatag 2787

<210> 2

<211> 928

<212> PRT

<213> Artificial sequence ()

<400> 2

Asp Gly Asn Thr Thr Asn Ile Ile Val His Tyr Phe Arg Pro Ala Gly

1 5 10 15

Asp Tyr Gln Pro Trp Ser Leu Trp Met Trp Pro Lys Gly Gly Asp Gly

20 25 30

Ala Glu Tyr Asp Phe Asn Gln Gln Ser Asp Ser Tyr Gly Ala Val Ala

35 40 45

Ser Ala Asp Ile Pro Gly Ser Pro Ser Gln Val Gly Ile Ile Val Arg

50 55 60

Thr Gln Asp Trp Thr Lys Asp Val Ser Val Asp Arg Tyr Ile Asp Leu

65 70 75 80

Ser Lys Gly His Glu Val Trp Leu Val Gln Gly Asn Ser Gln Ile Phe

85 90 95

Tyr Asn Glu Lys Asp Ala Glu Thr Ala Ala Gln Pro Ala Val Ser Asn

100 105 110

Ala Tyr Leu Asp Ala Ser Asn Gln Leu Leu Val Lys Leu Ser Gln Thr

115 120 125

Leu Thr Leu Gly Glu Gly Ala Ser Gly Phe Thr Val His Asp Asp Thr

130 135 140

Ala Asn Lys Asp Ile Pro Val Thr Ser Val Ser Asp Ser Ser Thr Gly

145 150 155 160

Gln Asp Val Thr Ala Val Leu Ala Gly Thr Phe Gln His Ile Phe Gly

165 170 175

Gly Ser Asp Trp Ala Pro Asp Asn His Ser Thr Leu Leu Lys Lys Val

180 185 190

Thr Asn Asn Leu Tyr Gln Phe Thr Gly Asp Leu Pro Glu Gly Asn Tyr

195 200 205

Gln Tyr Lys Val Ala Leu Asn Asp Ser Trp Asn Asn Pro Ser Tyr Pro

210 215 220

Ser Asp Asn Ile Asn Leu Ala Val Pro Ala Gly Gly Ala His Val Thr

225 230 235 240

Phe Ser Tyr Ile Pro Ser Thr His Ala Val Tyr Asp Thr Ile Asn Asn

245 250 255

Pro Asn Ala Asp Leu Gln Val Asp Asp Ser Gly Leu Lys Thr Asp Leu

260 265 270

Val Thr Val Thr Leu Gly Glu Asp Pro Asp Val Ser His Thr Leu Ser

275 280 285

Ile Gln Thr Glu Gly Tyr Gln Ala Lys Gln Val Ile Pro Arg Asn Val

290 295 300

Leu Asp Ser Ser Gln Tyr Tyr Tyr Ser Gly Asp Asp Leu Gly Asn Thr

305 310 315 320

Tyr Thr Lys Lys Ala Thr Thr Phe Lys Val Trp Ala Pro Thr Ser Thr

325 330 335

Gln Val Asn Val Leu Leu Tyr Asn Ser Ala Thr Gly Ala Val Thr Lys

340 345 350

Thr Val Pro Met Ala Ala Ser Ser Asn Gly Val Trp Lys Ala Thr Val

355 360 365

Asn Gln Asp Leu Glu Asn Trp Tyr Tyr Met Tyr Glu Val Thr Gly Gln

370 375 380

Gly Ser Thr Arg Thr Ala Val Asp Pro Tyr Ala Thr Ala Ile Ala Pro

385 390 395 400

Asn Gly Thr Arg Gly Met Ile Val Asp Leu Ser Lys Thr Asn Pro Ala

405 410 415

Gly Trp Glu Ser Asp Thr His Ile Thr Pro Lys Asn Ile Glu Asp Glu

420 425 430

Val Ile Tyr Glu Met His Ile Arg Asp Phe Ser Ile Asp Ser Asn Ser

435 440 445

Gly Met Asn Asn Lys Gly Lys Tyr Leu Ala Leu Thr Glu Lys Gly Thr

450 455 460

Lys Gly Pro Asp Asn Val Lys Thr Gly Val Asp Ser Leu Lys Gln Leu

465 470 475 480

Gly Ile Thr His Val Gln Leu Gln Pro Val Phe Gly Phe Asn Ser Val

485 490 495

Asp Glu Thr Asp Pro Thr Gln Tyr Asn Trp Gly Tyr Asp Pro Arg Asn

500 505 510

Tyr Asn Val Pro Glu Gly Gln Tyr Ala Thr Asn Ala Asn Gly Thr Thr

515 520 525

Arg Ile Lys Glu Phe Lys Glu Met Val Leu Ser Leu His Arg Asp His

530 535 540

Ile Gly Val Asn Met Asp Val Val Tyr Asn His Thr Phe Ala Thr Gln

545 550 555 560

Ile Ser Asp Phe Asp Lys Ile Val Pro Glu Tyr Tyr Tyr Arg Thr Asp

565 570 575

Asp Ala Gly Asn Tyr Thr Asn Gly Ser Gly Thr Gly Asn Glu Ile Ala

580 585 590

Ala Glu Lys Pro Met Val Gln Lys Phe Ile Ile Asp Ser Leu Lys Phe

595 600 605

Trp Val Asn Glu Tyr His Ile Asp Gly Phe Arg Phe Asp Leu Met Ala

610 615 620

Leu Leu Gly Lys Asp Thr Met Ser Lys Ala Ser Glu Gln Leu His Glu

625 630 635 640

Ile Asp Pro Gly Ile Ala Leu Tyr Gly Glu Pro Trp Thr Gly Gly Thr

645 650 655

Ser Ala Leu Pro Thr Asp Gln Leu Leu Thr Lys Gly Ala Gln Lys Gly

660 665 670

Leu Gly Val Ala Val Phe Asn Asp Asn Leu Arg Asn Ala Leu Asp Gly

675 680 685

Ser Val Phe Asp Ser Ser Ala Gln Gly Phe Ala Thr Gly Ala Thr Gly

690 695 700

Leu Thr Asp Ala Ile Lys Asn Gly Val Glu Gly Ser Ile Asn Asp Phe

705 710 715 720

Thr Ser Ser Pro Gly Glu Thr Ile Asn Tyr Val Thr Ser His Asp Asn

725 730 735

Tyr Thr Leu Trp Asp Lys Ile Ala Gln Ser Asn Pro Asn Asp Ser Glu

740 745 750

Ala Asp Arg Ile Lys Met Asp Glu Leu Ala Gln Ala Val Val Met Thr

755 760 765

Ser Gln Gly Val Pro Phe Met Gln Gly Gly Glu Glu Met Leu Arg Thr

770 775 780

Lys Gly Gly Asn Asp Asn Ser Tyr Asn Ala Gly Asp Ala Val Asn Glu

785 790 795 800

Phe Asp Trp Ser Arg Lys Ala Gln Tyr Pro Asp Val Phe Asn Tyr Tyr

805 810 815

Ser Gly Leu Ile His Leu Arg Leu Asp His Pro Ala Phe Arg Met Thr

820 825 830

Thr Ala Asn Glu Ile Asn Ser His Leu Gln Phe Leu Asp Ser Pro Asp

835 840 845

Asn Thr Val Ala Tyr Glu Ile Ser Asn His Ala Asn Lys Asp Ile Trp

850 855 860

Gly Asn Ile Ile Val Val Tyr Asn Pro Asn Lys Thr Ala Ala Thr Leu

865 870 875 880

Asn Leu Pro Ser Gly Lys Trp Ala Ile Asn Ala Thr Thr Gly Lys Ile

885 890 895

Gly Glu Ser Thr Leu Gly Gln Ala Glu Gly Ser Val Gln Val Pro Gly

900 905 910

Ile Ser Met Met Ile Leu His Gln Glu Val Ser Pro Ser Asp Gly Lys

915 920 925

<210> 3

<211> 2781

<212> DNA

<213> Prorolactobacillus longus ()

<400> 3

gatgggaaca ccacaaacat cgtagtccat tattttcgtc ctagtgggga ttatacggat 60

tggaatcttt ggatgtggcc ggagaacggt gatggggctg agtatgattt taatcaaccg 120

actgattctt atggggaggt tgcaagtgtg gacattcctg gaaacccaag tcaagtaggg 180

attattgtcc gtaaaggaaa ttgggatgcg aaagacattg atagtgaccg ctacatcgat 240

ttaagcaaag ggcatgagat ttggctcgtc caaggaaaca gccagatttt ctatagtgaa 300

aaggatgctg aggcagccgc acaacctgct gtaagtaacg cttatttaga tgcttccaac 360

caagtgttgg tcaagcttag ccagccgttt actcttggtg aaggttcaag cggttttacg 420

gttcatgatg acacagcaaa taaggatatt ccagttacat ctgttagtga tgccaatcag 480

gtaacggctg ttttagcagg tactttccag catatttttg gggggagtga ttgggcaccg 540

gataatcaca atactttact aaaaaaggtg aatagcaatc tctatcaatt ttcaggaaat 600

cttcctgaag gaaactacca atataaagtg gctttaaatg atagctggaa taatccgagc 660

tacccatctg ataacattaa tttgacagtg ccagctggtg gtgcccatgt tacattttct 720

tatataccat ccacccatgc tgtttatgac acgattaaca atcctaatgc ggatttacaa 780

gtagatagca gcggtgttaa gacggatctc gtggcggtta ctcttggaga aaatcctgat 840

gtaagccata ccctgtccat tcaaacagag gactatcagg caggacaggt catacctcgt 900

aaggtgcttg attcatccca gtactactat tccggagatg atctcgggaa tacctataca 960

aagaatgcaa ctacctttaa ggtctgggcg cctacatcca ctcaagtaaa tgtccttctt 1020

tataatagtg caaccggcgc ggtaactaaa acggttccaa tgaccgcatc aggccatggt 1080

gtatgggaag caacagtcaa ccaagacctt gaaaattggt attacatgta tgaggtaaca 1140

ggacaaggct caacccgaac ggctgttgat ccgtatgcaa cagctattgc accaaacgga 1200

acgagaggca tgattgtgga cctagccaaa acagacccgg ccggatggga gagtgacaaa 1260

catattacgc caaagaatat agaagatgaa gtcatctatg aaatggatgt tcgtgacttt 1320

tccatcgact ctaattcggg tatgaaaaat aaaggaaagt atttggcact tacagaaaaa 1380

ggaactaaag gccctgacaa tgtaaagaca ggggtagatt ccttaaaaca acttgggatt 1440

actcatgttc agctgcagcc tgttttcgca tttaatagtg tcaatgaaaa cgatccaact 1500

caatataatt ggggttatga ccctcgcaac tacaatgttc ctgagggaca atatgctact 1560

aatgcaaacg gaacaactcg gattaaagag tttaaggaaa tggttctttc actccatcag 1620

gaccacattg gggttaatat ggatgttgtt tataatcata cctttgccac gcaaatctct 1680

gacttcgata agattgtgcc agaatattac taccgcacgg atgatgctgg taactacact 1740

aacggctcag gtactggaaa cgaaatcgca gccgaaagac caatggttca aaaatttatt 1800

atcgattcac ttaagttttg ggtcaatgag taccacgttg acggtttccg ttttgactta 1860

atggcgttgc ttggaaaaga tacaatgtct aaagctgcca cgcagcttca tgccattgat 1920

ccaggaattg ctctctacgg tgagccatgg acaggaggaa catccgcgct gccagccgat 1980

cagcttttaa caaaaggagc tcaaaaaggc atgggagtgg ctgtatttaa tgacaatctg 2040

cgaaacggtt tggacggcag tgtctttgat tcatctgctc aaggttttgc gacaggtgct 2100

actggtttaa cggatgctat taaaaatgga gttgaaggaa gtattaatga cttcaccgct 2160

tcaccaggcg agacgatcaa ctatgtcaca agtcatgata actataccct ttgggacaag 2220

attgcccaaa gcaatccaaa cgattctgaa gcggatcgaa ttaaaatgga tgagctcgct 2280

caagcgatcg tcatgacctc acaaggcatt cctttcatgc agggcgggga agaaatgctt 2340

cgtacgaaag gcggcaacga caatagctat aatgctggtg atgtagtgaa cgagtttgat 2400

tggagcagaa aagctcaata tccagatgtt ttcaattatt atagcgggct gattcatctt 2460

cgtcttgatc acccagcctt ccgcatgacg acagctaatg aaatcaatag ccacctccaa 2520

ttcctaaata gcccagagaa cacagtggcc tatgaattat ctgatcatgc aaataaagat 2580

acatggggta atattgtggt tatttataat ccaaataaaa cggcagaaac cattaatttg 2640

ccaagcggga aatgggaaat caatgcgacg agcggtaagg tgggagaatc cacacttggt 2700

caagcagagg gcagtgttca agttccaggc atatctatga tgattcttca tcaagaagta 2760

agcccatctg atggtaaata g 2781

<210> 4

<211> 926

<212> PRT

<213> Prorolactobacillus longus ()

<400> 4

Asp Gly Asn Thr Thr Asn Ile Val Val His Tyr Phe Arg Pro Ser Gly

1 5 10 15

Asp Tyr Thr Asp Trp Asn Leu Trp Met Trp Pro Glu Asn Gly Asp Gly

20 25 30

Ala Glu Tyr Asp Phe Asn Gln Pro Thr Asp Ser Tyr Gly Glu Val Ala

35 40 45

Ser Val Asp Ile Pro Gly Asn Pro Ser Gln Val Gly Ile Ile Val Arg

50 55 60

Lys Gly Asn Trp Asp Ala Lys Asp Ile Asp Ser Asp Arg Tyr Ile Asp

65 70 75 80

Leu Ser Lys Gly His Glu Ile Trp Leu Val Gln Gly Asn Ser Gln Ile

85 90 95

Phe Tyr Ser Glu Lys Asp Ala Glu Ala Ala Ala Gln Pro Ala Val Ser

100 105 110

Asn Ala Tyr Leu Asp Ala Ser Asn Gln Val Leu Val Lys Leu Ser Gln

115 120 125

Pro Phe Thr Leu Gly Glu Gly Ser Ser Gly Phe Thr Val His Asp Asp

130 135 140

Thr Ala Asn Lys Asp Ile Pro Val Thr Ser Val Ser Asp Ala Asn Gln

145 150 155 160

Val Thr Ala Val Leu Ala Gly Thr Phe Gln His Ile Phe Gly Gly Ser

165 170 175

Asp Trp Ala Pro Asp Asn His Asn Thr Leu Leu Lys Lys Val Asn Ser

180 185 190

Asn Leu Tyr Gln Phe Ser Gly Asn Leu Pro Glu Gly Asn Tyr Gln Tyr

195 200 205

Lys Val Ala Leu Asn Asp Ser Trp Asn Asn Pro Ser Tyr Pro Ser Asp

210 215 220

Asn Ile Asn Leu Thr Val Pro Ala Gly Gly Ala His Val Thr Phe Ser

225 230 235 240

Tyr Ile Pro Ser Thr His Ala Val Tyr Asp Thr Ile Asn Asn Pro Asn

245 250 255

Ala Asp Leu Gln Val Asp Ser Ser Gly Val Lys Thr Asp Leu Val Ala

260 265 270

Val Thr Leu Gly Glu Asn Pro Asp Val Ser His Thr Leu Ser Ile Gln

275 280 285

Thr Glu Asp Tyr Gln Ala Gly Gln Val Ile Pro Arg Lys Val Leu Asp

290 295 300

Ser Ser Gln Tyr Tyr Tyr Ser Gly Asp Asp Leu Gly Asn Thr Tyr Thr

305 310 315 320

Lys Asn Ala Thr Thr Phe Lys Val Trp Ala Pro Thr Ser Thr Gln Val

325 330 335

Asn Val Leu Leu Tyr Asn Ser Ala Thr Gly Ala Val Thr Lys Thr Val

340 345 350

Pro Met Thr Ala Ser Gly His Gly Val Trp Glu Ala Thr Val Asn Gln

355 360 365

Asp Leu Glu Asn Trp Tyr Tyr Met Tyr Glu Val Thr Gly Gln Gly Ser

370 375 380

Thr Arg Thr Ala Val Asp Pro Tyr Ala Thr Ala Ile Ala Pro Asn Gly

385 390 395 400

Thr Arg Gly Met Ile Val Asp Leu Ala Lys Thr Asp Pro Ala Gly Trp

405 410 415

Glu Ser Asp Lys His Ile Thr Pro Lys Asn Ile Glu Asp Glu Val Ile

420 425 430

Tyr Glu Met Asp Val Arg Asp Phe Ser Ile Asp Ser Asn Ser Gly Met

435 440 445

Lys Asn Lys Gly Lys Tyr Leu Ala Leu Thr Glu Lys Gly Thr Lys Gly

450 455 460

Pro Asp Asn Val Lys Thr Gly Val Asp Ser Leu Lys Gln Leu Gly Ile

465 470 475 480

Thr His Val Gln Leu Gln Pro Val Phe Ala Phe Asn Ser Val Asn Glu

485 490 495

Asn Asp Pro Thr Gln Tyr Asn Trp Gly Tyr Asp Pro Arg Asn Tyr Asn

500 505 510

Val Pro Glu Gly Gln Tyr Ala Thr Asn Ala Asn Gly Thr Thr Arg Ile

515 520 525

Lys Glu Phe Lys Glu Met Val Leu Ser Leu His Gln Asp His Ile Gly

530 535 540

Val Asn Met Asp Val Val Tyr Asn His Thr Phe Ala Thr Gln Ile Ser

545 550 555 560

Asp Phe Asp Lys Ile Val Pro Glu Tyr Tyr Tyr Arg Thr Asp Asp Ala

565 570 575

Gly Asn Tyr Thr Asn Gly Ser Gly Thr Gly Asn Glu Ile Ala Ala Glu

580 585 590

Arg Pro Met Val Gln Lys Phe Ile Ile Asp Ser Leu Lys Phe Trp Val

595 600 605

Asn Glu Tyr His Val Asp Gly Phe Arg Phe Asp Leu Met Ala Leu Leu

610 615 620

Gly Lys Asp Thr Met Ser Lys Ala Ala Thr Gln Leu His Ala Ile Asp

625 630 635 640

Pro Gly Ile Ala Leu Tyr Gly Glu Pro Trp Thr Gly Gly Thr Ser Ala

645 650 655

Leu Pro Ala Asp Gln Leu Leu Thr Lys Gly Ala Gln Lys Gly Met Gly

660 665 670

Val Ala Val Phe Asn Asp Asn Leu Arg Asn Gly Leu Asp Gly Ser Val

675 680 685

Phe Asp Ser Ser Ala Gln Gly Phe Ala Thr Gly Ala Thr Gly Leu Thr

690 695 700

Asp Ala Ile Lys Asn Gly Val Glu Gly Ser Ile Asn Asp Phe Thr Ala

705 710 715 720

Ser Pro Gly Glu Thr Ile Asn Tyr Val Thr Ser His Asp Asn Tyr Thr

725 730 735

Leu Trp Asp Lys Ile Ala Gln Ser Asn Pro Asn Asp Ser Glu Ala Asp

740 745 750

Arg Ile Lys Met Asp Glu Leu Ala Gln Ala Ile Val Met Thr Ser Gln

755 760 765

Gly Ile Pro Phe Met Gln Gly Gly Glu Glu Met Leu Arg Thr Lys Gly

770 775 780

Gly Asn Asp Asn Ser Tyr Asn Ala Gly Asp Val Val Asn Glu Phe Asp

785 790 795 800

Trp Ser Arg Lys Ala Gln Tyr Pro Asp Val Phe Asn Tyr Tyr Ser Gly

805 810 815

Leu Ile His Leu Arg Leu Asp His Pro Ala Phe Arg Met Thr Thr Ala

820 825 830

Asn Glu Ile Asn Ser His Leu Gln Phe Leu Asn Ser Pro Glu Asn Thr

835 840 845

Val Ala Tyr Glu Leu Ser Asp His Ala Asn Lys Asp Thr Trp Gly Asn

850 855 860

Ile Val Val Ile Tyr Asn Pro Asn Lys Thr Ala Glu Thr Ile Asn Leu

865 870 875 880

Pro Ser Gly Lys Trp Glu Ile Asn Ala Thr Ser Gly Lys Val Gly Glu

885 890 895

Ser Thr Leu Gly Gln Ala Glu Gly Ser Val Gln Val Pro Gly Ile Ser

900 905 910

Met Met Ile Leu His Gln Glu Val Ser Pro Ser Asp Gly Lys

915 920 925

<210> 5

<211> 30

<212> DNA

<213> Artificial sequence ()

<400> 5

ccggaattcg atgggaacac cacaaacatc 30

<210> 6

<211> 42

<212> DNA

<213> Artificial sequence ()

<400> 6

aaggaaaaaa gcggccgcct atttaccatc agatgggctt ac 42

Claims (8)

1. A novel pullulanase is characterized in that the amino acid sequence of the pullulanase is shown in SEQ ID No: 2, respectively.

2. The novel pullulanase according to claim 1, wherein the gene encoding the pullulanase ispulmThe base sequence is shown in a sequence table SEQ ID No: 1 is shown.

3. The novel pullulanase according to claim 1, wherein the preparation method of the pullulanase comprises the following steps:

(1) carrying out enzyme digestion on the gene as described in claim 2, and connecting the gene with an expression vector to obtain a new recombinant vector;

(2) transforming the recombinant vector into a host cell to obtain a recombinant strain, and fermenting the recombinant strain to obtain the pullulanase of claim 1 with high stability.

4. A vector and an engineered bacterium comprising the gene of claim 2.

5. The vector and the engineering bacteria as claimed in claim 4, wherein the cloning vector is pBSA43 vector, the expression vector is pBSA43, and the host cell is Bacillus subtilis, Bacillus amyloliquefaciens or Bacillus licheniformis.

6. The vector and the engineering bacteria as claimed in claim 5, wherein:

the bacillus subtilis is CGMCC 10787;

the bacillus amyloliquefaciens is CICC 10079;

the bacillus licheniformis is CGMCC 10785.

7. The use of a novel pullulanase according to claim 1 in food processing.

8. The carrier of claim 4 and the application of the engineering bacteria in preparing the pullulanase of claim 1.

Images