CN109628433B - Pullulanase with high secretion capacity and application thereof - Google Patents

Abstract

The invention discloses pullulanase with high secretion capacity and application thereof, belonging to the technical field of enzyme engineering and microbial engineering. The pullulanase of the invention has high exocytosis capacity, and the total enzyme activity in the fermentation liquor can reach 212.0 U.mL after the escherichia coli carrying the pullulanase is subjected to shake flask fermentation for 48 hours^‑1Wherein the extracellular enzyme activity reaches 200.5 U.mL^‑1The pullulanase has mild action conditions, can hydrolyze α -1, 6-glucoside bonds in starch under the conditions of temperature of 40-60 ℃ and pH of 6.0-7.5, can reduce the cost in industrial conversion, and has potential utilization value in industries such as food, starch sugar and the like.

Description

Pullulanase with high secretion capacity and application thereof

Technical Field

The invention relates to pullulanase with high secretion capacity and application thereof, belonging to the technical field of enzyme engineering and microbial engineering.

Background

Pullulanase, also known as pullulan-6-glucan hydrolase, is a hydrolase that specifically cleaves pullulan (a linear polysaccharide of α -1, 6-glycosidic bond polymerized maltotriose repeating units linked by α -1, 4-glycosidic bonds), pullulan, and α -1, 6-glucosides of pullulan.

Pullulanases are largely classified into 2 types, pullulanases I and pullulanases II, depending on the type of active glycosidic bond, wherein pullulanase I (EC 3.2.1.41) has the activity of hydrolyzing α -1, 6-glycosidic bond and not α -1, 4-glycosidic bond in pullulan and branched dextrins, and pullulanase II, also known as amylopullulanase (EC 3.2.1.1/41), acts on both α -1, 6-glycosidic bond and α -1, 4-glycosidic bond in amylopectin or some dextrins, but not α -1, 4-glycosidic bond in pullulan.

Therefore, pullulanase is often used in combination with other amylases such as saccharifying enzyme, β -amylase, etc. or alone, and is used in the preparation of glucose syrup, maltose syrup, ultra-high maltose syrup, trehalose, etc., and is important in the fields of food, medicine, fermentation, etc.

However, because pullulanase protein molecules are generally large and generally contain more than 900 amino acids, the molecular weight of a single subunit is about 106 kDa; in addition, the pullulanase single subunit usually contains 6 structural domains and some unique amino acid sequences, so that the pullulanase is easy to form inclusion bodies, difficult to secrete to the outside of cells and low in extracellular expression level.

Therefore, a plurality of problems still exist in the development of the pullulanase at home and abroad, wherein the low fermentation unit caused by insufficient soluble secretion level of the pullulanase is one of the key factors influencing the large-scale preparation of the pullulanase. For example, after Du Ying et al expresses acidic pullulanase derived from B.nanogenensis in bacillus, the enzyme activity is only 26.5 U.mL^-1(ii) a Coconut et al futureAfter the pullulanase gene derived from Anoxybacillus sp.LM18-11 is expressed in the bacillus subtilis, although the expression activity is improved compared with that of the initial strain, the extracellular enzyme activity is only 42 U.mL^-1(ii) a Wulibang et al codon-optimize the pullulanase gene from B.acidopullulyticus, and then transfer the gene into Pichia pastoris for expression, and finally the extracellular enzyme activity is only 0.4 U.mL^-1And the requirement of industrial production is far from being met.

In addition, the problem of low extracellular expression level of the pullulanase can greatly improve the difficulty of separation and extraction of subsequent products in fermentation production of the pullulanase, further improve the industrial production cost and hinder the further popularization and application of the pullulanase.

Disclosure of Invention

[ problem ] to

The technical problem to be solved by the invention is to obtain the pullulanase with high secretion capacity, particularly high exocytosis capacity, so as to improve the yield of the pullulanase and reduce the difficulty of separation and extraction of the pullulanase.

[ solution ]

In order to solve the problems, the invention provides pullulanase with high secretion capacity, and the amino acid sequence of the pullulanase is shown in SEQ ID No. 1.

In one embodiment of the present invention, the pullulanase is derived from Bacillus aryabhattai (Bacillus aryabhattai) GEL-09; the Bacillus aryabhattai GEL-09 has been preserved in the China center for type culture Collection in 2017, 6 and 9 months, and the preservation number is CCTCC No: m2017320, the preservation address is China, Wuhan university. Said Bacillus aryabhattai GEL-09 has been described in patent application publication No. CN 107760623A.

The invention also provides a gene for coding the pullulanase.

In one embodiment of the invention, the nucleotide sequence of the gene is shown in SEQ ID No. 2.

The invention also provides a recombinant plasmid carrying the gene.

In one embodiment of the present invention, the vector of the recombinant plasmid is a pET vector, a pUC vector, a pT7-7 vector or a pGEX vector.

In one embodiment of the present invention, the vector of the recombinant plasmid is a pET-20b (+) vector.

The invention also provides a host cell carrying the gene or the recombinant plasmid.

In one embodiment of the invention, the host cell is Escherichia coli, Bacillus or yeast.

In one embodiment of the invention, the host cell is e.coli BL21(DE 3).

The invention also provides a preparation method of the pullulanase, which is to use the host cell and inoculate the host cell into a fermentation medium for fermentation.

The invention also provides the pullulanase prepared by the method.

The invention also provides the application of the pullulanase, the gene, the recombinant plasmid, the host cell, the preparation method or the prepared pullulanase in starch hydrolysis.

The invention also provides a method for hydrolyzing starch, which is to use the pullulanase or the host cell or the pullulanase prepared by the pullulanase, add the pullulanase or the host cell or the pullulanase prepared by the pullulanase and other amylases simultaneously into starch for enzymolysis, wherein the other amylases comprise one or more of saccharifying enzyme, α -amylase, β -amylase or amyloglucosidase.

[ advantageous effects ]

(1) The pullulanase of the invention has high exocytosis capacity, and the total enzyme activity in the fermentation liquor can reach 212.0 U.mL after the escherichia coli carrying the pullulanase is subjected to shake flask fermentation for 48 hours^-1Wherein the extracellular enzyme activity reaches 200.5 U.mL^-1The pullulanase accounts for 94.5 percent of the total enzyme activity, so the pullulanase is easy to ferment and prepare, and the difficulty and the cost of controlling a fermentation process can be obviously reduced;

(2) the pullulanase has mild action conditions, can hydrolyze α -1, 6-glucosidic bonds in starch at the temperature of 40-60 ℃ and the pH of 6.0-7.5, can reduce the cost in industrial conversion, and has potential utilization value in the industries of food, starch sugar and the like.

Drawings

FIG. 1: SDS-PAGE electrophoresis results of extracellular supernatant components, intracellular supernatant components and intracellular precipitation components of fermentation liquor of recombinant bacteria pul937-PET20b (+)/E.coli BL21(DE 3);

wherein M is a protein molecular weight standard; 1 is extracellular supernatant fraction; 2 is an intracellular supernatant fraction; and 3 is an intracellular precipitation component.

FIG. 2: the enzyme activity of the pullulanase of the invention is changed under different pH conditions.

FIG. 3: the pullulanase of the invention has the enzyme activity change after being preserved for 24 hours under different pH conditions.

FIG. 4: the enzyme activity of the pullulanase of the invention is changed under different temperature conditions.

FIG. 5: the pullulanase of the invention has the enzyme activity change during 12h storage under different temperature conditions.

Detailed Description

The invention will be further illustrated with reference to specific examples.

Coli BL21(DE3) was obtained from Beijing Solebao scientific Co., Ltd, Bacillus aryabhattai CCTCC No: M2017320 was obtained from China center for type culture Collection, and pET-20b (+) vector was obtained from Novagen. (the above strains Escherichia coli BL21(DE3) and Bacillus aryabhattai CCTCC No: M2017320 are commercially available and do not require preservation for patent procedures)

The media involved in the following examples are as follows:

LB liquid medium: yeast powder 5.0 g.L^-1Tryptone 10.0 g.L^-1、NaCl 10.0g·L^-1Ampicillin 100. mu.g/mL^-1。

LB solid medium: yeast powder 5.0 g.L^-1Tryptone 10.0 g.L^-1、NaCl 10.0g·L^-115g/L of agar powder and 30 mug. mL of ampicillin^-1。

TB culture medium: glycerol 5.0 g.L^-1Tryptone 12.0 g.L^-124.0 g.L of yeast powder^-1、K₂HPO₄·3H₂O16.4g·L^-1、KH₂PO₄2.3g·L^-1Glycine 7.5 g.L^-1Ampicillin 100. mu.g/mL^-1。

The detection methods referred to in the following examples are as follows:

the method for measuring the enzyme activity of the pullulanase comprises the following steps:

1mL of the substrate (1.0% pullulan solution) and 0.9mL of the substrate (50 mmol. multidot.L) were each added^-1Placing phosphate buffer solution with pH of 6.5 in a test tube, and preheating in water bath at 50 deg.C for about 10 min; adding 0.1mL of diluted enzyme solution sample, shaking and uniformly mixing, incubating at 50 ℃ for 10min, adding 3mL of DNS (Domain name System) to terminate the reaction, carrying out boiling water bath for 7min, and cooling in ice water bath; 10mL of distilled water was added to the above reaction system, the mixture was inverted and mixed, and the absorbance was measured at 540nm, and the reaction system using the inactivated enzyme solution as an enzyme solution sample under the same conditions was used as a blank.

Enzyme activity (U) is defined as: under the above-described analytical measurement conditions, the amount of enzyme that catalyzes the production of a reducing power equivalent to 1. mu. mol of glucose per minute is defined as one activity unit (1U).

Example 1: extraction of gene encoding pullulanase of the present invention and construction of recombinant bacterium containing gene encoding pullulanase of the present invention

The method comprises the following specific steps:

(1) extraction of Bacillus aryabhattai CCTCC No: M2017320 genome DNA

Selecting single colony of Bacillus aryabhattai CCTCC No. M2017320, inoculating into LB liquid culture medium, performing shake culture at 37 deg.C and 200rpm for 12h, centrifuging at 12000rpm for 2 min, and collecting thallus; washing the thalli with deionized water, centrifuging again, collecting the thalli, and suspending the collected thalli in 200 mu L Tris-EDTA (Tris-EDTA) buffer solution to obtain a resuspension solution; adding 20 mu L of lysozyme into the resuspension, preserving the heat at 37 ℃ for 30min, then adding 5 mu L of RNase, preserving the heat at 37 ℃ for 30min, then adding 30 mu L of 10% SDS (sodium dodecyl sulfate) and 15 mu L of proteinase K, preserving the heat at 37 ℃ for 60min, finally adding 100 mu L of NaCl (5M) and 80 mu L of CTAB (cetyl trimethyl ammonium bromide), preserving the heat at 65 ℃ for 20min, and obtaining a reaction solution; the reaction solution was mixed with 700. mu.L of phenol: chloroform: after extraction with isoamyl alcohol (25: 24: 1), centrifuging at 12000rpm to obtain supernatant; the supernatant was purified with 700 μ L of chloroform: after extraction of isoamyl alcohol (24: 1), centrifuging at 12000rpm, and obtaining supernatant again; mixing the obtained supernatant with 1400 μ L of isoamyl alcohol, precipitating at-20 deg.C for 30min, and centrifuging at 12000rpm to obtain precipitate; washing the precipitate with 200 μ L70% ethanol, centrifuging at 12000rpm, and collecting the precipitate again; dissolving the obtained precipitate with Tris-EDTA buffer solution to obtain Bacillus aryabhattai genome DNA;

(2) extraction of gene coding for Bacillus aryabhattai CCTCC No: M2017320 pullulanase

The following primer design was designed:

Pul937-F：5’-CCGGCGATGGCCATGGCGGATACCACAAAACTCACG-3’(SEQ ID No.3)，

Pul937-R：5’-GTGCGGCCGCAAGCTTATCTTACTAGTACAAATGTCG-3’(SEQ ID No.4)；

PCR amplifying pullulanase gene by using the primer and the extracted Bacillus aryabhattai CCTCC No. M2017320 genome as a template; carrying out PCR reaction in a 50 mu L system, wherein the reaction condition is preheating at 94 ℃ for 4min for denaturation, then entering circulation, heating at 94 ℃ for denaturation for 30s, then cooling at 56 ℃ for annealing for 30s, then heating to 72 ℃ for extension for 3min, and circulating for 30 times; storing at 72 deg.C for 10min, and storing at 12 deg.C;

the PCR fragment of 2814bp size obtained by amplification is recovered by tapping, the recovered product is linked with pET20b (+) vector after double digestion (Nco I and Hind III), the linked product is transformed into Escherichia coli JM109, and the transformed product is spread on a medium containing 30. mu.g.mL^-1Ampicillin LB solid medium, at 37 degrees C were cultured overnight, on LB solid medium pick 5 transformants,the inoculum contained 30. mu.g.mL^-1Culturing in LB liquid culture medium of ampicillin for 10h, extracting plasmid, sequencing the plasmid (SEQ ID No.4), and coding 937 amino acids with the whole length of 2814bp pullulanase gene.

(3) Verification of Gene encoding Bacillus aryabhattai CCTCC No: M2017320 pullulanase

E.coli BL21(DE3) host bacteria were heat shock-transformed with a correctly sequenced plasmid (pul937-pET20b (+)), cultured overnight at 37 ℃ on LB solid medium containing 30. mu.g/mL ampicillin, and transformants were selected; the selected recombinant bacterium pul937-PET20b (+)/E.coli BL21(DE3) is cultured in LB liquid culture medium at 37 ℃ overnight, then inoculated into TB culture medium for culture at 37 ℃ for 4h, and then induced and cultured for 44h at 30 ℃ by 0.4mM isopropylthio-D galactoside (IPTG) to obtain fermentation liquor, and the fermentation liquor is centrifuged to obtain supernatant fluid for fermentation.

Taking the obtained fermentation supernatant as an enzyme solution sample to carry out pullulanase activity determination, wherein the detection result shows that the pullulanase extracellular enzyme activity in the enzyme solution sample is 175.0 U.mL^-1The result shows that the Bacillus aryabhattai CCTCC No. M2017320 pullulanase is successfully expressed and has pullulanase activity.

Comparative example 1: construction of recombinant bacteria containing genes encoding pullulanase from other sources

The method comprises the following specific steps:

obtaining nucleotide sequences of pullulanases of different sources (respectively, Bacillus Acidopullululi pullulanase with an amino acid sequence shown as SEQ ID No.5 and a nucleotide sequence shown as SEQ ID No.6 and Bacillus megaterium pullulanase with an amino acid sequence shown as SEQ ID No.7 and a nucleotide sequence shown as SEQ ID No.8 and Pullulani naganois pullulanase with an amino acid sequence shown as SEQ ID No.9 and a nucleotide sequence shown as SEQ ID No. 10) from NCBI, obtaining the sequences through artificial synthesis, then respectively connecting the obtained sequences to pET20b (+) vectors and transforming host cells E.coli BL21(DE3) to obtain recombinant bacteria pulBac-PET20b (+)/E.coli BL21(DE3), pulBm-PET20b (+)/E.coli 21(DE3) and pul Bn-PET20b (+)/E.coli BL 3 (BLip 3621);

the Bacillus acidopululyticus pullulanase gene and a pET20b (+) vector are connected after double enzyme digestion through Nco I and Hind III, the Bacillus megaterium pullulanase gene is connected after double enzyme digestion through Nco I and EcoR I, and the Bacillus acidorenus pullulanase gene is connected after double enzyme digestion through EcoR V and Xho I.

Example 2: preparation of pullulanase from different sources and detection of secretion capacity of pullulanase from different sources

The method comprises the following specific steps:

(1) preparation of pullulanase from different sources

Recombinant bacteria pulBac-PET20b (+)/E.coli BL21(DE3), pulBm-PET20b (+)/E.coli BL21(DE3) and pulBn-PET20b (+)/E.coli BL21(DE3) prepared in example 1 and comparative example 1 are respectively inoculated into an LB liquid medium and shake-cultured at 37 ℃ for 8 hours to obtain seed solutions; then, 2.5mL of each seed solution was added to the TB medium (containing 100. mu.g/mL of the seed solution)^-1Ampicillin) at 37 ℃ for 200 r.min^-1The culture solution C obtained by fermenting the recombinant bacterium pul937-PET20b (+)/E.coli BL21(DE3) with shaking culture for 4 hours and adding 0.4mM inducer IPTG to induce culture for 48 hours to obtain a fermentation solution A, pulBac-PET20b (+)/E.coli BL21(DE3) and a fermentation solution D obtained by fermenting the recombinant bacterium pul937-PET20b (+)/E.coli BL21(DE3) and the fermentation solution B, pulBm-PET20b (+)/E.coli BL21(DE3) and the pulBn-PET20b (+)/E.coli BL21(DE 3).

(2) Detection of pullulanase from different sources

1. Sample processing

Placing the obtained fermentation liquid A, B, C, D in a 50mL centrifuge tube, centrifuging at 4 deg.C and 6000rpm for 20min, collecting supernatant (extracellular supernatant component), and collecting thalli cells precipitated by centrifugation; resuspending the centrifuged thallus cells with phosphate buffer solution with the same volume, placing on ice for ultrasonic disruption, wherein the power is 130KW, ultrasonic for 3s, and intermittent for 5s for 20 min; the disrupted cell suspension was centrifuged at 12000rpm at 4 ℃ for 5min, and the centrifuged supernatant (intracellular supernatant fraction) and cell debris (intracellular pellet fraction) were collected, respectively.

2. Sample detection

Detecting the enzyme activities of pullulanase in the extracellular supernatant component, the intracellular supernatant component and the intracellular sediment component, wherein the detection results show that the enzyme activities of the extracellular supernatant, the intracellular supernatant and the intracellular sediment in the fermentation liquid A are respectively 200.5 U.mL^-1、11.3U·mL^-1And 0.2 U.mL^-1Wherein the extracellular enzyme activity accounts for 94.6 percent of the total enzyme activity;

the enzyme activities of the extracellular supernatant, the intracellular supernatant and the intracellular precipitate in the fermentation liquid B are respectively 26.3 U.mL^-1、35.6U·mL^-1And 15.7 U.mL^-1Wherein the extracellular enzyme activity accounts for 33.9 percent of the total enzyme activity;

the enzyme activities of the extracellular supernatant, the intracellular supernatant and the intracellular precipitate in the fermentation liquid C are respectively 98.2 U.mL^-1、65.4U·mL^-1And 0.1 U.mL^-1Wherein the extracellular enzyme activity accounts for 60.0 percent of the total enzyme activity;

the enzyme activities of the extracellular supernatant, the intracellular supernatant and the intracellular precipitate in the fermentation broth D were 17.6 U.mL, respectively^-1、48.9U·mL^-1And 36.7 U.mL^-1Wherein the extracellular enzyme activity accounts for 17.1 percent of the total enzyme activity;

protein molecular weight standard P0061 purchased from Biyunstian biotechnology limited is used as a standard, and SDS-PAGE electrophoresis method is adopted to detect protein expression levels of recombinant pullulanase proteins of three components in fermentation liquor A (shown in figure 1), so that pullulanase proteins in supernatant of the fermentation liquor account for main components, and the content of recombinant proteins in intracellular supernatant is very low.

Therefore, the pullulanase has good extracellular secretion capacity and has obvious advantages in the preparation process of the pullulanase through extracellular fermentation.

Example 3: separation and purification of pullulanase of the present invention

The method comprises the following specific steps:

inoculating the recombinant bacterium pul937-PET20b (+)/E.coli BL21(DE3) into an LB liquid culture medium to be cultured for 10 hours to obtain a seed solution; transferring the seed solution into a TB culture medium according to the inoculation amount of 5% for fermentation for 4h, adding 0.4mM inducer IPTG, and performing induced culture for 48h to obtain fermentation liquor; centrifuging the fermentation broth at 4 deg.C and 10000g for 20min to collect pullulanaseThe fermentation supernatant of (a); the supernatant was 70% (NH)₄)₂SO₄Salting out, centrifuging and collecting precipitate; redissolving the precipitate at pH 6.8, 50 mmol. multidot.L^-1Dialyzing in the phosphate buffer solution for 20 hours, and replacing the buffer solution once in the middle to obtain a sample; filtering the sample by a 0.45-micron membrane to prepare a sample; purifying the sample by a DEAE anion exchange chromatographic column, collecting target components by 280nm ultraviolet on-line monitoring, and collecting eluate containing pullulanase enzyme activity in parts to obtain purified pullulanase.

Example 4: study of enzymatic Properties of pullulanase of the present invention

The method comprises the following specific steps:

(1) the optimum pH and pH stability of the pullulanase of the invention

Preparing phosphate buffer solutions with pH values of 4.0, 5.0, 6.0, 7.0 and 8.0 respectively to replace buffer solutions in the pullulanase activity determination method, determining the pullulanase activity at 50 ℃, and calculating relative enzyme activity by taking the highest enzyme activity as 100% and the other enzyme activities as comparison to investigate the optimum action pH of the enzyme (the detection result is shown in figure 2);

preparing phosphate buffer solutions with pH values of 4.0, 5.0, 6.0, 7.0 and 8.0 respectively to replace the buffer solution in the pullulanase activity determination method, storing the purified enzymes at 25 ℃ for 24 hours respectively in the buffer system, determining the pullulanase activity at 50 ℃, and calculating the residual enzyme activity by comparing the enzyme activity after storage with the initial enzyme activity of 100% to examine the pH stability (the detection result is shown in figure 3).

As can be seen from FIG. 2, the optimum pH of the pullulanase of the present invention is 6.5, the enzyme activity retention rate at pH 7.0 is 91%, and when the pH is lower than 6.5 or higher than 7.0, the pullulanase activity is rapidly decreased, i.e., the pullulanase of the present invention has good catalytic activity in a weakly acidic environment, but has weak catalytic activity in neutral and weakly alkaline environments, and after deviating from this range, the enzyme activity is rapidly decreased and almost no enzyme activity is present, which indicates that the optimum pH of the pullulanase of the present invention is mild, but the range is narrow.

As can be seen from FIG. 3, the pullulanase of the present invention has good pH stability under the weak acidic to neutral condition of pH 5.5-7.5, the preservation rate of the enzyme activity is above 80%, the residual enzyme activity is very low below pH 5.0, and the preservation rate of the enzyme activity begins to decrease after the pH is above 7.5, which indicates that the pullulanase of the present invention is suitable for preservation under the neutral or weak acidic condition. .

(2) The optimum temperature and the temperature stability of the pullulanase of the invention

Respectively measuring pullulanase enzyme activity at 40 deg.C, 45 deg.C, 50 deg.C, 55 deg.C, and 60 deg.C, calculating relative enzyme activity by taking the highest enzyme activity as 100%, and comparing the other enzyme activities with the highest enzyme activity, to examine the optimum action temperature of enzyme (see figure 4);

and (3) respectively preserving the purified enzyme at 30 ℃ and 40 ℃ for 12h, taking out part of enzyme liquid after a period of time, quickly cooling, measuring the pullulanase activity, and calculating the residual enzyme activity by taking the initial enzyme activity as 100% and comparing the enzyme activity with the enzyme activity after heat preservation so as to investigate the temperature stability of the pullulanase (the detection result is shown in figure 5).

As can be seen from FIG. 4, the optimum temperature of the pullulanase of the present invention is 50 ℃, more than 90% of the activity is maintained between 45 ℃ and 50 ℃, and the enzyme activity rapidly decreases when the temperature is higher than 50 ℃, which indicates that the pullulanase of the present invention has mild action conditions and is very suitable for the catalytic process under the condition of moderate temperature.

As can be seen from FIG. 5, the enzyme activity of the pullulanase of the present invention decreased rapidly in the first 20 hours at 30 ℃ and 40 ℃, and the enzyme activity remained about 50% after 30 hours of heat preservation at 40 ℃; and at the temperature of 30 ℃, the enzyme activity at the early stage is reduced quickly, but the enzyme activity at the later stage is kept stable, and the half-life period can reach more than 90 h.

(3) Effect of Metal chelators and Metal ions on the pullulanase of the present invention

1mL of a 1.0% pullulan solution (substrate) and 0.9mL of 50 mmol.L^-1pH 6.5 phosphate buffer into a test tube, and metal ion Ca²⁺、Fe²⁺、Zn²⁺、Mg²⁺、Zn²⁺、Cu²⁺、Co²⁺And adding the metal chelating agent EDTA mother liquor into the test tube respectively to make the metal ions Ca²⁺、Fe²⁺、Zn²⁺、Mg²⁺、Zn²⁺、Cu²⁺、Co²⁺And the final concentration of the metal chelating agent EDTA mother liquor in the test tube is 1mM and 5mM respectively to obtain a mixed solution; preheating the mixed solution in a 50 ℃ water bath for about 10min, then adding 0.1mL of diluted enzyme solution sample into the mixed solution, shaking and uniformly mixing, incubating at 50 ℃ for 10min for reaction, quickly adding 3mL of DNS (Domain name System) to terminate the reaction after the reaction is finished, developing in a boiling water bath for 7min, cooling in ice water, finally adding 10mL of distilled water into the reaction system, uniformly mixing, and measuring the light absorption value at 540 nm; the enzyme activity measured by using a sample (Control group) without adding metal ions and metal chelating agents is 100%, and the ratio of the enzyme activity measured by using other substrates to the activity is the relative enzyme activity (the result is shown in table 1).

As is clear from Table 1, 1 mmol. L^-1The EDTA has strong inhibition effect on the pullulanase, almost inactivates the pullulanase, and the residual enzyme activity is 4.8 percent; 5 mmol. L^-1After the EDTA is used for treating the pullulanase, the residual enzyme activity is 3.2 percent, which shows that the pullulanase needs the participation of metal ions when playing a role;

and in 1 mmol. L^-1In the metal ion of (2), Mn²⁺、Co²⁺The pullulanase has moderate inhibition effect on the pullulanase; fe²⁺、Zn²⁺、Cu²⁺The inhibition effect on the pullulanase is very obvious; ca²⁺The pullulanase has a certain promotion effect on the pullulanase; at 5 mmol. L^-1All of the metal ions of (a) have no promoting effect on the pullulanase of the present invention, wherein a high concentration of Mn²⁺The inhibitory effect of the ion on the enzyme is minimal, next to Ca²⁺The inhibition of the enzyme by ions, other metal ions at high concentrations, is evident.

TABLE 1 Effect of Metal ions and Metal chelators on enzyme Activity

Metal ion or chelating agent (1mM)	Relative activity＊	Metal ion or chelating agent (5mM)	Relative activity
				Control	100.0±2.2	Control	100.0±3.97
Ca2+	107.50±3.2	Ca2+	93.35±3.66
				Fe2+	17.45±0.52	Fe2+	6.62±0.33
Zn2+	12.01±0.36	Zn2+	6.54±0.32
				Mg2+	93.20±2.8	Mg2+	95.97±2.79
Mn2+	72.35±2.2	Mn2+	71.62±3.58
				Cu2+	1.40±0.14	Cu2+	0.94±0.04
Co2+	52.85±1.59	Co2+	19.71±0.98
				EDTA	4.75±0.14	EDTA	3.17±0.98

(4) Kinetic parameters of the pullulanase of the present invention

Respectively taking pullulan solutions with the concentrations of 0.1, 0.25, 0.5, 1.0, 1.5, 2.0, 3.0, 4.0, 5.0, 6.0, 8.0 and 10.0mg/mL as substrates, measuring the initial hydrolysis activity of the pullulanase at the temperature of 50 ℃ and the pH value of 6.5, and fitting the data by adopting a nonlinear regression method in GraphPad Prism 7.0 software to respectively obtain the K of the Michaelis-Menten equation_mAnd V_maxValue, then K is calculated_catAnd K_cat/K_mA value;

K_catthe calculation formula of the value is: k_cat＝V_max/M/106124.74/60; wherein M is the mass of the enzyme added in the reaction, and the unit is mg.

The results show that the maximum reaction rate (V) of the pullulanase of the present invention on the pullulan substrate_max) Catalytic constant (K)_cat) Substrate affinity (K)_m) And catalytic efficiency (K)_cat/K_m) Respectively 489.6U/mg^-1、844.9s^-1、0.19mg·mL^-1、4371.0s^-1·mg^-1mL, which indicates that the pullulanase of the present invention has higher activity.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> Nanjing university of forestry

<120> pullulanase with high secretion capacity and application thereof

<160>10

<170>PatentIn version 3.3

<210>1

<211>937

<212>PRT

<213> Artificial sequence

<400>1

Ala Asp Thr Thr Lys Leu Thr Ile His Tyr Gln Pro Ala Ser Asn Asp

1 5 10 15

Thr Lys Glu Trp Gly Leu Trp Val Phe Pro Glu Gly Gly Glu Gly Lys

20 25 30

Pro Tyr Ala Phe Thr Gly Glu Asp Gln Phe Gly Lys Val Ala Glu Val

35 40 45

Glu Leu Pro Gly Thr Tyr Asp Lys Val Gly Phe Ile Val Arg Thr Glu

50 55 60

Ser Trp Glu Lys Asp Gly Gly Asp Arg Phe Val Ser Val Glu Asn Gly

65 70 75 80

Glu Gly Glu Val Trp Val Lys Ser Gly Asp Glu His Thr Tyr Thr Ser

85 90 95

Pro Pro Asp Gly Glu Tyr Arg Asp Leu Pro Glu Phe Asp Lys Val Asn

100 105 110

Val Thr Leu Asn Tyr His Arg Tyr Asp Gly Asp Tyr Ser Gly Trp Asn

115 120 125

Ile Trp Thr Trp Pro Gly Asp Glu Lys Glu Gly Lys Gln Ile Glu Phe

130 135 140

Thr Glu Asp Thr Asn Phe Gly Lys Lys Ala Thr Tyr Thr Ile Asn Ser

145 150 155 160

Gly Ser Gly Asn Leu Phe Asp Lys Ile Gly Phe Ile Val Arg His Ser

165 170 175

Thr Ser Asp Ser Asp Trp Glu Asn Lys Asp Gly Gly Asn Arg Phe Ile

180 185 190

Thr Lys Val Gly Lys Asp Gly Asn Val Glu Val Trp Ile Val Gln Gly

195 200 205

Gln Asn Arg Ile Tyr Tyr Asp Arg Ala Gly Val Asp Leu Thr Arg Lys

210 215 220

Ile Met Lys Ala Thr Met Asp Thr Phe Asn Gln Ile Thr Leu Glu Thr

225 230 235 240

Asn Val Pro Phe Asp Ser Ser Lys Ser Leu Gly Asp Ile Glu Ile Asp

245 250 255

Gly Ala Gln Ile Glu Lys Val Thr Pro Tyr Lys Glu Gly Gly Asp Ala

260 265 270

Val Thr Thr Lys Ile Lys Ile Ile Thr Lys Arg Pro Leu Asp Val Thr

275 280 285

Gln Thr Tyr Arg Val Lys Gln Gln Gly Tyr Gly Ser Ala Asp Val Val

290 295 300

Asn Gly Asn Val Val Arg Thr Lys Glu Phe Asp Glu Lys Tyr Ala Tyr

305 310 315 320

Ser Gly Asn Asp Leu Gly Asn Thr Tyr Ser Lys Lys Gln Thr Asn Phe

325 330 335

Arg Val Trp Ala Pro Thr Ala Ser Glu Ala Lys Leu Val Thr Tyr Ser

340 345 350

Ser Trp Asn Ser Lys Ala Leu Lys Glu Ile Ser Met Thr Lys Ser Glu

355 360 365

Lys Gly Thr Trp Lys Ala Glu Leu Lys Gly Asn Gln Asp Glu Leu Ile

370 375 380

Tyr Thr Tyr Lys Val Lys Ile Gly Asn Val Trp Asn Glu Ala Val Asp

385 390 395 400

Pro Tyr Val Arg Ala Thr Thr Val Asn Gly Asp Arg Gly Val Val Val

405 410 415

Asp Leu Ala Lys Thr Asn Pro Lys Lys Trp Ser Thr Asn Lys Pro Lys

420 425 430

Phe Lys Asn Pro Glu Asp Ala Ile Ile Tyr Glu Leu His Val Arg Asp

435 440 445

Leu Ser Ser Gln Lys Glu Ser Gly Ile Lys Asn Lys Gly Lys Tyr Leu

450 455 460

Gly Val Ala Glu Trp Asn Thr Lys Gly Pro Asn Gly Val Lys Thr Gly

465 470 475 480

Leu Ser His Ile Lys Asp Leu Gly Val Thr His Val Gln Phe Leu Pro

485 490 495

Ile Tyr Asp Tyr Arg Thr Val Asp Glu Thr Lys Leu Asn Glu Pro Gln

500 505 510

Phe Asn Trp Gly Tyr Asp Pro Lys Asn Tyr Asn Val Pro Glu Gly Ser

515 520 525

Tyr Ser Thr Asn Pro Tyr Asn Pro Lys Thr Arg Ile Ile Glu Leu Lys

530535 540

Gln Met Ile Gln Thr Leu His Asp Lys Gln Leu Arg Met Val Met Asp

545 550 555 560

Val Val Tyr Asn His Val Tyr Ala Val Ser Glu His Ser Phe Asp Lys

565 570 575

Leu Val Pro Gly Tyr Tyr Phe Arg Tyr Lys Glu Asp Gly Thr Leu Ser

580 585 590

Asn Gly Thr Gly Val Gly Asn Asp Thr Ala Ser Glu Arg Lys Met Val

595 600 605

Arg Lys Phe Ile Val Asp Ser Val Ala Tyr Trp Ala Lys Glu Tyr His

610 615 620

Ile Asp Gly Phe Arg Phe Asp Leu Met Gly Ile His Asp Thr Lys Thr

625 630 635 640

Met Asn Glu Val Arg Lys Lys Leu Asp Glu Leu Asp Pro Ser Ile Ile

645 650 655

Val Leu Gly Glu Gly Trp Asp Leu Gly Thr Glu Leu Asp Ala Lys Leu

660 665 670

Lys Ala Asn Gln Lys Asn Ala Gln Asp Met Lys Arg Ile Ala His Phe

675 680 685

Asn Asp Gly Met Arg Asp Gly Leu Lys Gly Ser Val Phe Phe Asp His

690695 700

Asp Asn Gly Phe Val Asn Gly Lys Gln Gly Gln Glu Lys Leu Ile Gln

705 710 715 720

Gln Ser Ile Ala Ala Gly Ile Asp Tyr Asp Arg Ser Thr Ala Thr Tyr

725 730 735

Glu Asp Pro Asp Gln Val Val Thr Tyr Val Glu Ala His Asp Asn His

740 745 750

Thr Leu Trp Asp Lys Leu Gln Leu Thr Asn Pro Ala Asp Thr Glu Gln

755 760 765

Thr Lys Lys Gln Met His Lys Leu Ala Ser Ser Ile Ile Leu Thr Ser

770 775 780

Gln Gly Met Asn Phe Ile His Ala Gly Gln Glu Phe Met Arg Thr Lys

785 790 795 800

Gly Gly Asp His Asn Ser Tyr Gln Ser Pro Asp Ser Val Asn Gln Leu

805 810 815

Asp Trp Lys Arg Arg Ala Ala Phe Arg Gln Glu Val Asn Tyr Met Lys

820 825 830

Gly Leu Ile Ala Leu Arg Lys Gln Tyr Ser Ser Phe Arg Met Thr Ser

835 840 845

Ala Gln Ala Ile His Gln Asn Leu Arg Phe Val Asp Ala Pro Ala Asn

850 855 860

Val Val Gly Tyr Thr Leu Asn Ala Lys Ala Asn Lys Asp Lys Ala Asn

865 870 875 880

Glu Ile Met Val Ile His Asn Ala Asn Lys Gln Ala Gln Thr Val His

885 890 895

Leu Pro Ser Asn Arg Thr Trp Arg Leu Leu Val Asp Gly Glu Arg Ala

900 905 910

Gly Thr Lys Thr Leu Arg Thr Val Lys Gly Asn Thr Ile Asn Val Ser

915 920 925

Pro Leu Ser Thr Phe Val Leu Val Arg

930 935

<210>2

<211>2814

<212>DNA

<213> Artificial sequence

<400>2

gcggatacca caaaactcac gattcactat cagcctgctt caaacgatac aaaagaatgg 60

ggattatggg tttttcctga aggaggagaa gggaagcctt acgcatttac aggggaagat 120

caatttggaa aagtagcgga agttgaacta cccggtactt atgacaaagt aggttttatt 180

gtacgaacag agtcgtggga aaaagatgga ggagaccgct tcgtttcagt ggagaacggt 240

gaaggagaag tatgggtaaa aagtggagat gaacatacat atacgtctcc tcctgacggt 300

gaatatcgag atttaccgga atttgataaa gtaaatgtta ccttaaacta tcatcggtac 360

gatggagatt atagcgggtg gaacatttgg acatggccag gtgatgaaaa agaaggcaag 420

caaatcgaat ttacggaaga cacgaatttt gggaagaaag caacttacac aattaacagt 480

ggaagtggta atttatttga caaaattggt tttattgtac gccattctac tagtgacagc 540

gattgggaaa ataaagacgg aggaaaccgc tttattacca aggttggtaa agatgggaat 600

gtagaagtat ggattgttca agggcaaaat cgaatttatt acgatagagc tggagtagat 660

ctcactcgga aaatcatgaa ggcgacgatg gatacattta atcaaatcac cttagaaaca 720

aacgtgccgt ttgactcttc taagagttta ggagacattg aaattgacgg agctcaaatt 780

gagaaagtga caccttataa agagggagga gacgctgtta ctactaaaat taaaatcata 840

acaaaacggc ctttggacgt tacacaaacg tatagagtta agcaacaagg atacggatca 900

gctgatgtag tcaatggaaa tgtcgtgcgt acgaaagaat ttgacgaaaa gtatgcatat 960

agcggaaacg atttaggaaa cacatattct aagaaacaaa caaattttcg cgtatgggct 1020

ccaactgcaa gcgaagccaa gctagtgact tattcgtcat ggaactcgaa agctttaaaa 1080

gaaatttcta tgactaaaag tgaaaaagga acgtggaaag cggagttaaa aggaaatcaa 1140

gatgaactaa tttatacgta caaagtaaaa attgggaacg tctggaatga agcggttgat 1200

ccatatgtac gagcaacaac ggtcaatgga gatcgcggag tcgtcgtaga tttggctaaa 1260

acaaatccga aaaagtggag tacaaataag ccgaaattta aaaatccaga agatgccatt 1320

atctatgaac tgcacgtacg agatttatcg tctcaaaaag agagcggtat caaaaacaaa 1380

ggaaaatatt taggcgtagc ggagtggaat acgaaaggac caaatggagt aaaaacagga 1440

ctcagtcata ttaaagattt aggtgtaacg cacgtccagt tcctgcctat ttacgattat 1500

cgtacggtgg atgaaacgaa attaaacgag ccgcagttta actggggata tgatccgaaa 1560

aattataacg tcccagaagg ctcctattca acaaacccat ataatcctaa gactagaatt 1620

attgagctca aacaaatgat tcaaacgctt catgacaagc agcttcgcat ggtaatggac 1680

gttgtttata atcacgtgta tgcagtgagt gagcatagtt ttgataaact agttccaggc 1740

tactacttcc gttataaaga agatggaact ctatccaacg gaacaggtgt tggaaacgac 1800

acggcgtctg aacggaaaat ggttcggaag tttatcgtag attctgttgc gtattgggca 1860

aaagagtacc acattgacgg gtttcggttt gatttaatgg ggattcacga tacaaagaca 1920

atgaatgaag tgagaaagaa gttagatgaa cttgatcctt ccattatcgt cttaggagag 1980

ggctgggatc taggaaccga gcttgacgct aagctcaaag ctaaccagaa aaacgctcag 2040

gatatgaagc gcatcgctca ctttaatgac ggtatgcggg atggtcttaa aggcagcgta 2100

ttttttgatc atgacaacgg atttgtgaat ggaaagcaag gacaagaaaa gctcatacag 2160

caaagtatag cagctggaat tgattatgat cgttcaactg ccacgtatga agatccagat 2220

caagttgtta cgtatgtaga agcgcacgat aaccatacgt tatgggataa gcttcagctg 2280

acgaaccctg ctgacaccga gcaaacgaaa aagcaaatgc acaagcttgc ttcttctatt 2340

attttaacat ctcaaggaat gaactttata catgcaggtc aagagtttat gagaacaaaa 2400

ggcggagacc ataacagcta tcagtcaccc gattctgtca atcagctaga ttggaagcgc 2460

cgagcagctt tcagacaaga agtaaattac atgaagggac ttattgcgct tcgaaagcaa 2520

tattcgtcat ttagaatgac gagtgcacag gctattcatc aaaatttacg ctttgttgat 2580

gcaccagcaa acgtagtagg ttatacgtta aatgctaaag ctaataaaga taaagcaaac 2640

gaaataatgg tgattcataa tgcaaataaa caagctcaaa cggttcattt gccttctaac 2700

agaacgtgga gattacttgt tgacggcgag cgggccggaa caaaaacact ccgtacggtg 2760

aaaggaaata caataaacgt ttcgcctctt tcgacatttg tactagtaag ataa 2814

<210>3

<211>36

<212>DNA

<213> Artificial sequence

<400>3

ccggcgatgg ccatggcgga taccacaaaa ctcacg 36

<210>4

<211>37

<212>DNA

<213> Artificial sequence

<400>4

gtgcggccgc aagcttatct tactagtaca aatgtcg 37

<210>5

<211>897

<212>PRT

<213> Artificial sequence

<400>5

Met Trp Pro Tyr Gln Pro Val Asn Gly Asn Gly Ala Ala Tyr Gln Phe

1 5 10 15

Thr Gly Thr Asn Asp Asp Phe Gly Ala Val Ala Asp Thr Gln Val Pro

20 25 30

Gly Asp Asn Thr Gln Val Gly Leu Ile Val Arg Lys Asn Asp Trp Ser

35 40 45

Glu Lys Asn Thr Pro Asn Asp Leu His Ile Asp Leu Ala Lys Gly His

50 55 60

Glu Val Trp Ile Val Gln Gly Asp Pro Thr Ile Tyr Tyr Asn Leu Ser

65 70 75 80

Asp Ala Gln Ala Ala Ala Ile Pro Ser Val Ser Asn Ala Tyr Leu Asp

85 90 95

Asp Glu Lys Thr Val Leu Ala Lys Leu Ser Met Pro Met Thr Leu Ala

100 105 110

Asp Ala Ala Ser Gly Phe Thr Val Ile Asp Lys Thr Thr Gly Glu Lys

115 120 125

Ile Pro Val Thr Ser Ala Val Ser Ala Asn Pro Val Thr Ala Val Leu

130 135 140

Val Gly Asp Leu Gln Gln Ala Leu Gly Ala Ala Asn Asn Trp Ser Pro

145 150 155 160

Asp Asp Asp His Thr Leu Leu Lys Lys Ile Asn Pro Asn Leu Tyr Gln

165 170 175

Leu Ser Gly Thr Leu Pro Ala Gly Thr Tyr Gln Tyr Lys Ile Ala Leu

180 185 190

Asp His Ser Trp Asn Thr Ser Tyr Pro Gly Asn Asn Val Ser Leu Thr

195200 205

Val Pro Gln Gly Gly Glu Lys Val Thr Phe Thr Tyr Ile Pro Ser Thr

210 215 220

Asn Gln Val Phe Asp Ser Val Asn His Pro Asn Gln Ala Phe Pro Thr

225 230 235 240

Ser Ser Ala Gly Val Gln Thr Asn Leu Val Gln Leu Thr Leu Ala Ser

245 250 255

Ala Pro Asp Val Thr His Asn Leu Asp Val Ala Ala Asp Gly Tyr Lys

260 265 270

Ala His Asn Ile Leu Pro Arg Asn Val Leu Asn Leu Pro Arg Tyr Asp

275 280 285

Tyr Ser Gly Asn Asp Leu Gly Asn Val Tyr Ser Lys Asp Ala Thr Ser

290 295 300

Phe Arg Val Trp Ala Pro Thr Ala Ser Asn Val Gln Leu Leu Leu Tyr

305 310 315 320

Asn Ser Glu Lys Gly Ser Ile Thr Lys Gln Leu Glu Met Gln Lys Ser

325 330 335

Asp Asn Gly Thr Trp Lys Leu Gln Val Ser Gly Asn Leu Glu Asn Trp

340 345 350

Tyr Tyr Leu Tyr Gln Val Thr Val Asn Gly Thr Thr Gln Thr Ala Val

355360 365

Asp Pro Tyr Ala Arg Ala Ile Ser Val Asn Ala Thr Arg Gly Met Ile

370 375 380

Val Asp Leu Lys Ala Thr Asp Pro Ala Gly Trp Gln Gly Asp His Glu

385 390 395 400

Gln Thr Pro Ala Asn Pro Val Asp Glu Val Ile Tyr Glu Ala His Val

405 410 415

Arg Asp Phe Ser Ile Asp Ala Asn Ser Gly Met Lys Asn Lys Gly Lys

420 425 430

Tyr Leu Ala Phe Thr Glu His Gly Thr Lys Gly Pro Asp His Val Lys

435 440 445

Thr Gly Ile Asp Ser Leu Lys Glu Leu Gly Ile Thr Thr Val Gln Leu

450 455 460

Gln Pro Val Glu Glu Phe Asn Ser Ile Asp Glu Thr Gln Pro Asp Thr

465 470 475 480

Tyr Asn Trp Gly Tyr Asp Pro Arg Asn Tyr Asn Val Pro Glu Gly Ala

485 490 495

Tyr Ala Thr Thr Pro Glu Gly Thr Ala Arg Ile Thr Glu Leu Lys Gln

500 505 510

Leu Ile Gln Ser Leu His Gln Gln Arg Ile Gly Val Asn Met Asp Val

515520 525

Val Tyr Asn His Thr Phe Asp Val Met Val Ser Asp Phe Asp Lys Ile

530 535 540

Val Pro Gln Tyr Tyr Tyr Arg Thr Asp Ser Asn Gly Asn Tyr Thr Asn

545 550 555 560

Gly Ser Gly Cys Gly Asn Glu Phe Ala Thr Glu His Pro Met Ala Gln

565 570 575

Lys Phe Val Leu Asp Ser Val Asn Tyr Trp Val Asn Glu Tyr His Val

580 585 590

Asp Gly Phe Arg Phe Asp Leu Met Ala Leu Leu Gly Lys Asp Thr Met

595 600 605

Ala Lys Ile Ser Asn Glu Leu His Ala Ile Asn Pro Gly Ile Val Leu

610 615 620

Tyr Gly Glu Pro Trp Thr Gly Gly Thr Ser Gly Leu Ser Ser Asp Gln

625 630 635 640

Leu Val Thr Lys Gly Gln Gln Lys Gly Leu Gly Ile Gly Val Phe Asn

645 650 655

Asp Asn Ile Arg Asn Gly Leu Asp Gly Asn Val Phe Asp Lys Thr Ala

660 665 670

Gln Gly Phe Ala Thr Gly Asp Pro Asn Gln Val Asp Val Ile Lys Asn

675 680685

Gly Val Ile Gly Ser Ile Gln Asp Phe Thr Ser Ala Pro Ser Glu Thr

690 695 700

Ile Asn Tyr Val Thr Ser His Asp Asn Met Thr Leu Trp Asp Lys Ile

705 710 715 720

Leu Ala Ser Asn Pro Ser Asp Thr Glu Ala Asp Arg Ile Lys Met Asp

725 730 735

Glu Leu Ala His Ala Val Val Phe Thr Ser Gln Gly Val Pro Phe Met

740 745 750

Gln Gly Gly Glu Glu Met Leu Arg Thr Lys Gly Gly Asn Asp Asn Ser

755 760 765

Tyr Asn Ala Gly Asp Ser Val Asn Gln Phe Asp Trp Ser Arg Lys Ala

770 775 780

Gln Phe Lys Asp Val Phe Asp Tyr Phe Ser Ser Met Ile His Leu Arg

785 790 795 800

Asn Gln His Pro Ala Phe Arg Met Thr Thr Ala Asp Gln Ile Lys Gln

805 810 815

Asn Leu Thr Phe Leu Glu Ser Pro Thr Asn Thr Val Ala Phe Glu Leu

820 825 830

Lys Asn Tyr Ala Asn His Asp Thr Trp Lys Asn Ile Ile Val Met Tyr

835 840845

Asn Pro Asn Lys Thr Ser Gln Thr Leu Asn Leu Pro Ser Gly Asp Trp

850 855 860

Thr Ile Val Gly Leu Gly Asp Gln Ile Gly Glu Lys Ser Leu Gly His

865 870 875 880

Val Met Gly Asn Val Gln Val Pro Ala Ile Ser Thr Leu Ile Leu Lys

885 890 895

Gln

<210>6

<211>2766

<212>DNA

<213> Artificial sequence

<400>6

gacagcacca gtaccaaggt catcgtccac taccacagat tcgacagtaa ttacaccaac 60

tgggatgttt ggatgtggcc ataccaacca gtcaacggaa acggtgctgc atatcagttt 120

actggaacca acgacgactt cggtgcagtc gctgacactc aggttccagg tgacaacacc 180

caggtcggtc tcatcgtcag aaagaacgac tggtctgaga agaacactcc taatgacttg 240

cacatcgact tggctaaggg tcacgaggtc tggatcgtcc agggtgatcc taccatctac 300

tataaccttt ctgatgctca agcagctgcc atccctagcg tcagcaacgc ttacttggac 360

gacgagaaga ctgtcttggc taaactgtcc atgccaatga ctcttgctga cgcagcctct 420

ggtttcactg tcatcgacaa gactactgga gagaagattc cagttactag cgcagtcagt 480

gccaacccag tcactgctgt cttggtcggt gatcttcagc aagcacttgg tgctgctaac 540

aactggagtc ctgacgacga ccataccttgttgaagaaaa tcaaccctaa cttgtatcag 600

cttagtggca ccttgcctgc tggcacttat cagtacaaaa tcgctcttga tcacagctgg 660

aacaccagtt accctggcaa taacgtctcc ttgaccgtcc cacaaggtgg tgagaaagtc 720

actttcactt acatccctag cactaaccaa gtctttgact ctgttaacca cccaaatcag 780

gcttttccaa ccagtagtgc tggtgttcaa accaaccttg ttcagcttac ccttgcttct 840

gctcctgacg ttactcacaa cctggacgtc gctgctgatg gctataaggc tcataacatc 900

cttccaagaa acgtcctgaa ccttccaaga tacgactact ctggcaacga ccttggcaac 960

gtctacagca aagacgctac cagtttcaga gtctgggcac ctactgccag taacgttcaa 1020

ctcttgctct ataactccga gaagggaagt atcaccaagc aacttgagat gcagaagtcc 1080

gacaatggaa cctggaagct ccaagtcagt ggcaacttgg agaattggta ctacttgtac 1140

caggttactg tcaatggtac tacccagact gctgttgacc cttacgctag agccatcagt 1200

gtcaacgcta ccagaggcat gatcgttgat ctcaaggcta ctgatccagc tggttggcaa 1260

ggagaccacg agcaaactcc agctaaccct gttgacgagg tcatctacga agctcacgtc 1320

agagacttca gtatcgacgc aaacagtggc atgaagaaca aaggtaagta ccttgccttc 1380

actgaacatg gcaccaaagg tcctgatcac gtcaaaactg gcatcgactc tctcaaagag 1440

cttggtatta ctaccgtcca gcttcagcca gtcgaagagt tcaactccat cgacgaaact 1500

caaccagaca cttacaattg gggttatgac cctagaaact acaatgttcc tgaaggtgcc 1560

tacgctacca ctcctgaggg tactgctaga atcaccgaac tcaaacagct catccagtcc 1620

ttgcaccaac aaagaatcgg tgtcaacatg gacgtcgtct acaaccacactttcgacgtc 1680

atggtcagcg acttcgacaa gatcgttcca cagtactact acagaactga ctccaacggt 1740

aactacacta atggctctgg ctgtggtaac gagtttgcta ctgaacatcc tatggctcag 1800

aagttcgtct tggactccgt caactactgg gtcaacgaat atcatgttga cggtttcaga 1860

ttcgatctta tggccttgct tggcaaggat actatggcta agatcagcaa cgaacttcac 1920

gctatcaatc caggcatcgt cctttacggt gagccttgga ctggtggcac cagtggtctt 1980

agctctgatc agttggtcac taaaggccag cagaaaggtc ttggcatcgg tgtctttaac 2040

gacaacatca gaaacggttt ggacggtaat gtcttcgaca agactgctca gggtttcgct 2100

actggtgatc ctaaccaagt tgacgtcatc aagaacggtg tcattggctc catccaggac 2160

ttcaccagtg ctccatctga gaccatcaat tacgtcactt ctcacgacaa tatgactttg 2220

tgggacaaga tccttgcttc caacccttcc gataccgaag cagatagaat caagatggac 2280

gagcttgctc acgctgtcgt ctttaccagt cagggtgttc ctttcatgca gggaggtgag 2340

gagatgctta gaaccaaagg tggtaacgac aattcctaca atgctggtga ctccgtcaac 2400

cagtttgatt ggagtagaaa ggctcagttc aaggacgtct tcgactattt cagctccatg 2460

atccacttga gaaaccaaca tccagctttc agaatgacca ctgctgacca gatcaagcag 2520

aacttgacct ttcttgagtc tcctaccaat actgtcgcat ttgaactcaa gaactacgct 2580

aatcacgaca cctggaagaa catcatcgtt atgtacaatc ctaacaaaac cagtcagact 2640

ttgaacttgc cttctggtga ctggactatc gtcggtcttg gtgatcagat cggagaaaag 2700

agccttggac acgtcatggg taacgtccag gtcccagcca tctccacttt gatccttaag 2760

cagtaa 2766

<210>7

<211>937

<212>PRT

<213> Artificial sequence

<400>7

Ala Asp Ser Thr Lys Ile Thr Ile His Tyr Gln Pro Ala Ser Asn Asp

1 5 10 15

Thr Lys Glu Trp Gly Leu Trp Val Phe Pro Glu Gly Gly Glu Gly Lys

20 25 30

Ala Tyr Ala Phe Thr Gly Glu Asp Gln Phe Gly Lys Val Ala Glu Val

35 40 45

Glu Leu Pro Gly Thr Tyr Asp Lys Val Gly Phe Ile Val Arg Thr Glu

50 55 60

Ser Trp Glu Lys Asp Gly Gly Asp Arg Phe Val Ser Val Glu Asn Gly

65 70 75 80

Glu Gly Glu Val Trp Val Lys Ser Gly Asp Glu His Thr Tyr Thr Ser

85 90 95

Pro Pro Asp Gly Glu Tyr Arg Asp Leu Pro Lys Phe Asp Lys Val Asn

100 105 110

Val Thr Leu Asn Tyr His Arg Tyr Asp Gly Asp Tyr Ser Gly Trp Asn

115 120 125

Ile Trp Thr Trp Pro Gly AspGlu Lys Glu Gly Lys Gln Ile Gln Phe

130 135 140

Thr Glu Asp Thr Asn Phe Gly Lys Arg Ala Thr Tyr Thr Leu Asn Ser

145 150 155 160

Gly Thr Gly Asn Leu Phe Asp Lys Ile Gly Phe Ile Val Arg His Ser

165 170 175

Thr Ser Asp Ser Asp Trp Glu Asn Lys Asp Gly Gly Asp Arg Phe Ile

180 185 190

Thr Lys Val Gly Lys Asp Gly Asn Val Glu Val Trp Ile Val Gln Gly

195 200 205

Gln Asn Arg Ile Tyr Tyr Asp Arg Ala Val Val Asp Ile Thr Arg Lys

210 215 220

Ile Thr Lys Ala Thr Met Asp Ala Phe Asn Gln Ile Thr Leu Glu Thr

225 230 235 240

Asn Val Pro Phe Asp Ser Ser Lys Ser Val Gly Asp Ile Glu Ile Asp

245 250 255

Gly Ala Gln Ile Glu Lys Val Thr Pro Tyr Lys Glu Gly Gly Ala Ser

260 265 270

Val Thr Thr Lys Val Lys Ile Ile Thr Lys Gln Pro Leu Asp Val Thr

275 280 285

Lys Thr Tyr Lys Val Lys Gln Lys GlyTyr Gly Ser Ala Asn Val Val

290 295 300

Asn Gly Asn Val Val Arg Thr Lys Glu Phe Asp Glu Lys Tyr Ala Tyr

305 310 315 320

Ser Gly Asn Asp Leu Gly Asn Thr Tyr Ser Lys Lys Gln Thr Asn Phe

325 330 335

Arg Val Trp Ala Pro Thr Ala Ser Glu Ala Lys Leu Val Thr Tyr Ser

340 345 350

Ser Trp Asn Ser Lys Ala Val Lys Glu Ile Ser Met Thr Lys Ser Glu

355 360 365

Lys Gly Thr Trp Lys Ala Glu Leu Lys Gly Asn Gln Asp Glu Leu Ile

370 375 380

Tyr Thr Tyr Lys Val Lys Ile Gly Asn Ser Trp Asn Glu Ala Val Asp

385 390 395 400

Pro Tyr Val Arg Ala Thr Thr Val Asn Gly Asp Arg Gly Val Val Val

405 410 415

Asp Leu Ala Lys Thr Asn Pro Arg Lys Trp Ser Thr Asn Lys Pro Lys

420 425 430

Phe Lys Asn Pro Glu Asp Ala Ile Ile Tyr Glu Leu His Val Arg Asp

435 440 445

Leu Ser Ser Gln Lys Glu Ser Gly Ile Lys AsnLys Gly Lys Tyr Leu

450 455 460

Gly Val Ala Glu Trp Asn Thr Lys Gly Pro Asn Gly Val Lys Thr Gly

465 470 475 480

Leu Ser His Ile Lys Asp Leu Gly Val Thr His Val Gln Phe Leu Pro

485 490 495

Ile Tyr Asp Tyr Arg Thr Val Asp Glu Thr Lys Leu Asn Glu Pro Gln

500 505 510

Phe Asn Trp Gly Tyr Asp Pro Lys Asn Tyr Asn Val Pro Glu Gly Ser

515 520 525

Tyr Ser Thr Asn Pro Tyr Asn Pro Lys Thr Arg Ile Ile Glu Leu Lys

530 535 540

Gln Met Ile Gln Thr Leu His Asp Lys Gln Leu Arg Met Val Met Asp

545 550 555 560

Val Val Tyr Asn His Val Tyr Ala Val Ser Glu His Ser Phe Asp Lys

565 570 575

Leu Val Pro Gly Tyr Tyr Phe Arg Tyr Lys Glu Asp Gly Thr Leu Ser

580 585 590

Asn Gly Thr Gly Val Gly Asn Asp Thr Ala Ser Glu Arg Lys Met Val

595 600 605

Arg Lys Phe Ile Val Asp Ser Val Ala Tyr Trp Ala LysGlu Tyr His

610 615 620

Ile Asp Gly Phe Arg Phe Asp Leu Met Gly Ile His Asp Thr Lys Thr

625 630 635 640

Met Asn Glu Val Arg Lys Lys Leu Asp Glu Met Asp Pro Ser Ile Ile

645 650 655

Ile Leu Gly Glu Gly Trp Asp Leu Gly Thr Glu Leu Asp Ala Lys Leu

660 665 670

Lys Ala Asn Gln Lys Asn Ala Gln Asp Met Lys Arg Ile Ala His Phe

675 680 685

Asn Asp Gly Met Arg Asp Gly Leu Lys Gly Ser Val Phe Phe Asp His

690 695 700

Asp Asn Gly Phe Val Asn Gly Lys Gln Gly Gln Glu Lys Leu Ile Gln

705 710 715 720

Gln Ser Ile Ala Ala Gly Ile Asp Tyr Asp Arg Ser Thr Ala Thr Tyr

725 730 735

Glu Asp Pro Asp Gln Val Val Thr Tyr Val Glu Ala His Asp Asn His

740 745 750

Thr Leu Trp Asp Lys Leu Gln Leu Thr Asn Pro Ala Asp Thr Glu Arg

755 760 765

Thr Arg Met Gln Met His Lys Leu Ala Ser Ser Ile Thr Leu ThrSer

770 775 780

Gln Gly Met Asn Phe Ile His Ala Gly Gln Glu Phe Met Arg Thr Lys

785 790 795 800

Gly Gly Asp His Asn Ser Tyr Gln Ser Pro Asp Ser Val Asn Gln Leu

805 810 815

Asp Trp Lys Arg Arg Ala Ala Phe Ser Gln Glu Val Asp Tyr Met Lys

820 825 830

Gly Leu Ile Ala Leu Arg Lys Gln Tyr Ser Ser Phe Arg Met Thr Ser

835 840 845

Ala Gln Ala Ile His Gln Asn Leu Arg Phe Val Asp Ala Pro Ala Asn

850 855 860

Val Val Gly Tyr Thr Leu Asn Ala Lys Ala Asn Lys Asp Lys Ala Asn

865 870 875 880

Glu Ile Met Val Ile His Asn Ala Asn Lys Gln Ala Gln Thr Val His

885 890 895

Leu Pro Ser Asn Arg Thr Trp Arg Leu Leu Val Asp Gly Glu Arg Ala

900 905 910

Gly Thr Gln Thr Leu Arg Thr Val Lys Gly Asn Thr Val Asn Val Ser

915 920 925

Pro Leu Ser Thr Phe Val Leu Val Arg

930 935

<210>8

<211>2814

<212>DNA

<213> Artificial sequence

<400>8

gcagactcaa caaaaatcac gattcactat cagcctgctt caaacgacac aaaagaatgg 60

ggattatggg tttttcctga aggtggagaa gggaaggctt acgcatttac aggggaagat 120

cagtttggaa aagtagcgga agttgaacta cccggtactt atgataaagt aggctttatt 180

gtacgaacag agtcatggga aaaagatgga ggagaccgct tcgtctcagt ggagaacggt 240

gaaggagaag tatgggtaaa aagtggagat gaacatacat atacgtctcc tcctgacggt 300

gaataccggg atttaccgaa gtttgataaa gtaaacgtta ctttaaacta tcaccgatat 360

gacggagatt acagcgggtg gaacatttgg acgtggccag gtgacgaaaa agaaggcaag 420

cagatccaat ttacggaaga cacgaatttt gggaagagag ccacttacac gcttaacagt 480

ggaactggta acttatttga caaaataggt tttattgtac gccactctac tagtgatagc 540

gattgggaaa ataaagacgg aggagaccgc tttattacca aggttgggaa agatgggaat 600

gtagaagtat ggattgttca agggcaaaat cgaatttatt atgatagagc tgtagtagat 660

atcactcgga aaatcacgaa agcgactatg gatgcattta atcaaattac attagaaaca 720

aacgtaccgt ttgactcttc taagagtgta ggagacattg aaattgacgg agctcaaatt 780

gagaaagtga caccttataa agagggagga gcctctgtta ctactaaagt taaaatcata 840

acaaaacagc ctctggacgt tacaaaaacg tataaagtta agcaaaaagg atacggctca 900

gctaatgtag tcaatggaaa tgtcgttcgt accaaagaat ttgacgaaaa gtatgcgtac 960

agcgggaatg atttaggaaa cacgtattct aagaaacaaa caaattttcg cgtatgggct 1020

ccaaccgcaa gcgaagccaa gctagtgact tattcttcat ggaactccaa agctgtaaaa 1080

gaaatttcta tgactaaaag tgaaaaagga acgtggaaag cggagttaaa aggaaatcaa 1140

gatgagctaa tttacacgta caaagtaaaa attgggaaca gctggaatga agcggttgat 1200

ccatatgtac gagcaacaac ggtgaatgga gaccgtggag ttgtggtgga tttggctaag 1260

acaaatccaa gaaagtggag tacgaataag ccaaaattta aaaatccaga agatgccatc 1320

atctatgaac tacacgtaag agatttatcg tctcaaaaag aaagcggtat caaaaataaa 1380

ggaaagtatt tgggtgtagc ggagtggaat acgaagggac caaatggcgt aaaaacagga 1440

ctcagtcata ttaaagacct aggtgtaacg catgttcagt ttctgcctat ttatgattat 1500

cgtacggtgg atgaaacgaa attaaacgag ccgcagttta actggggata tgatccgaaa 1560

aattataacg taccagaagg ttcctattca acaaatccat ataatcctaa gactagaatt 1620

attgagctta aacaaatgat tcaaacgctt catgacaagc agcttcgtat ggtaatggac 1680

gttgtctata accatgtgta tgcagtgagt gagcatagct ttgataaact agttccaggc 1740

tactacttcc gctataaaga agatggaact ctatccaacg gaacaggtgt tggaaacgac 1800

acggcttctg aacggaaaat ggttcggaag tttattgtag attctgtggc ttattgggca 1860

aaagagtacc acattgacgg gtttcgattt gatttaatgg ggattcacga tacaaagaca 1920

atgaatgaag tgagaaagaa gttagatgaa atggatcctt ccattatcat cttaggagag 1980

ggatgggatc taggaaccga gcttgacgct aagctcaaag ctaaccagaa aaacgctcag 2040

gatatgaaac gcatcgctca ctttaatgac ggtatgcgag atggccttaa aggcagcgtg 2100

ttttttgatc atgacaacgg atttgttaat ggaaagcaag gacaagaaaa gctcatacag 2160

caaagtatag cagctggaat agattacgat cgttcaactg ccacgtatga agatccagat 2220

caagttgtca catatgtaga agcgcacgac aaccatacgt tatgggataa gcttcagctg 2280

acgaaccctg ctgacacgga gcgaacgaga atgcagatgc ataagcttgc ttcttccatt 2340

actttaacat ctcaaggaat gaactttata catgcaggtc aagagtttat gagaacaaaa 2400

ggcggagatc ataatagcta tcagtcaccc gattctgtca atcagttaga ttggaagcgc 2460

cgagcagctt tcagccaaga agtagattac atgaagggac ttattgcgct tcgaaagcaa 2520

tattcctcat ttagaatgac aagtgcacag gctattcatc aaaatttacg ctttgttgat 2580

gcaccagcaa acgtagtagg ttatacgtta aatgctaaag ccaataaaga taaagcaaac 2640

gaaataatgg tgattcataa tgcaaataaa caagctcaaa cagttcattt accttctaac 2700

agaacgtgga gattacttgt tgacggcgag cgggcaggaa cacaaacgct ccgtacggtg 2760

aaaggaaata cagtaaacgt ttcgcctctt tcgacatttg tgctagtaag ataa 2814

<210>9

<211>926

<212>PRT

<213> Artificial sequence

<400>9

Asp Gly Asn Thr Thr Asn Ile Val Val His Tyr Phe Arg Pro Ser Gly

1 5 10 15

Asp Tyr Thr Asp Trp Asn Leu Trp Met Trp Pro Glu Asn Gly Asp Gly

20 25 30

Ala Glu Tyr Asp Phe Asn Gln Pro Thr Asp Ser Tyr Gly Glu Val Ala

35 40 45

Ser Val Asp Ile Pro Gly Asn Pro Ser Gln Val Gly Ile Ile Val Arg

50 55 60

Lys Gly Asn Trp Asp Ala Lys Asp Ile Asp Ser Asp Arg Tyr Ile Asp

65 70 75 80

Leu Ser Lys Gly His Glu Ile Trp Leu Val Gln Gly Asn Ser Gln Ile

85 90 95

Phe Tyr Ser Glu Lys Asp Ala Glu Ala Ala Ala Gln Pro Ala Val Ser

100 105 110

Asn Ala Tyr Leu Asp Ala Ser Asn Gln Val Leu Val Lys Leu Ser Gln

115 120 125

Pro Phe Thr Leu Gly Glu Gly Ser Ser Gly Phe Thr Val His Asp Asp

130 135 140

Thr Ala Asn Lys Asp Ile Pro Val Thr Ser Val Ser Asp Ala Asn Gln

145 150 155 160

Val Thr Ala Val Leu Ala Gly Thr Phe Gln His Ile Phe Gly Gly Ser

165 170 175

Asp Trp Ala Pro Asp Asn His Asn Thr Leu Leu Lys Lys Val Asn Ser

180 185 190

Asn Leu Tyr Gln Phe Ser Gly Asn Leu Pro Glu Gly Asn Tyr Gln Tyr

195 200 205

Lys Val Ala Leu Asn Asp Ser Trp Asn Asn Pro Ser Tyr Pro Ser Asp

210 215 220

Asn Ile Asn Leu Thr Val Pro Ala Gly Gly Ala His Val Thr Phe Ser

225 230 235 240

Tyr Ile Pro Ser Thr His Ala Val Tyr Asp Thr Ile Asn Asn Pro Asn

245 250 255

Ala Asp Leu Gln Val Asp Ser Ser Gly Val Lys Thr Asp Leu Val Ala

260 265 270

Val Thr Leu Gly Glu Asn Pro Asp Val Ser His Thr Leu Ser Ile Gln

275 280 285

Thr Glu Asp Tyr Gln Ala Gly Gln Val Ile Pro Arg Lys Val Leu Asp

290 295 300

Ser Ser Gln Tyr Tyr Tyr Ser Gly Asp Asp Leu Gly Asn Thr Tyr Thr

305 310 315 320

Lys Asn Ala Thr Thr Phe Lys Val Trp Ala Pro Thr Ser Thr Gln Val

325 330 335

Asn Val Leu Leu Tyr Asn Ser Ala Thr Gly Ala Val Thr Lys Thr Val

340 345 350

Pro Met Thr Ala Ser Gly His Gly Val Trp Glu Ala Thr Val Asn Gln

355 360 365

Asp Leu Glu Asn Trp Tyr Tyr Met Tyr Glu Val Thr Gly Gln Gly Ser

370 375 380

Thr Arg Thr Ala Val Asp Pro Tyr Ala Thr Ala Ile Ala Pro Asn Gly

385 390 395 400

Thr Arg Gly Met Ile Val Asp Leu Ala Lys Thr Asp Pro Ala Gly Trp

405 410 415

Glu Ser Asp Lys His Ile Thr Pro Lys Asn Ile Glu Asp Glu Val Ile

420 425 430

Tyr Glu Met Asp Val Arg Asp Phe Ser Ile Asp Ser Asn Ser Gly Met

435 440 445

Lys Asn Lys Gly Lys Tyr Leu Ala Leu Thr Glu Lys Gly Thr Lys Gly

450 455 460

Pro Asp Asn Val Lys Thr Gly Val Asp Ser Leu Lys Gln Leu Gly Ile

465 470 475 480

Thr His Val Gln Leu Gln Pro Val Phe Ala Phe Asn Ser Val Asn Glu

485 490 495

Asn Asp Pro Thr Gln Tyr Asn Trp Gly Tyr Asp Pro Arg Asn Tyr Asn

500 505 510

Val Pro Glu Gly Gln Tyr Ala Thr Asn Ala Asn Gly Thr Thr Arg Ile

515 520 525

Lys Glu Phe Lys Glu Met Val Leu Ser Leu His Gln Asp His Ile Gly

530 535 540

Val Asn Met Asp Val Val Tyr Asn His Thr Phe Ala Thr Gln Ile Ser

545 550 555 560

Asp Phe Asp Lys Ile Val Pro Glu Tyr Tyr Tyr Arg Thr Asp Asp Ala

565 570 575

Gly Asn Tyr Thr Asn Gly Ser Gly Thr Gly Asn Glu Ile Ala Ala Glu

580 585 590

Arg Pro Met Val Gln Lys Phe Ile Ile Asp Ser Leu Lys Phe Trp Val

595 600 605

Asn Glu Tyr His Val Asp Gly Phe Arg Phe Asp Leu Met Ala Leu Leu

610 615 620

Gly Lys Asp Thr Met Ser Lys Ala Ala Thr Gln Leu His Ala Ile Asp

625 630 635 640

Pro Gly Ile Ala Leu Tyr Gly Glu Pro Trp Thr Gly Gly Thr Ser Ala

645 650 655

Leu Pro Ala Asp Gln Leu Leu Thr Lys Gly Ala Gln Lys Gly Met Gly

660 665 670

Val Ala Val Phe Asn Asp Asn Leu Arg Asn Gly Leu Asp Gly Ser Val

675 680 685

Phe Asp Ser Ser Ala Gln Gly Phe Ala Thr Gly Ala Thr Gly Leu Thr

690 695 700

Asp Ala Ile Lys Asn Gly Val Glu Gly Ser Ile Asn Asp Phe Thr Ala

705 710 715 720

Ser Pro Gly Glu Thr Ile Asn Tyr Val Thr Ser His Asp Asn Tyr Thr

725 730 735

Leu Trp Asp Lys Ile Ala Gln Ser Asn Pro Asn Asp Ser Glu Ala Asp

740 745 750

Arg Ile Lys Met Asp Glu Leu Ala Gln Ala Ile Val Met Thr Ser Gln

755 760 765

Gly Ile Pro Phe Met Gln Gly Gly Glu Glu Met Leu Arg Thr Lys Gly

770 775 780

Gly Asn Asp Asn Ser Tyr Asn Ala Gly Asp Val Val Asn Glu Phe Asp

785 790 795 800

Trp Ser Arg Lys Ala Gln Tyr Pro Asp Val Phe Asn Tyr Tyr Ser Gly

805 810 815

Leu Ile His Leu Arg Leu Asp His Pro Ala Phe Arg Met Thr Thr Ala

820 825 830

Asn Glu Ile Asn Ser His Leu Gln Phe Leu Asn Ser Pro Glu Asn Thr

835 840 845

Val Ala Tyr Glu Leu Ser Asp His Ala Asn Lys Asp Thr Trp Gly Asn

850 855 860

Ile Val Val Ile Tyr Asn Pro Asn Lys Thr Ala Glu Thr Ile Asn Leu

865 870 875 880

Pro Ser Gly Lys Trp Glu Ile Asn Ala Thr Ser Gly Lys Val Gly Glu

885 890 895

Ser Thr Leu Gly Gln Ala Glu Gly Ser Val Gln Val Pro Gly Ile Ser

900 905 910

Met Met Ile Leu His Gln Glu Val Ser Pro Ser Asp Gly Lys

915 920 925

<210>10

<211>2781

<212>DNA

<213> Artificial sequence

<400>10

gatgggaaca ccacaaacat cgtagtccat tattttcgtc ctagtgggga ttatacggat 60

tggaatcttt ggatgtggcc ggagaacggt gatggggctg agtatgattt taatcaaccg 120

actgattctt atggggaggt tgcaagtgtg gacattcctg gaaacccaag tcaagtaggg 180

attattgtcc gtaaaggaaa ttgggatgcg aaagacattg atagtgaccg ctacatcgat 240

ttaagcaaag ggcatgagat ttggctcgtc caaggaaaca gccagatttt ctatagtgaa 300

aaggatgctg aggcagccgc acaacctgct gtaagtaacg cttatttaga tgcttccaac 360

caagtgttgg tcaagcttag ccagccgttt actcttggtg aaggttcaag cggttttacg 420

gttcatgatg acacagcaaa taaggatatt ccagttacat ctgttagtga tgccaatcag 480

gtaacggctg ttttagcagg tactttccag catatttttg gggggagtga ttgggcaccg 540

gataatcaca atactttact aaaaaaggtg aatagcaatc tctatcaatt ttcaggaaat 600

cttcctgaag gaaactacca atataaagtg gctttaaatg atagctggaa taatccgagc 660

tacccatctg ataacattaa tttgacagtg ccagctggtg gtgcccatgt tacattttct 720

tatataccat ccacccatgc tgtttatgac acgattaaca atcctaatgc ggatttacaa 780

gtagatagca gcggtgttaa gacggatctc gtggcggtta ctcttggaga aaatcctgat 840

gtaagccata ccctgtccat tcaaacagag gactatcagg caggacaggt catacctcgt 900

aaggtgcttg attcatccca gtactactat tccggagatg atctcgggaa tacctataca 960

aagaatgcaa ctacctttaa ggtctgggcg cctacatcca ctcaagtaaa tgtccttctt 1020

tataatagtg caaccggcgc ggtaactaaa acggttccaa tgaccgcatc aggccatggt 1080

gtatgggaag caacagtcaa ccaagacctt gaaaattggt attacatgta tgaggtaaca 1140

ggacaaggct caacccgaac ggctgttgat ccgtatgcaa cagctattgc accaaacgga 1200

acgagaggca tgattgtgga cctagccaaa acagacccgg ccggatggga gagtgacaaa 1260

catattacgc caaagaatat agaagatgaa gtcatctatgaaatggatgt tcgtgacttt 1320

tccatcgact ctaattcggg tatgaaaaat aaaggaaagt atttggcact tacagaaaaa 1380

ggaactaaag gccctgacaa tgtaaagaca ggggtagatt ccttaaaaca acttgggatt 1440

actcatgttc agctgcagcc tgttttcgca tttaatagtg tcaatgaaaa cgatccaact 1500

caatataatt ggggttatga ccctcgcaac tacaatgttc ctgagggaca atatgctact 1560

aatgcaaacg gaacaactcg gattaaagag tttaaggaaa tggttctttc actccatcag 1620

gaccacattg gggttaatat ggatgttgtt tataatcata cctttgccac gcaaatctct 1680

gacttcgata agattgtgcc agaatattac taccgcacgg atgatgctgg taactacact 1740

aacggctcag gtactggaaa cgaaatcgca gccgaaagac caatggttca aaaatttatt 1800

atcgattcac ttaagttttg ggtcaatgag taccacgttg acggtttccg ttttgactta 1860

atggcgttgc ttggaaaaga tacaatgtct aaagctgcca cgcagcttca tgccattgat 1920

ccaggaattg ctctctacgg tgagccatgg acaggaggaa catccgcgct gccagccgat 1980

cagcttttaa caaaaggagc tcaaaaaggc atgggagtgg ctgtatttaa tgacaatctg 2040

cgaaacggtt tggacggcag tgtctttgat tcatctgctc aaggttttgc gacaggtgct 2100

actggtttaa cggatgctat taaaaatgga gttgaaggaa gtattaatga cttcaccgct 2160

tcaccaggcg agacgatcaa ctatgtcaca agtcatgata actataccct ttgggacaag 2220

attgcccaaa gcaatccaaa cgattctgaa gcggatcgaa ttaaaatgga tgagctcgct 2280

caagcgatcg tcatgacctc acaaggcatt cctttcatgc agggcgggga agaaatgctt 2340

cgtacgaaag gcggcaacga caatagctat aatgctggtg atgtagtgaa cgagtttgat 2400

tggagcagaa aagctcaata tccagatgtt ttcaattatt atagcgggct gattcatctt 2460

cgtcttgatc acccagcctt ccgcatgacg acagctaatg aaatcaatag ccacctccaa 2520

ttcctaaata gcccagagaa cacagtggcc tatgaattat ctgatcatgc aaataaagat 2580

acatggggta atattgtggt tatttataat ccaaataaaa cggcagaaac cattaatttg 2640

ccaagcggga aatgggaaat caatgcgacg agcggtaagg tgggagaatc cacacttggt 2700

caagcagagg gcagtgttca agttccaggc atatctatga tgattcttca tcaagaagta 2760

agcccatctg atggtaaata g 2781

Claims (10)

1. A pullulanase with high secretion capability is characterized in that the amino acid sequence of the pullulanase is shown as SEQ ID No. 1.

2. A gene encoding the pullulanase of claim 1.

3. A recombinant plasmid carrying the gene of claim 2.

4. The recombinant plasmid of claim 3, wherein the vector of the recombinant plasmid is a pET vector, a pUC vector, a pT7-7 vector or a pGEX vector.

5. A host cell carrying the gene of claim 2 or the recombinant plasmid of claim 3 or 4.

6. The host cell of claim 5, wherein the host cell is Escherichia coli, Bacillus, or yeast.

7. A method for producing pullulanase according to claim 1, wherein the host cell according to claim 5 or 6 is inoculated into a fermentation medium to carry out fermentation using the host cell according to claim 5 or 6.

8. Pullulanase produced by the method of claim 7.

9. Use of the pullulanase of claim 1 or the gene of claim 2 or the recombinant plasmid of claim 3 or 4 or the host cell of claim 5 or 6 or the preparation method of claim 7 or the pullulanase prepared according to claim 8 for hydrolyzing starch.

10. A method for hydrolyzing starch, which comprises using the pullulanase of claim 1 or the host cell of claim 5 or 6 or the pullulanase prepared by claim 8, and adding the pullulanase of claim 1 or the host cell of claim 5 or 6 or the pullulanase prepared by claim 8 and other amylase simultaneously into starch for enzymolysis, wherein the other amylase comprises one or more of saccharifying enzyme, α -amylase, β -amylase or amyloglucosidase.

Images