CN109293775A - Anti- PD-1 protein monoclonal antibody, cell line and its preparation method and application - Google Patents

Anti- PD-1 protein monoclonal antibody, cell line and its preparation method and application Download PDF

Info

Publication number
CN109293775A
CN109293775A CN201811365150.7A CN201811365150A CN109293775A CN 109293775 A CN109293775 A CN 109293775A CN 201811365150 A CN201811365150 A CN 201811365150A CN 109293775 A CN109293775 A CN 109293775A
Authority
CN
China
Prior art keywords
monoclonal antibody
protein
seq
amino acid
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811365150.7A
Other languages
Chinese (zh)
Other versions
CN109293775B (en
Inventor
李恢波
王小亚
李玲玲
黄信超
陈惠玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fuzhou Maixin Biotechnology Development Co ltd
Original Assignee
Fuzhou Maixin Biotechnology Development Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fuzhou Maixin Biotechnology Development Co ltd filed Critical Fuzhou Maixin Biotechnology Development Co ltd
Priority to CN201811365150.7A priority Critical patent/CN109293775B/en
Publication of CN109293775A publication Critical patent/CN109293775A/en
Application granted granted Critical
Publication of CN109293775B publication Critical patent/CN109293775B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
    • G01N2333/70521—CD28, CD152

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to a kind of anti-PD-1 protein monoclonal antibody, the heavy chain of the monoclonal antibody and the amino acid sequence of light chain variable region are amino acid sequence shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.Inventor additionally provides a kind of preparation method of anti-PD-1 protein monoclonal antibody, its antigen for being used to be immunized mouse is recombinant protein, for the recombinant protein via Recombinant protein expression, the recombinant protein includes the extracellular domain protein fragments and histidine protein label of Escherichia coli pectase signal peptide sequence, PD-1.Inventor provides the hybridoma cell line of one plant of anti-PD-1 albumen of secretion again, and the cell line is mouse hybridoma cell system 11F5C5, deposit number are as follows: CGMCC NO.16209.The anti-PD-1 protein monoclonal antibody is suitable for immune detection, and film accurate positioning, high specificity, sensibility are strong.

Description

Anti- PD-1 protein monoclonal antibody, cell line and its preparation method and application
Technical field
The present invention relates to field of biological detection, in particular to anti-PD-1 protein monoclonal antibody, cell line and its preparation side Method and application.
Background technique
PD-1 is a kind of inhibitive ability of immunity receptor, and molecular weight is 50~55kD, belongs to immunoglobulin CD28/CTLA-4 man The Ι type transmembrane glycoprotein of family member, is present in cell surface in the form of monomer.There are two tyrosine are residual for PD-1 intracellular region Base participates in constituting an immunity receptor Tyrosine Inhibitory Motifs of aminoterminal and an immunity receptor junket ammonia of c-terminus respectively The conversion motif that acid relies on；Extracellular region is then made of an IgV spline structure domain, containing multiple glycosylation sites and by severe sugar Base, the structural domain can be with ligand bindings, to play the function of inhibiting T cell activation, and in periphery row immune tolerance machine It plays an important role in system and autoimmune disease.
The soluble cytokine that tumor tissues can be secreted by negativity costimulatory molecules forms and is suitble to tumour growth Microenvironment, and monitoring of the body immune system to growth of tumour cell and proliferation is inhibited or interfered with, show as T lymphocyte function Obstacle and proliferative capacity weaken, and eventually lead to tumour growth, transfer and recurrence.In the correlative study to tumor escape mechanism It was found that the negativity costimulatory molecules such as PD-1 that lymphocyte is overexpressed in most of tumor patient bodies and its ligand are exactly that tumour is thin Born of the same parents escape immunosurveillance and the killing important channel of body.Under normal circumstances, the expression raising of PD-1, which is found in, successfully exempts from In epidemic disease response, to inhibit the excessive activation of immunocyte, to limit tissue damage and immune system is made to be restored to ground state. The signal that PD-1 is mediated can also prevent cytotoxic effect cell challenges normal tissue.And in tumor microenvironment PD-1 table It then may be related to T cell dysfunction up to increasing.The PD-1 that the long-term chronic stimulation of body tumour antigen causes T cell to be expressed Up-regulation so that the CD8+T cell to play a crucial role in antineoplastic immune becomes " failure T cell ", lead to its dysfunction and It is unable to normal proliferative and activation, to make tumor-infiltrated and transfer.So being examined by the monoclonal antibody for specifically binding PD-1 The expression quantity for surveying PD-1 is studied cancer pathology most important.
Summary of the invention
A kind of anti-PD-1 protein monoclonal antibody is inventor provided, the hybridoma for being CGMCC NO.16209 by deposit number Cell line generates.The cell strain is mouse hybridoma cell system 11F5C5, classification naming are as follows: mouse hybridoma cell system, it should Cell line is on 07 30th, 2018 in China Committee for Culture Collection of Microorganisms's common micro-organisms center's preservation, address For Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica.
Further, the monoclonal antibody specificity identifies PD-1 albumen.
Further, the heavy chain of the monoclonal antibody and chain variable region amino acid sequence are SEQ ID NO.2 respectively With coded by nucleotide sequence shown in SEQ ID NO.3.
Further, the heavy chain of the monoclonal antibody and the amino acid sequence of light chain variable region are SEQ ID respectively Amino acid sequence shown in NO.4 and SEQ ID NO.5.
Further, the monoclonal antibody is mouse IgG2aHypotype monoclonal antibody.
Inventor additionally provides a kind of preparation method of anti-PD-1 protein monoclonal antibody, and the antigen for mouse to be immunized is The recombinant protein of Recombinant protein expression, the recombinant protein include the born of the same parents of Escherichia coli pectase signal peptide sequence, PD-1 Extracellular portion protein fragments and histidine protein label.
Further, the extracellular domain protein fragments of the PD-1 are the 32nd of PD-1 albumen to the 160th bit amino Acid fragment, amino acid sequence are amino acid sequence shown in SEQ ID NO.1.
Inventor additionally provides the hybridoma cell line of one plant of anti-PD-1 albumen of secretion, and the cell strain is Mouse Hybridoma Cells Cell line 11F5C5, the cell line are preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation Number are as follows: CGMCC NO.16209.
Inventor also provides any of the above-described anti-PD-1 protein monoclonal antibody, in the detection of PD-1 protein immunization Purposes.
Further, the immune detection includes immunohistochemical method, Western blot and enzyme-linked immunization.
It is different from the prior art, above-mentioned technical proposal chooses PD-1 ectodomain protein fragments core corresponding with its Acid fragments are recombinantly expressed by Escherichia coli, and recombinant protein includes Escherichia coli pectase signal peptide sequence, PD-1 egg White 32nd purification tag formed to the 160th amino acids segment and multiple histidines.Recombinant protein conduct after purification Mouse is immunized in immunogene, and through cell fusion, screening and subclone, it is anti-to obtain the anti-PD-1 protein monoclonal of efficient secretion The mouse hybridoma cell system 11F5C5 of body, and the anti-PD-1 protein monoclonal antibody as secreted by the cell line.This programme Obtained antibody has high specific, sensibility, and the cell of PD-1 albumen can be expressed with specific recognition, is suitable for immunology and examines It surveys, especially immunohistochemistry detects.
Detailed description of the invention
The agarose gel electrophoresis figure of Fig. 1: PD-1 ectodomain gene cloning.
The polyacrylamide gel electrophoresis figure of Fig. 2: PD-1 ectodomain protein expression identification.
The polyacrylamide gel electrophoresis figure of Fig. 3: PD-1 monoclonal antibody after purification.
The western blot figure of Fig. 4: PD-1 monoclonal antibody detection people PD-1 albumen.
Fig. 5: the immunohistochemical staining comparison diagram of t cell lymphoma；Left side is anti-PD1 protein monoclonal antibody (11F5C5), right side are PD1 (NAT105).
Fig. 6: the immunohistochemical staining comparison diagram of tonsil；Left side is anti-PD1 protein monoclonal antibody (11F5C5), Right side is PD1 (NAT105).
Specific embodiment
The preparation of the recombination PD-1 protein fragments of embodiment 1
One, gene cloning
Extracellular domain conduct of present invention selection people PD-1 (h PD-1) the 32nd, albumen to the 160th amino acids segment Antigen (SEQ ID NO.1) corresponds to base sequence (SEQ ID NO.6) according to it and designs PD-1 egg using software Primer 5.0 White specific forward primer
5 ' TGAATTCCATATGCCCCCCACCTTCTCCCCAG3 ' (restriction enzyme site, Nde I) and downstream primer: 5 ' GTACTCGAG TTCTGCCCTTCTCTCTGTCACC3 ' (restriction enzyme site, Xho I), the post transcription cloning packet from T lymphocyte Include genetic fragment of the coding the 32nd to the 160th amino acids.
PCR product recycles after agarose gel electrophoresis separates, respectively to the target gene of recycling and for the matter of expression Grain carrier pET22b carries out Nde I and Xho I double digestion, and electrophoresis recycles again, with the connection of T4DNA ligase.Connection product turns Change competent escherichia coli cell BL21, clone's enlarged -incu bating on picking plate extracts Plasmid DNA, carries out PCR identification.It will PCR shows that the clone of the target gene positive carries out sequencing analysis, and the right-on clone of sequence is for carrying out next step experiment.
Fig. 1 is the agarose gel electrophoresis figure of PD-1 ectodomain gene cloning.
Two, protein expression and purifying
Correct recombinant plasmid pET22b-PD-1 will be sequenced to convert into host strain BL21 (DE3), picking positive monoclonal Bacterium colony is inoculated in the test tube LB culture medium of the 10mL benzyl resistance of ammonia containing 50mg/L, is inoculated with this culture solution after 37 DEG C of overnight incubations It spreads cultivation in the triangular flask LB culture medium that 1L contains 50mg/L ammonia benzyl resistance, 37 DEG C, 200rpm/min, which is cultivated to bacterium solution OD value, to be reached To 0.6-0.8, the IPTG of final concentration of 1.0mM is added, 30 DEG C are continued to cultivate 6h, ultrasonication that thalline were collected by centrifugation.It will be crushed Solution centrifuged deposit is dissolved in the PBS buffer solution in right amount containing 8M urea, and renaturation buffer (10mM Tris- is added dropwise HCl pH 8.0,400mM L-Arghydrochloride, 2mM EDTA, 0.5mM Cysteamine) in carry out renaturation, finally It recycles Ni-NTA column that PD-1 protein solution after renaturation is further purified, obtains high-purity, the antigen protein of conformation homogeneity Solution.Fig. 2 is the polyacrylamide gel electrophoresis figure of PD-1 ectodomain protein expression identification.
The foundation of 2 11F5C5 hybridoma cell line of embodiment
One, it is immunized
The PD-1 albumen obtained in embodiment 1 is diluted to 1mg/mL, then with isometric complete Freund's adjuvant (CFA, Sigma company) mixing and emulsifying, abdomen injection is carried out to the Balb/c mouse (being purchased from Foochow Wu Shi experimental animal) of 18-20g and is exempted from Epidemic disease, injection dosage are 100 μ g/.Hereafter every 14 days booster immunizations are primary, and antigen uses Freund non-fully adjuvant (IFA, Sigma Company) emulsification, dosage is 50 μ g/.Mice serum was detected with indirect ELISA (wavelength 450nm) in 14 days after 3rd booster immunization The how anti-potency of middle anti-immunity original, the highest mouse of potency is immune with tail vein injection impact, and antigen is mixed with physiological saline, agent Amount is 50 μ g/.
Two, cell fusion
Mouse boosting cell suspension up to standard is immunized in sterile preparation, with murine myeloma cell sp2/0 (ATCC) with 5:1 ratio Mixing, 1000rpm are centrifuged 10min, and after abandoning supernatant, the PEG (Sigma that 1mL is preheated to 37 DEG C is added from slow to fast in 1 minute Company) solution, it needs gently to rotate centrifuge tube in adition process, comes into full contact with cell with PEG.After being stored at room temperature 90s, in 2min Serum-free DMEM (Hyclone company) culture medium that 4mL is preheated to 37 DEG C is added from slow to fast, is added in subsequent 2min 10mL preheats plasma-free DMEM medium, adds remaining preheating plasma-free DMEM medium in last 2min, is settled to 50mL, Entire adition process needs to slowly shake centrifuge tube, it is ensured that is uniformly mixed, mitigates the injury to cell.After being stored at room temperature 10min It is centrifuged (1000rpm, 5min), abandons supernatant, cell is resuspended with 10~20mL HAT (Sigma company) culture medium, and cultivated with HAT Base is diluted to final concentration of 0.5 × 106Cells/mL, all solution are transferred in 96 orifice plates, 200 holes μ L/, and are marked. 96 well culture plates are carefully transferred to 37 DEG C, are cultivated in 5%CO2 incubator.Inspect periodically the growth conditions of cell and potential Pollution, pays attention to opening and closing incubator less as far as possible, it is ensured that culture environment is stablized.The 5th day after fusion, HAT culture is added into culture plate Base, 50 holes μ L/.
Three, ELISA screens positive hybridoma cell
When fused cell diameter it is long to about 1~2mm when, draw 50~200 μ L culture solution supernatants and carry out cell for the first time Screening (ELISA, IHC-P and other methods detection), while HAT culture medium is added to 200 μ L into culture hole.ELISA detection The culture solution supernatant, the culture hole inner cell culture solution that will test to obtain positive findings are fully transferred to 24 well culture plates, add HT culture medium, the hole 2mL/ are cultivated 3 days.
Repeat screening 24 orifice plates in each cell strain, reject be not positive findings culture hole cell, obtain positive findings compared with Good culture hole cell.The positive hole cell that these 24 well culture plates obtain is subjected to subclone screening using limiting dilution assay, Limiting dilution assay is obtained to be transferred to CO in cell liquid 96 well culture plates of addition2It is incubator culture 11 days, straight to clone cell When diameter is 1~2mm, repeat cell screening.According to testing result, each subcloned cells strain, selection 4 are well-grown Monoclonal positive culture hole, and be transferred in 24 orifice plates and continue to cultivate.Clone in 24 orifice plates is screened after a period of time again to obtain Positive colony cell strain, as secrete the hybridoma cell strain of specific monoclonal antibody.This cell strain is transferred to T-75 culture It is expanded to logarithmic growth phase conservation in bottle or carries out subsequent experimental.
3 ascites of embodiment induces method preparation monoclonal antibody
One, prepared by ascites
It will be washed and be resuspended with serum free medium after cell strain culture to logarithmic growth phase, count 2 × 106A/mL.It is outstanding Paraffin oil sensitization 10 days F1 mouse are used in floating cell solution intraperitoneal injection in advance, and every mouse injects 0.5mL.Raise mouse 6- Start to acquire ascites after 7 days.The ascites of collection is centrifuged 10min in 4 DEG C, 8000rpm, draws supernatant solution and is collected in centrifuge tube In, as ascites, 4 DEG C or -20 DEG C preservations.Two, the purifying of monoclonal antibody
With rProtein A sepharose Fast Flow (GE company) affinity column antibody purification master from ascites It is divided into: 1. fills column, the ProteinA filler of purchase is loaded in gravitational stratification column in right amount with equilibration buffer (0.1M Tris Solution, pH7.0) it rinses to balance；2. loading will be added in the chromatographic column installed, control by the ascites of 0.22 μm of membrane filtration 1 drop/sec of flow velocity processed；3. balancing, Equilibration buffer wash to balance is used after upper complete sample liquid；4. eluting, elution buffer is added (0.1M citric acid solution, pH3.0) rinses pillar and collects eluent；5. regenerating, equilibration buffer punching is added after the completion of elution Pillar is washed to balancing, the 20% ethyl alcohol flushing of 2 times of column volumes is placed on 4 DEG C of preservations.Antibody is finally identified using SDS-PAGE method Purity (such as attached drawing 3), for purity up to 95% or more, ultraviolet micro-spectrophotometer method measures antibody concentration, and concentration reaches 3.0mg/ ML or more.
4 monoclonal antibody CHARACTERISTICS IDENTIFICATION of embodiment
One, subtype identification
Immunogen solution is diluted to 1 μ g/mL coated elisa plate, every hole adds 100 μ L, and 4 DEG C of coatings overnight, are emptied liquid, With PBS (PBS-T) board-washing 3 times containing 0.05% Tween, 200 μ L confining liquids (the PBS-T solution containing 2%BSA) is added in every hole, 37 DEG C of incubation 1h.It is emptied liquid, is cleaned 3 times with PBS-T.Every hole is added on the 0.1mL hybridoma cell strain culture solution for diluting 5 times Clearly, 37 DEG C of incubation 1h.It is emptied liquid, is cleaned 3 times with PBS-T.With confining liquid 1:400 dilution HRP label sheep anti mouse (κ, λ, IgM, IgG1, IgG2a, IgG2b, IgG3, IgA) and antibody (Southern Biotech company), every hole is separately added into 0.1mL, and 37 DEG C It is incubated for 1h.It is emptied liquid, is cleaned 3 times with PBS-T.Every hole adds 100 μ L TMB (Huzhou Yingcheng Biological Technology Co., Ltd.) substrates (the isometric mixed solution of A, B) develops the color, and reacts at room temperature 15min, it is anti-that 50 μ L 1N HCl solution color development stoppings are added in every hole It answers, then the OD value under microplate reader measurement 450nm wavelength.The results show that monoclonal antibody of the present invention is IgG2aType source of mouse Dan Ke Grand antibody.
Two, affinity costant measures
Coating recombination PD-1 albumen, peridium concentration are 100 μ g/ml, and 100 holes μ l/, overnight, PBS-T is washed 3 times 4 DEG C of coatings. Every hole adds 37 DEG C of 200 μ l confining liquid closing 1h, PBS-T to wash 3 times.The monoclonal antibody that embodiment 3 purifies, is diluted to following concentration (unit: ng/mL): 2000,500,125,62.5,31.25,15.625,3.125,0.625,37 DEG C of incubations 1h, PBS-T wash 3 It is secondary.The sheep anti mouse secondary antibody 1:5000 dilution of HRP label, 100 μ l of every hole, 37 DEG C of incubation 1h, PBS-T are washed 3 times.100 μ are added in every hole L TMB (Huzhou Yingcheng Biological Technology Co., Ltd.) developing solution, develop the color 13min, and 100 μ l 1.0N salting liquids is added to terminate reaction.With The light absorption value of microplate reader measurement wavelength 450nm.The curve that OD value corresponds to antibody extension rate is drawn, 1/2 " platform OD value " is found out Corresponding antibody concentration A.Calculating affinity costant using following equation is 7.13 × 109L×mol-1。
Three, monoclonal antibody atopic and application effect
Immunogen solution is selected, the identification specificity of monoclonal antibody of the invention is detected with the method for immunoblotting, it is right PD-1 albumen carries out 15% polyacrylamide gel electrophoresis.Gel protein is transferred to pvdf membrane with conventional wet robin.By film It is placed in 5% BSA-TBST solution (albumen is face-down), 1h is closed in 37 DEG C of shaking tables, to eliminate non-specific background.Closing knot Shu Houyong TBST washes off 5%BSA-TBST, and the monoclonal antibody of PD-1 prepared by the present invention is added, and sways incubation in decolorization swinging table 1h.After washing film with TBST, secondary antibody is added, is incubated for 1h in decolorization swinging table, combines secondary antibody sufficiently with primary antibody.It is washed again with TBST ECL colour reagent box is added in film.Experimental result is as shown in the western blot figure of Fig. 4 PD-1 monoclonal antibody detection people PD-1 albumen: band Single and color is deeper, illustrates that the specific reaction of antibody and antigen is obvious.
The dyeing of 5 organization chip of embodiment and identification
One, paraffin embedded tissues preparation process
HE slice dyeing is carried out to t cell lymphoma and tonsillotome, to determine lesion.Disease site is drawn Circle, preparation punching.When making acceptor wax block, plastics are placed on mold, the paraffin (fusing point is at 56~58 DEG C) of thawing is fallen Enter mold, appropriate wax liquor is added after tissue block is put into the wax liquor in mold is fully embedded in tissue block in wax liquor, cold But to mold is put into -20 DEG C of refrigerator 6min after room temperature, wax stone is removed from the molds, is sliced or is put into 4 DEG C of refrigerators and save It is spare.Serial section is carried out after photo fix, thickness is set to 4 μm, and serial section is floated in 40% alcohol, it is allowed to be unfolded naturally, then will Separated slice is transferred in 45 DEG C of warm water and opens up piece 30 seconds, is sliced with through the processed glass slide mount of 2%APES acetone solution, Manufactured organization chip is put into 60 DEG C of ovens and is baked piece 2 hours, room temperature cooling is taken out, -4 DEG C of refrigerators is put into and saves.
Two .IHC dyeing and analysis
Conventional xylene dewaxes 3 times, and 6 minutes every time, aquation in 100%, 100%, 95%, 95%, 85% graded ethanol, 3 minutes every time, last tap water rinsed.Antigen retrieval is carried out, then slice is put into wet box, PBS is rinsed 3 × 3 minutes.Drop Add 3%H2O2It is incubated for 10 minutes, PBS is rinsed 3 × 3 minutes.PBS is got rid of, peroxidase blocking reagent is added dropwise and is incubated at room temperature 10 points Clock.Drying slice, is added dropwise the diluted primary antibody of proper proportion (diluting the dilution ratio according to antibody concentration come designerantibodies for the first time) (25 DEG C) of room temperature are incubated for 1 hour, and PBS is rinsed 3 × 3 minutes, and secondary antibody is added dropwise and is incubated at room temperature 30 minutes, and PBS is rinsed 3 × 3 minutes, is got rid of PBS is removed, is developed the color 3-10 minutes with the DAB developing solution of fresh configuration.Haematoxylin is redyed 20 seconds, and PBS returns indigo plant.According to 85% (3 points Clock), 95% (3 minutes), 95% (3 minutes), 100% (3 minutes), 100% (3 minutes) alcohol gradient be successively dehydrated, finally Transparent 10 minutes of dimethylbenzene twice, neutral gum mounting.Microscopically observation is as a result, record and analyze.
Immunohistochemical staining result is divided into: positive and negative.Positive expression must be in cell and the specific antigen portion of tissue Position can just be considered as the positive.In tissue staining distribution clearly and in the accurate situation of cellular localization, coloration result is according to staining power Difference carry out further division, it is specific as follows:
1, sample is weakly positive；Labeled as "+"；
2, sample is moderate positive；Labeled as " ++ "；
3, sample is High positive；Labeled as " +++ ".
4, sample is feminine gender, is labeled as "-".
Three, pattern detection result:
T cell with anti-PD1 protein monoclonal antibody (11F5C5) and the commercially available PD1 of control antibodies-(NAT105) at 85 Detection is synchronized in lymthoma and 63 B cell lymphomas, as a result as shown in the table:
Testing result is shown: anti-PD1 protein monoclonal antibody (11F5C5) is in the dyeing accurate positioning of cell membrane, and dyeing is clearly Clear and without unspecific staining, clean background illustrates anti-PD1 protein monoclonal antibody (11F5C5) high specificity.Meanwhile with city The positive for selling antibody PD1 (NAT105) is consistent with negative findings, illustrates the specificity of this antibody with commercial antibody PD1 (NAT105) Quite.
And in some cases, it is higher than use pair using the positive staining intensity of anti-PD1 protein monoclonal antibody (11F5C5) According to reagent, illustrate that the sensibility of anti-PD1 protein monoclonal antibody (11F5C5) is higher than commercial antibody.
And with anti-PD1 protein monoclonal antibody (11F5C5) and the commercially available anti-PD1 protein monoclonal antibody (mouse of control antibodies- Monoclonal antibody NAT105), detection is synchronized on normal tissue chip, the sample positive is consistent with negative findings, illustrates that this antibody exists The specificity of normal tissue is suitable with commercial antibody.
Sequence table
<110>Fuzhou Maixin biotechnology Development Co., Ltd
<120>anti-PD-1 protein monoclonal antibody, cell line and its preparation method and application
<130> 2018
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 129
<212> PRT
<213>homo sapiens (Homo sp)
<400> 1
Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly
1 5 10 15
Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe
20 25 30
Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu
35 40 45
Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe
50 55 60
Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val
65 70 75 80
Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser
85 90 95
Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg
100 105 110
Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser
115 120 125
Pro
<210> 2
<211> 417
<212> DNA
<213>artificial sequence (Artificial)
<400> 2
atgctgttgg ggctgaagtg ggttttcttt gttgtttttc atcaaggtgt gcattgtgag 60
gtgcagcttg ttgagtctgg tggaggattg gtgcagccta aagggtcaat gaaactctca 120
tgtgcagcct ctggattcac cttcaatacc tacgccatga actgggtccg ccaggctcca 180
ggaaagggtt tggaatgggt tgctcgcata agaactagaa gtaataatta tgtaacatat 240
tatgccgatt cagtgaaagg caggttcacc atctccagag atgattcaca aaacattctc 300
tatctgcaaa tgaacaactt gaaaactgag gactcagcca tgtattactg tgtgcgaccg 360
acagctcggg ggccgtttgc ttactggggc caagggactc tggtcactgt ctctgca 417
<210> 3
<211> 393
<212> DNA
<213>artificial sequence (Artificial)
<400> 3
atggagacag acacactcct gctatgggtg ctgctgctct gggttccagg ttccacaggt 60
aacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 120
atatcctgca gagccactga aagtgttgat agttatgaca atagttttat gtgctggtac 180
cagcagaaac caggacagcc acccaaactc ctcatctatc ttgcatccaa cctagaatct 240
ggggtccctg ccaggttcag tggcagtggg tctgggacag acttcaccct caccattgat 300
cctgtggagg ctgatgatgc tgcaacctat tactgtcagc aaaattatga ggatcccctc 360
acgttcggtg ctgggaccaa gctggagctg aaa 393
<210> 4
<211> 139
<212> PRT
<213>artificial sequence (Artificial)
<400> 4
Met Leu Leu Gly Leu Lys Trp Val Phe Phe Val Val Phe His Gln Gly
1 5 10 15
Val His Cys Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln
20 25 30
Pro Lys Gly Ser Met Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
35 40 45
Asn Thr Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
50 55 60
Glu Trp Val Ala Arg Ile Arg Thr Arg Ser Asn Asn Tyr Val Thr Tyr
65 70 75 80
Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser
85 90 95
Gln Asn Ile Leu Tyr Leu Gln Met Asn Asn Leu Lys Thr Glu Asp Ser
100 105 110
Ala Met Tyr Tyr Cys Val Arg Pro Thr Ala Arg Gly Pro Phe Ala Tyr
115 120 125
Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala
130 135
<210> 5
<211> 131
<212> PRT
<213>artificial sequence (Artificial)
<400> 5
Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro
1 5 10 15
Gly Ser Thr Gly Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala
20 25 30
Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Thr Glu Ser
35 40 45
Val Asp Ser Tyr Asp Asn Ser Phe Met Cys Trp Tyr Gln Gln Lys Pro
50 55 60
Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser
65 70 75 80
Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
85 90 95
Leu Thr Ile Asp Pro Val Glu Ala Asp Asp Ala Ala Thr Tyr Tyr Cys
100 105 110
Gln Gln Asn Tyr Glu Asp Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu
115 120 125
Glu Leu Lys
130
<210> 6
<211> 387
<212> DNA
<213>homo sapiens (Homo sp)
<400> 6
tggaaccccc ccaccttctc cccagccctg ctcgtggtga ccgaagggga caacgccacc 60
ttcacctgca gcttctccaa cacatcggag agcttcgtgc taaactggta ccgcatgagc 120
cccagcaacc agacggacaa gctggccgcc ttccccgagg accgcagcca gcccggccag 180
gactgccgct tccgtgtcac acaactgccc aacgggcgtg acttccacat gagcgtggtc 240
agggcccggc gcaatgacag cggcacctac ctctgtgggg ccatctccct ggcccccaag 300
gcgcagatca aagagagcct gcgggcagag ctcagggtga cagagagaag ggcagaagtg 360
cccacagccc accccagccc ctcaccc 387
<210> 7
<211> 32
<212> DNA
<213>artificial sequence (Artificial)
<400> 7
tgaattccat atgcccccca ccttctcccc ag 32
<210> 8
<211> 31
<212> DNA
<213>artificial sequence (Artificial)
<400> 8
gtactcgagt tctgcccttc tctctgtcac c 31

Claims (10)

1. a kind of anti-PD-1 protein monoclonal antibody, which is characterized in that the heavy chain of the monoclonal antibody and light chain variable region Amino acid sequence is amino acid sequence shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.
2. monoclonal antibody according to claim 1, which is characterized in that the heavy chain and light chain variable of the monoclonal antibody Region amino acid sequence is coded by nucleotide sequence shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.
3. monoclonal antibody according to claim 1, which is characterized in that the monoclonal antibody is CGMCC by deposit number The mouse hybridoma cell system of NO.16209 secretes.
4. monoclonal antibody according to claim 1, which is characterized in that the monoclonal antibody specificity identifies PD-1 egg It is white.
5. monoclonal antibody according to claim 1, which is characterized in that the monoclonal antibody is mouse IgG2aHypotype list Clonal antibody.
6. a kind of preparation method of anti-PD-1 protein monoclonal antibody, which is characterized in that for the antigen of mouse to be immunized as recombination Albumen, the recombinant protein is by Recombinant protein expression, the extracellular knot comprising Escherichia coli pectase signal peptide sequence, PD-1 Structure domain protein fragments and histidine protein label.
7. preparation method according to claim 6, which is characterized in that the extracellular domain protein fragments of the PD-1 are For the 32nd of PD-1 albumen to the 160th amino acids segment, amino acid sequence is amino acid sequence shown in SEQ ID NO.1 Column.
8. the hybridoma cell line of one plant of anti-PD-1 albumen of secretion, the cell line is mouse hybridoma cell system 11F5C5, institute It states cell line and is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number are as follows: CGMCC NO.16209。
9. any anti-PD-1 protein monoclonal antibody of claim 1-5, the purposes in immune detection.
10. immune detection according to claim 9, which is characterized in that the immune detection includes immunohistochemical method, Western blot and enzyme-linked immunization.
CN201811365150.7A 2018-11-16 2018-11-16 anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof Active CN109293775B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811365150.7A CN109293775B (en) 2018-11-16 2018-11-16 anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811365150.7A CN109293775B (en) 2018-11-16 2018-11-16 anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN109293775A true CN109293775A (en) 2019-02-01
CN109293775B CN109293775B (en) 2021-06-04

Family

ID=65143171

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811365150.7A Active CN109293775B (en) 2018-11-16 2018-11-16 anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN109293775B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111995683A (en) * 2020-09-02 2020-11-27 福州迈新生物技术开发有限公司 anti-PD-L1 protein monoclonal antibody, cell strain, preparation method and application thereof
CN113845593A (en) * 2021-10-27 2021-12-28 福州迈新生物技术开发有限公司 anti-alpha-SMA protein monoclonal antibody, cell line and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106632676A (en) * 2017-01-20 2017-05-10 新乡学院 Mouse anti-swine PD-L1 (Programmed Death 1 Ligand 1) monoclonal antibody and application thereof
CN106749666A (en) * 2016-12-22 2017-05-31 福州大学 A kind of monoclonal antibodies of people's source program death receptor hPD 1
WO2017200796A1 (en) * 2016-05-17 2017-11-23 Albert Einstein College Of Medicine, Inc. Engineered pd-1 variants
CN108752460A (en) * 2018-06-07 2018-11-06 江苏东抗生物医药科技有限公司 The fusion protein and its pharmaceutical composition and purposes of a kind of PD-1 film outskirt mutant of high-affinity

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017200796A1 (en) * 2016-05-17 2017-11-23 Albert Einstein College Of Medicine, Inc. Engineered pd-1 variants
CN106749666A (en) * 2016-12-22 2017-05-31 福州大学 A kind of monoclonal antibodies of people's source program death receptor hPD 1
CN106632676A (en) * 2017-01-20 2017-05-10 新乡学院 Mouse anti-swine PD-L1 (Programmed Death 1 Ligand 1) monoclonal antibody and application thereof
CN108752460A (en) * 2018-06-07 2018-11-06 江苏东抗生物医药科技有限公司 The fusion protein and its pharmaceutical composition and purposes of a kind of PD-1 film outskirt mutant of high-affinity

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111995683A (en) * 2020-09-02 2020-11-27 福州迈新生物技术开发有限公司 anti-PD-L1 protein monoclonal antibody, cell strain, preparation method and application thereof
CN111995683B (en) * 2020-09-02 2022-03-11 福州迈新生物技术开发有限公司 anti-PD-L1 protein monoclonal antibody, cell strain, preparation method and application thereof
CN113845593A (en) * 2021-10-27 2021-12-28 福州迈新生物技术开发有限公司 anti-alpha-SMA protein monoclonal antibody, cell line and application thereof
CN113845593B (en) * 2021-10-27 2023-03-10 福州迈新生物技术开发有限公司 anti-alpha-SMA protein monoclonal antibody, cell line and application thereof

Also Published As

Publication number Publication date
CN109293775B (en) 2021-06-04

Similar Documents

Publication Publication Date Title
CN112480260B (en) anti-PSMA protein monoclonal antibody, cell line, preparation method and application thereof
CN109206514B (en) TSLP monoclonal antibody and its preparation method and application
CN110903389B (en) Monoclonal antibody and cell line for resisting GFAP protein, and preparation method and application thereof
CN109734805A (en) Anti- CK20 protein monoclonal antibody, cell line and its preparation method and application
CN112442124B (en) anti-CD 23 protein monoclonal antibody, cell line, preparation method and application thereof
CN113234155B (en) anti-Calponin protein monoclonal antibody, cell strain thereof, preparation method and application
CN110218251A (en) Anti- MSH2 protein monoclonal antibody, cell line and its preparation method and application
CN112940133B (en) Monoclonal antibody of anti-ATRX protein, cell strain, preparation method and application thereof
CN113061186B (en) Monoclonal antibody of anti CA125 protein, cell strain, preparation method and application thereof
CN110194799A (en) In conjunction with the anti-dog PD-1 antibody of dog PD-1
CN113045667A (en) anti-IDO 1 protein monoclonal antibody and cell strain, preparation method and application thereof
CN114605543B (en) Monoclonal antibody of HLA-G isomer molecule HLA-G5 and HLA-G6 and application thereof
CN109293775A (en) Anti- PD-1 protein monoclonal antibody, cell line and its preparation method and application
CN109485724A (en) Anti- Desmin protein monoclonal antibody, cell line and its preparation method and application
CN112940125B (en) anti-VISTA protein monoclonal antibody, cell strain thereof, preparation method and application
CN113956356A (en) anti-PRL protein monoclonal antibody, cell line and application thereof
CN113234158B (en) anti-TIM 3 protein monoclonal antibody, cell strain thereof, preparation method and application
CN105646712B (en) Monoclonal antibody and its application
CN114075281B (en) anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof
CN113831410A (en) anti-CD 56 protein monoclonal antibody and cell strain, preparation method and application thereof
CN105646713B (en) A kind of monoclonal antibody and its application
CN110922485B (en) anti-Ep-cam protein monoclonal antibody, cell line, preparation method and application thereof
CN113929783B (en) anti-CD 99 protein monoclonal antibody, cell line, preparation method and application thereof
CN113912727B (en) anti-CD 38 protein monoclonal antibody, cell line, preparation method and application thereof
CN114014933B (en) anti-PLAP protein monoclonal antibody, cell line, preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant