CN113912727B - anti-CD 38 protein monoclonal antibody, cell line, preparation method and application thereof - Google Patents

Abstract

The invention relates to the field of biological detection, and provides an anti-CD 38 protein monoclonal antibody, the amino acid sequences of heavy chain and light chain variable regions of which are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3. In the preparation method, the antigen used for immunizing the mice is the nucleotide sequence code shown in SEQ ID NO.1, and the recombinant protein is recombinantly expressed by escherichia coli. The inventor also provides a hybridoma cell line secreting anti-CD 38 protein, wherein the cell line is a mouse hybridoma cell line 13B5B11C8, and the preservation number is as follows: CGMCC No.22319. The anti-CD 38 protein monoclonal antibody has high specificity and sensitivity, can specifically identify cells expressing CD38 protein, and is suitable for immunological detection, especially immunohistochemical detection.

Description

anti-CD 38 protein monoclonal antibody, cell line, preparation method and application thereof

Technical Field

The invention relates to the field of biological detection, in particular to an anti-CD 38 protein monoclonal antibody, a cell line, a preparation method and application thereof.

Background

CD38 is a single-chain transmembrane type II glycoprotein with a molecular weight of 45kD and comprises 1 long carboxy-terminal extracellular region (258 amino acids), 1 transmembrane region (21 amino acids) and 1 short amino-terminal intracellular region (21 amino acids). The human CD38 gene is located on chromosome 4 (4 p 15), extending over 62kb. The gene comprises 7 introns and 8 exons encoding the CD38 protein.

CD38 is a multifunctional protein with receptor and enzyme mediated functions, and can be used as a receptor, an adhesion molecule and an exonuclease. CD38 has a variety of physiological functions and can act as a receptor, adhesion molecule and exonuclease. CD38 is expressed predominantly in cells of the gonorrhoeae and myeloid lines, and also at low levels in some non-hematopoietic cells (e.g., prostate epithelial cells, pancreatic B cells, osteoclasts, retinal cells, etc.). In normal humans, approximately 20% of human bone marrow cells express CD38, predominantly in plasma cells, myeloid cells, erythroid cells, precursor cells, and a small fraction of T cells. In peripheral blood, 90% of plasma cells are CD38 positive, and about 60% of natural killer cells and monocytes express CD38. Most myeloid thymocytes express CD38, while circulating T cells do not, and expression is induced in activated T cells. Neither stem cells nor progenitor cells express CD38, but are also expressed on B cells, and plasma cell CD38 expression levels are particularly high, which make CD38 an important target for the treatment of plasma cell diseases.

Disclosure of Invention

The inventors provide an anti-CD 38 protein monoclonal antibody, the amino acid sequences of the heavy chain and the light chain variable regions of the monoclonal antibody are the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.

Further, the heavy chain and light chain variable region amino acid sequences of the monoclonal antibody are respectively encoded by the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO. 5.

Furthermore, in the preparation process of the monoclonal antibody, the antigen used for immunizing the mice is a recombinant protein which is encoded by a nucleotide sequence shown as SEQ ID NO.1 and is recombinantly expressed by escherichia coli.

Further, the monoclonal antibody specifically recognizes human CD38 protein.

Further, the monoclonal antibody is produced by a hybridoma cell line with a preservation number of CGMCC No.22319. The cell line is a mouse hybridoma cell line 13B5B11C8, and is classified and named as follows: a mouse hybridoma cell line which has been deposited in the China general microbiological culture Collection center, including the institute of microbiological culture Collection center, national institute of sciences of China, including North Chen West Lu No.1, national institute of sciences of China, including the area of Korea, beijing, at 2021, month 04, and address.

Further, the anti-CD 38 protein is a mouse IgG1 subtype monoclonal antibody.

The inventors also provided a hybridoma cell line secreting anti-CD 38 protein, which is a mouse hybridoma cell line 13B5B11C8, classified as: a mouse hybridoma cell line which has been deposited in the China general microbiological culture Collection center, including the institute of microbiological culture Collection center, national institute of sciences of China, including North Chen West Lu No.1, national institute of sciences of China, including the area of Korea, beijing, at 2021, month 04, and address.

The inventors also provide the use of an anti-CD 38 protein monoclonal antibody as described in any of the above in human CD38 protein immunodetection.

Further, the immunodetection includes immunohistochemistry, immunoblotting and enzyme-linked immunosorbent assay.

The inventor provides a human CD38 protein immune detection reagent, wherein the immune detection reagent contains any anti-CD 38 protein monoclonal antibody as an active ingredient.

Compared with the prior art, the technical scheme is characterized in that according to the structure, antigenicity, hydrophilicity and hydrophobicity of constituent amino acids and a secondary structure of CD38 protein, the 99 th to 296 th amino acid fragments of the CD38 protein and the corresponding nucleotide fragments are selected, recombinant expression is carried out through escherichia coli, mice are immunized, a monoclonal cell line 13B5B11C8 which efficiently secretes an anti-CD 38 protein monoclonal antibody is obtained through cell fusion, screening and cloning, in-vitro culture is carried out on the monoclonal cell line 13B5B11C8, and the anti-CD 38 protein monoclonal antibody secreted by the cell line is obtained. The antibody obtained by the scheme has high specificity and sensitivity, can specifically identify cells expressing CD38 protein, and is suitable for immunological detection, in particular for immunohistochemical detection.

The foregoing summary is merely an overview of the present application, and is provided to enable one of ordinary skill in the art to make more clear the present application and to be practiced according to the teachings of the present application and to make more readily understood the above-described and other objects, features and advantages of the present application, as well as by reference to the following detailed description and accompanying drawings.

Drawings

FIG. 1 is a graph showing the result of electrophoresis of the purified CD38 monoclonal antibody of example 3; m: molecular weight markers.

FIG. 2 is a graph showing the results of immunohistochemical staining of B cell lymphoma; wherein the left is CD38 secreted by 13B5B11C8, and the right is commercially available CD38 (38C 03).

Detailed Description

In order to describe the possible application scenarios, technical principles, practical embodiments, and the like of the present application in detail, the following description is made with reference to the specific embodiments and the accompanying drawings. The embodiments described herein are only used to more clearly illustrate the technical solutions of the present application, and are therefore only used as examples and are not intended to limit the scope of protection of the present application.

Reference herein to "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment may be included in at least one embodiment of the present application. The appearances of the phrase "in various places in the specification are not necessarily all referring to the same embodiment, nor are they particularly limited to independence or relevance from other embodiments. In principle, in the present application, as long as there is no technical contradiction or conflict, the technical features mentioned in the embodiments may be combined in any manner to form a corresponding implementable technical solution.

Unless defined otherwise, technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains; the use of related terms herein is for the description of specific embodiments only and is not intended to limit the present application.

In the description of the present application, the term "and/or" is a representation for describing a logical relationship between objects, which means that there may be three relationships, e.g., a and/or B, representing: there are three cases, a, B, and both a and B. In addition, the character "/" herein generally indicates that the front-to-back associated object is an "or" logical relationship.

In this application, terms such as "first" and "second" are used merely to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual number, order, or sequence of such entities or operations.

Without further limitation, the use of the terms "comprising," "including," "having," or other like terms in this application is intended to cover a non-exclusive inclusion, such that a process, method, or article of manufacture that comprises a list of elements does not include additional elements but may include other elements not expressly listed or inherent to such process, method, or article of manufacture.

As in the understanding of the "examination guideline," the expressions "greater than", "less than", "exceeding", and the like are understood to exclude the present number in this application; the expressions "above", "below", "within" and the like are understood to include this number. Furthermore, in the description of the embodiments of the present application, the meaning of "a plurality of" is two or more (including two), and similarly, the expression "a plurality of" is also to be understood as such, for example, "a plurality of groups", "a plurality of" and the like, unless specifically defined otherwise.

EXAMPLE 1 preparation of recombinant CD38 protein fragments

1. Antigen fragment selection

The CD38 protein sequence numbered P62736 was selected from the Uniprot database (http:// www.uniprot.org) as the standard sequence. The invention selects 99 th to 296 th amino acid fragments of human CD38 protein as antigens, and designs a specific upstream Primer 5 'TTCGGGATCTGCAACAAC' (SEQ ID NO.6 cleavage site, bamH I) and a downstream Primer of the CD38 protein by utilizing software Primer 5.0 according to the corresponding base sequence (SEQ ID NO. 1): 5'ATCTCGAGGCAGGAAGAGTCTTC 3' (SEQ ID NO.7, cleavage site, xho I), the gene fragment encoding amino acids 99 to 296 SEQ ID NO.1 was amplified by reverse transcription.

The PCR product is recovered after agarose gel electrophoresis separation, bamH I and Xho I double enzyme digestion are respectively carried out on the recovered target gene and a plasmid vector pET27b for expression, and the recovered target gene and the plasmid vector pET27b are subjected to electrophoresis recovery again and are connected by T4DNA ligase. The ligation product is transformed into competent cells Rosetta of the escherichia coli, clones on a flat plate are selected for inoculation and expansion, plasmid DNA is extracted, and PCR identification is carried out. Clones showing positive genes of interest by PCR were sequenced and clones with perfectly correct sequences were used for the next step.

2. Expression and purification of recombinant CD38 protein fragments

100ul (Rosetta) of competent cells stored at-80℃were removed, and after thawing, 5ul of CD38 plasmid DNA was added and left on ice for 30min. After heat shock at 42℃for 90 seconds, an ice bath was carried out for 5 minutes, 800. Mu.L of the non-resistant LB medium was added. Resuscitating at 37deg.C for 60min, plating, and overnight culturing. From the transformed plate, the single clone was picked into 4ml of LB liquid medium, cultured at 37℃and 200rpm overnight, and then maintained.

4ul of bacterial liquid is taken into 4ml of LB liquid culture medium, and the culture is carried out overnight for resuscitation. The cultured bacterial liquid is transferred to 200ml LB liquid culture medium for mixing, the temperature is 37 ℃, the rpm is 200, the bacterial liquid is cultured until OD=0.6-0.8, and IPTG (0.5 mM) is added for low-temperature overnight induction. The cells were collected by centrifugation at 4000rpm for 10min in a 400ml large centrifuge tube and the supernatant was discarded. The pellet was blown up with 20-30ml of 10mM Tris-HCl (pH 8.0) and NaCl solution with a final concentration of 0.5M and the cells were sonicated. Centrifugation at 12000rpm for 20 min, loading the supernatant onto Ni-NTA nickel column (QIAGEN) for purification, eluting with 10mM Tris-HCl (pH 7.0) solution containing 50mM imidazole, 250mM imidazole and 500mM imidazole, respectively (containing 0.5M sodium chloride), collecting protein peaks, and detecting by electrophoresis.

Example 2 establishment of 13B5B11C8 hybridoma cell line

1. Immunization

The recombinant CD38 protein obtained in example 1 was emulsified by mixing with an equal volume of complete Freund's adjuvant (CFA, sigma Co.) and was injected for abdominal immunization at a dose of 50. Mu.g/mouse Balb/c (from Evian laboratory animal, fuzhou). After each 14 days booster immunization, the antigen was emulsified with Freund's incomplete adjuvant (IFA, sigma Co.) at a dose of 25. Mu.g/dose. The polyclonal antibody titer of the anti-immunogen in the serum of the mice was detected by indirect ELISA (wavelength 450 nm) 14 days after the 2 nd booster immunization, the mice with the highest titers were immunized by tail vein injection, and the antigen was uniformly mixed with PBS solution at a dose of 50 mug/mouse.

2. Cell fusion:

sterile preparation of immune-up-to-standard mouse spleen cell suspension, mixing with mouse myeloma cell sp2/0 (ATCC) at a ratio of 5:1, centrifuging at 1000rpm for 10min, discarding supernatant, adding 1mL of PEG (Sigma company) solution preheated to 37deg.C from slow to fast within 1 min, and gently rotating centrifuge tube during the addition process to make the cells fully contact with PEG. After standing for 90s at room temperature, adding 4mL of serum-free DMEM (Hyclone) medium preheated to 37 ℃ from slow to fast within 2min, adding 10mL of preheated serum-free DMEM medium within 2min, and finally adding the rest of preheated serum-free DMEM medium within 2min, and fixing the volume to 50mL, wherein a centrifuge tube needs to be slowly shaken during the whole adding process, so that uniform mixing is ensured, and the damage to cells is reduced. After 10min of standing at room temperature, centrifuging (1000 rpm,5 min), discarding the supernatant, resuspending the cells with 10-20mLHAT (Sigma Co.) medium and diluting with HAT medium to a final concentration of 0.5X10 ⁶ cells/mL, all solutions were transferred to 96-well plates, 200. Mu.L/well, and labeled. Carefully transfer 96-well plates to 37 ℃,5% co ₂ Culturing in an incubator. The growth state and potential pollution of the cells are checked regularly, and the culture environment is ensured to be stable by taking care of opening and closing the incubator as little as possible. On day 5 after fusion, HAT medium, 50. Mu.L/well, was added to the plates.

3. Cloning and ELISA screening positive hybridoma cells:

when the fused cell diameter is about 1-2mm, 50-200. Mu.L of the culture supernatant is aspirated for the first cell selection (ELISA, IHC-P and other methods of detection), while HAT medium is added to the culture wells to 200. Mu.L. ELISA was performed on the supernatant, and the cell culture medium in the wells, which gave positive results, was transferred to 24-well plates, supplemented with HT medium, 2 mL/well, and incubated for 3 days.

Repeat screening 2And removing the cultured cells which are not positive results from each cell line in the 4-hole plate to obtain the cultured cells with better positive results. Subcloning and screening the positive cells obtained from the 24-well culture plates by adopting a limiting dilution method, namely adding cell sap obtained by the limiting dilution method into a 96-well culture plate for transferring to CO ₂ Culturing in an incubator for 11 days, and repeatedly screening cells when the diameter of the cloned cells is 1-2 mm. According to the detection result, 4 well-grown monoclonal positive culture wells are selected for each subclone cell line, and transferred to a 24-well plate for continuous culture. And (3) screening the positive clone cell line obtained by cloning in the 24 pore plate again after a period of time, namely the hybridoma cell line 13B5B11C8 secreting the specific monoclonal antibody. The cell line is transferred into a T-75 culture flask to be amplified to the logarithmic growth phase for seed preservation or to carry out subsequent experiments.

EXAMPLE 3 preparation of monoclonal antibodies by in vitro culture

1. In vitro culture

After obtaining a stable hybridoma cell line 13B5B11C8, obtaining the monoclonal antibody by adopting an in vitro culture method.

The hybridoma cells were cultured in DMEM complete medium containing 10% fetal bovine serum, and then the culture supernatant was collected after low-speed centrifugation and stored at 4 ℃ for later use.

2. Purification of monoclonal antibodies

Purification of antibodies by affinity chromatography column rProtein A sepharose Fast Flow (GE): (1) filling the column, filling the purchased protein A packing with proper amount in a gravity chromatographic column, and flushing the column to balance by using a balance buffer solution (0.1M Tris solution containing 1.5M NaCl, pH 7.0); (2) loading, namely adding the cell supernatant filtered by a 0.22 mu m filter membrane into an assembled chromatographic column, and controlling the flow rate to be 1 drop/second; (3) balancing, namely flushing the sample to be balanced by using a balancing buffer solution after loading the sample; (4) eluting, adding an elution buffer (0.1M citric acid solution, pH 4.5) to wash the column and collecting the eluate; (5) regenerating, adding an equilibrium buffer solution to wash the column to balance after the elution is finished, washing the column with 20% ethanol with 2 times of the volume of the column, and storing the column at 4 ℃. Finally, SDS-PAGE method is adopted to identify the purity of the antibody. The result is shown in figure 1, the purity of the polyacrylamide gel electrophoresis diagram of the purified CD38 monoclonal antibody reaches more than 95%, and the concentration of the antibody reaches more than 3.0mg/mL when the concentration is measured by an ultraviolet micro-spectrophotometry.

EXAMPLE 4 characterization of monoclonal antibodies

1. Subtype identification

The antigen protein was diluted to 1. Mu.g/mL of coated ELISA plate, 100. Mu.L of each well was coated overnight at 4℃and the solution was emptied, the plate was washed 3 times with PBS (PBS-T) containing 0.05% Tween, 200. Mu.L of blocking solution (PBS-T solution containing 2% BSA) was added to each well and incubated for 1h at 37 ℃. The liquid was emptied and washed 3 times with PBS-T. 0.1mL of hybridoma cell line culture supernatant diluted 5-fold was added to each well, and incubated at 37℃for 1 hour. The liquid was emptied and washed 3 times with PBS-T. With blocking liquid 1: dilution of HRP-labeled goat anti-mouse (kappa, lambda, igM, igG1, igG2a, igG2b, igG) ₃ IgA) antibodies (Southern Biotech Co.) were added at 0.1mL each well and incubated at 37℃for 1h. The liquid was emptied and washed 3 times with PBS-T. The color development was performed by adding 100. Mu.L of LTMB (Ind. Biotechnology Co., ltd.) substrate (A, B, equal volume of mixed solution) to each well, reacting at room temperature for 15min, stopping the color development reaction by adding 50. Mu.L of 1N HCl solution to each well, and then measuring the OD value at 450nm by using an ELISA reader. The results showed that the monoclonal antibody of the present invention was an IgG1 type murine monoclonal antibody.

2. Affinity constant determination

CD38 protein was coated at a concentration of 100. Mu.g/ml, 100. Mu.l/well, coated overnight at 4℃and washed 3 times with PBS-T. Mu.l of blocking solution was added to each well and blocked at 37℃for 1h and washed 3 times with PBS-T. The monoclonal antibodies purified in example 4 were diluted to the following concentrations (unit: ng/mL): 2000. 500, 125, 62.5, 31.25, 15.625, 3.125, 0.625, 37℃for 1h, PBS-T was washed 3 times. HRP-labeled goat anti-mouse secondary antibody 1: diluted at 5000, 100 μl per well, incubated for 1h at 37℃and washed 3 times with PBS-T. Each well was charged with 100. Mu.l of TMB (Biotechnology Co., ltd., huzhou) and developed for 13min, and 100. Mu.l of 1.0N hydrochloric acid solution was added to terminate the reaction. The absorbance at a wavelength of 450nm was measured with a microplate reader. And drawing a curve of OD value corresponding to the dilution multiple of the antibody, and finding out the concentration A of the antibody corresponding to 1/2 platform OD value. The affinity constant was calculated to be 6.99X10 using the following formula ⁹ 。

Example 5 tissue chip staining and identification

1. Tissue wax block preparation

The sample tissue was HE-slice stained to determine the tumor lesion. Circling the lesion site and preparing for punching. When the acceptor wax block is manufactured, a plastic frame is arranged on a mould, melted paraffin (the melting point is 56-58 ℃) is poured into the mould, a proper amount of paraffin is added after the tissue block is put into the paraffin in the mould, so that the tissue block is completely embedded in the paraffin, the mould is put into a refrigerator with the temperature of minus 20 ℃ for 6min after the temperature is cooled to the room temperature, the paraffin block is taken out of the mould, and the cut piece is put into a refrigerator with the temperature of 4 ℃ for standby. After trimming, continuous slicing is carried out, the thickness is set to be 4 mu m, the continuous slicing is rinsed in 40% alcohol, the continuous slicing is naturally unfolded, then the separated slices are transferred to warm water at 45 ℃ for 30 seconds, the slices are pasted on a glass slide which is treated by 2% APES acetone solution, the prepared tissue chips are placed into a 60 ℃ oven for baking the slices for 2 hours, taken out for cooling at room temperature, and placed into a refrigerator at-4 ℃ for preservation.

2. IHC staining and analysis

Conventional xylenes were dewaxed 3 times for 6 minutes each, hydrated in 100%, 95%, 85% gradient ethanol for 3 minutes each, and finally rinsed with tap water. Antigen retrieval was performed and the sections were then placed in a wet box and rinsed 3 x 3min in PBS. Dropwise adding 3%H ₂ O ₂ Incubate for 10min, rinse with PBS for 3 x 3 min. The PBS was removed by shaking, and the peroxidase blocking agent was added dropwise for incubation at room temperature for 10 minutes. Sections were spun dry, incubated for 1 hour at room temperature (25 ℃) with primary antibody diluted in the appropriate ratio (the dilution ratio of the antibody was designed according to the antibody concentration for the first time), washed 3X 3min with PBS, incubated for 30min with secondary antibody at room temperature, washed 3X 3min with PBS, spun off PBS, and developed for 3-10 min with freshly prepared DAB developing solution. Hematoxylin counterstain for 20 seconds, PBS returns to blue. Sequentially dehydrating according to alcohol gradients of 85% (3 min), 95% (3 min), 100% (3 min) and 100% (3 min), and finally making the xylene transparent for 10min for the last two times, wherein the neutral resin is sealed.

Immunohistochemical staining results were divided into: positive and negative. Positive expression must be positive at the cell and tissue specific antigenic sites. Under the conditions of clear tissue staining distribution and accurate cell positioning, the staining results are further divided according to the difference of staining intensity, and the specific steps are as follows:

1. the sample is weak positive; marked as "+";

2. the sample is moderately positive; marked as "++";

3. the sample was highly positive; marked as' ++ ".

4. The sample was negative, labeled "-".

3. Sample detection results:

the anti-CD 38 protein monoclonal antibody (13B 5B11C 8) and the commercial anti-CD 38 protein monoclonal antibody (38C 03) prepared by the invention are used for synchronously detecting 17T cell lymphomas and 50B cell lymphomas, and the results are shown in the following table:

the result shows that the anti-CD 38 protein monoclonal antibody (13B 5B11C 8) has accurate dyeing positioning, clear dyeing, no nonspecific dyeing and clean background, and shows that the anti-CD 38 protein monoclonal antibody (13B 5B11C 8) has strong specificity.

In 17 cases of T cell lymphomas and 50 cases of B cell lymphomas, the positive rate of the anti-CD 38 protein monoclonal antibody (13B 5B11C 8) is higher than that of the commercial antibody, the sensitivity of the anti-CD 38 protein monoclonal antibody (13B 5B11C 8) is high, the low-level expression of the CD38 protein can be detected, the differential diagnosis on the T cell lymphomas and the B cell lymphomas is more sensitive than that of the commercial antibody, and the risk of omission detection can be avoided. FIG. 2 is a graph of B cell lymphoma immunohistochemical staining results, wherein CD38 is shown on the left (13B 5B11C 8) and commercially available CD38 is shown on the right (38C 03).

And the anti-CD 38 protein monoclonal antibody (13B 5B11C 8) and the control antibody (38C 03) are adopted to synchronously detect on 30 normal tissue chips, and the positive and negative results of samples are consistent, so that the specificity of the antibody in the commercial tissue is equivalent to that of the commercial antibody.

The 30 normal tissues include: brain, heart, cerebellum, esophagus, adrenal gland, stomach, ovary, small intestine, pancreas, colorectal, parathyroid, liver, pituitary, salivary gland, testis, kidney, thyroid, prostate, breast, uterus, spleen, bladder, tonsils, skeletal muscle, thymus (young children), skin, bone marrow, peripheral nerves, lung, mesothelial cells.

Finally, it should be noted that, although the foregoing embodiments have been described in the text and the accompanying drawings of the present application, the scope of the patent protection of the present application is not limited thereby. All technical schemes generated by replacing or modifying equivalent structures or equivalent flows based on the essential idea of the application and by utilizing the contents recorded in the text and the drawings of the application, and the technical schemes of the embodiments are directly or indirectly implemented in other related technical fields, and the like, are included in the patent protection scope of the application.

SEQUENCE LISTING

<110> Fuzhou Michaelis technology development Co., ltd

<120> anti-CD 38 protein monoclonal antibody, cell line, preparation method and application thereof

<130> 2020

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 594

<212> DNA

<213> Artificial sequence (Artifical)

<400> 1

tgcaacatca ccgaggaaga ctaccagcca ctgatgaaac tgggtactca gaccgtgccg 60

tgcaacaaaa ttctgctgtg gtcccgcatc aaggatctgg cacaccagtt tacccaggta 120

cagtgggata tgttcaccct ggaagatacc ctgctgggct atctggcaga tgacctgacc 180

tggtgtggtg aattcaatac ctctaagatc aactatcaaa gctgtccgga ttggcgtaaa 240

gattgcagca ataatccggt ttccgttttc tggaaaaccg taagccgtcg cttcgcggaa 300

gcggcgtgcg atgtggtgca cgtgatgctg aacggttctc gttctaaaat ctttgacaaa 360

aactctacct tcggctccgt cgaagttcac aacctgcagc cggaaaaagt gcagaccctg 420

gaagcctggg ttattcacgg cggtcgtgaa gattcccgtg acctgtgcca ggacccgacc 480

atcaaagaac tggaaagcat catcagcaaa cgtaacattc agttcagctg caaaaacatc 540

taccgcccag acaaatttct gcaatgtgtt aaaaacccgg aagactcttc ctgc 594

<210> 2

<211> 139

<212> PRT

<213> Artificial sequence (Artifical)

<400> 2

Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ser Thr Ala Thr Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Gln Leu Val Arg

20 25 30

Pro Gly Thr Ser Val Glu Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe

35 40 45

Thr Thr Tyr Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu

50 55 60

Glu Trp Ile Gly Met Ile Asp Pro Ser Asp Ser Arg Thr Gly Leu Asn

65 70 75 80

Pro Lys Phe Lys Asp Arg Ala Ser Leu Thr Val Asp Lys Ser Ser Ser

85 90 95

Thr Ala Tyr Met His Leu Asn Ser Pro Thr Ser Asp Asp Ser Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Thr Tyr Arg Ser Phe Phe Trp Phe Phe Asp Val

115 120 125

Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ser

130 135

<210> 3

<211> 127

<212> PRT

<213> Artificial sequence (Artifical)

<400> 3

Met Arg Phe Gln Val Gln Val Leu Gly Leu Leu Leu Leu Trp Ile Ser

1 5 10 15

Gly Val Gln Cys Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala

20 25 30

Ala Ser Pro Gly Glu Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Asn

35 40 45

Ile Ser Lys Tyr Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn

50 55 60

Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser

65 70 75 80

Arg Ile Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

85 90 95

Ser Leu Glu Pro Glu Asp Phe Ala Ile Tyr Tyr Cys Gln Gln His Tyr

100 105 110

Glu Asp Pro Leu Thr Phe Gly Asp Gly Thr Lys Leu Glu Leu Lys

115 120 125

<210> 4

<211> 417

<212> DNA

<213> Artificial sequence (Artifical)

<400> 4

atgggatgga gctgtatcat cctcttcttg gtatcaacag ctacaggtgt ccactcccag 60

gtgcaactgc agcaatctgg gcctcagcta gttaggcctg ggacttcagt ggaaatatcc 120

tgcaaggctt ctggttactc attcaccacc tactggatgc actgggtgaa gcagaggcct 180

ggacaaggtc ttgagtggat tggcatgatt gatccttccg atagtagaac tggattaaat 240

ccgaagttca aggacagggc ctcattgact gtagacaaat cctccagcac agcctacatg 300

cacctaaaca gcccgacatc tgatgactct gcggtctatt actgtgcacg gacctatagg 360

tccttcttct ggttcttcga tgtctggggc gcagggacca cggtcaccgt ctcctca 417

<210> 5

<211> 381

<212> DNA

<213> Artificial sequence (Artifical)

<400> 5

atgaggttcc aggttcaggt tctggggctc cttctgctct ggatatcagg tgtccagtgt 60

gatgtccaga ttacccagtc tccatcttat cttgctgcat ctcctggaga aaccattact 120

attaattgca gggcaagtaa gaacattagc aaatatttag cctggtatca ggagaaacct 180

ggtaaaacta ataagcttct tatctactct ggatccactt tgcaatctgg aattccatca 240

aggatcagtg gcagtggatc tggtacagat ttcactctca ccatcagcag cctggagcca 300

gaagattttg caatatatta ctgtcaacag cattatgaag acccgctcac gttcggtgat 360

gggaccaagc tggagctgaa a 381

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artifical)

<400> 6

ttcgggatcc tgcaacatca c 21

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (Artifical)

<400> 7

atctcgaggc aggaagagtc ttc 23

Claims (6)

1. An anti-CD 38 protein monoclonal antibody, wherein the amino acid sequences of the heavy and light chain variable regions of the monoclonal antibody are the amino acid sequences shown in SEQ ID No.2 and SEQ ID No.3, respectively.

2. The monoclonal antibody of claim 1, wherein the monoclonal antibody heavy and light chain variable region amino acid sequences are encoded by the nucleotide sequences set forth in SEQ ID No.4 and SEQ ID No.5, respectively.

3. The monoclonal antibody according to claim 1, wherein the monoclonal antibody is produced by a hybridoma cell line having a accession number of CGMCC No.22319.

4. The monoclonal antibody of claim 1, wherein the anti-CD 38 protein monoclonal antibody is a mouse IgG1 subtype monoclonal antibody.

5. A hybridoma cell line secreting anti-CD 38 protein monoclonal antibody, which is a mouse hybridoma cell line 13B5B11C8, deposited with the China general microbiological culture collection center with accession number: CGMCC No.22319.

6. An immunoassay reagent for human CD38 protein, wherein the immunoassay reagent comprises the anti-CD 38 protein monoclonal antibody according to any one of claims 1 to 4 as an active ingredient.

Images