CN109293775B

CN109293775B - anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof

Info

Publication number: CN109293775B
Application number: CN201811365150.7A
Authority: CN
Inventors: 李恢波; 王小亚; 李玲玲; 黄信超; 陈惠玲
Original assignee: Fuzhou Maixin Biotechnology Development Co ltd
Current assignee: Fuzhou Maixin Biotechnology Development Co ltd
Priority date: 2018-11-16
Filing date: 2018-11-16
Publication date: 2021-06-04
Anticipated expiration: 2038-11-16
Also published as: CN109293775A

Abstract

The invention relates to an anti-PD-1 protein monoclonal antibody, wherein the amino acid sequences of the variable regions of the heavy chain and the light chain of the monoclonal antibody are respectively the amino acid sequences shown in SEQ ID NO.4 and SEQ ID NO. 5. The inventor also provides a preparation method of the anti-PD-1 protein monoclonal antibody, and the antigen used for immunizing mice is recombinant protein which is expressed by recombination of escherichia coli, and the recombinant protein comprises an escherichia coli pectinase signal peptide sequence, an extracellular domain protein fragment of PD-1 and a histidine protein tag. The inventor further provides a hybridoma cell line for secreting anti-PD-1 protein, wherein the cell line is a mouse hybridoma cell line 11F5C5 with the preservation number of: CGMCC NO. 16209. The anti-PD-1 protein monoclonal antibody is suitable for immunodetection, and has accurate membrane positioning, strong specificity and strong sensitivity.

Description

anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof

Technical Field

The invention relates to the field of biological detection, in particular to an anti-PD-1 protein monoclonal antibody, a cell line, a preparation method and application thereof.

Background

PD-1 is an immunosuppressive receptor, has a molecular weight of 50-55 kD, belongs to I-type transmembrane glycoprotein of immunoglobulin CD28/CTLA-4 family members, and exists on the cell surface in a monomer form. Two tyrosine residues exist in the PD-1 intracellular region and respectively participate in an immune receptor tyrosine inhibition motif forming an amino terminal and an immune receptor tyrosine dependent conversion motif forming a carboxyl terminal; the extracellular region is composed of an IgV-like domain, contains a plurality of glycosylation sites and is heavily glycosylated, and the domain can be combined with a ligand, thereby playing a role in inhibiting T cell activation and playing an important role in peripheral immune tolerance mechanisms and autoimmune diseases.

Tumor tissues can form a microenvironment suitable for tumor growth through soluble cytokines secreted by negative co-stimulatory molecules, and prevent or interfere the monitoring of the immune system of the body on the growth and proliferation of tumor cells, which is manifested by dysfunction of T lymphocytes and reduction of proliferation capacity, and finally, tumor growth, metastasis and recurrence are caused. In the related research of tumor escape mechanism, negative co-stimulatory molecules such as PD-1 and the like over-expressed by lymphocytes in most tumor patients and ligands thereof are found to be important ways for immune monitoring and killing of tumor cells to escape from organisms. Under normal conditions, elevated expression of PD-1 can be seen in a successful immune response to suppress over-activation of immune cells, thereby limiting tissue damage and returning the immune system to ground state. PD-1 mediated signaling can also prevent cytotoxic effector cells from attacking normal tissues. Elevated expression of PD-1 in the tumor microenvironment may be associated with T cell dysfunction. Chronic stimulation of body tumor antigens leads to up-regulation of PD-1 expressed by T cells, causing CD8+ T cells, which play a key role in anti-tumor immunity, to become "depleted T cells", leading to dysfunction without normal proliferation and activation, thus leading to tumor infiltration and metastasis. Therefore, the detection of the expression level of PD-1 by a monoclonal antibody that specifically binds to PD-1 is important for the study of tumor pathology.

Disclosure of Invention

The inventor provides an anti-PD-1 protein monoclonal antibody which is produced by a hybridoma cell line with the preservation number of CGMCC NO. 16209. The cell strain is a mouse hybridoma cell line 11F5C5, and is classified and named as: a mouse hybridoma cell line which has been deposited at the general microbiological center of China Committee for culture Collection of microorganisms 30.07.2018 and is addressed to the institute of microbiology, China academy of sciences, No.3, West Lu 1 Hospital, North Cheng, the area of Chaozhou, Beijing.

Further, the monoclonal antibody specifically recognizes the PD-1 protein.

Further, the heavy chain and light chain variable region amino acid sequences of the monoclonal antibody are respectively encoded by the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO. 3.

Further, the amino acid sequences of the heavy chain and light chain variable regions of the monoclonal antibody are respectively the amino acid sequences shown in SEQ ID NO.4 and SEQ ID NO. 5.

Further, the monoclonal antibody is mouse IgG_2aSubtype monoclonal antibodies.

The inventor also provides a preparation method of the anti-PD-1 protein monoclonal antibody, and the antigen used for immunizing mice is recombinant protein expressed by escherichia coli in a recombinant mode, and the recombinant protein comprises an escherichia coli pectinase signal peptide sequence, an extracellular domain protein fragment of PD-1 and a histidine protein tag.

Further, the extracellular domain protein fragment of the PD-1 is a fragment from the 32 th position to the 160 th position of the PD-1 protein, and the amino acid sequence of the fragment is the amino acid sequence shown in SEQ ID NO. 1.

The inventor also provides a hybridoma cell line secreting anti-PD-1 protein, the cell line is a mouse hybridoma cell line 11F5C5, the cell line is preserved in China general microbiological culture Collection center with the preservation number: CGMCC NO. 16209.

The inventor also provides the application of the anti-PD-1 protein monoclonal antibody in the immunodetection of the PD-1 protein.

Further, the immunodetection includes immunohistochemistry, immunoblotting and enzyme-linked immunoassay.

Different from the prior art, the PD-1 protein extracellular domain protein fragment and the corresponding nucleotide fragment are selected in the technical scheme, and are recombined and expressed through escherichia coli, and the recombined protein comprises an escherichia coli pectinase signal peptide sequence, a PD-1 protein 32 th-160 th amino acid fragment and a purification tag consisting of a plurality of histidines. The purified recombinant protein is used as immunogen to immunize mice, and cell fusion, screening and subcloning are carried out to obtain a mouse hybridoma cell line 11F5C5 which efficiently secretes the anti-PD-1 protein monoclonal antibody and the anti-PD-1 protein monoclonal antibody secreted by the cell line. The antibody obtained by the scheme has high specificity and sensitivity, can specifically recognize cells expressing PD-1 protein, and is suitable for immunological detection, particularly immunohistochemical detection.

Drawings

FIG. 1: agarose gel electrophoresis picture of PD-1 protein extracellular domain gene clone.

FIG. 2: polyacrylamide gel electrophoresis pattern identified for PD-1 protein extracellular domain protein expression.

FIG. 3: polyacrylamide gel electrophoresis picture of PD-1 purified monoclonal antibody.

FIG. 4: immunoblotting of PD-1 monoclonal antibody for detecting human PD-1 protein.

FIG. 5: immunohistochemical staining of T cell lymphoma; the left side is anti-PD 1 protein monoclonal antibody (11F5C5) and the right side is PD1(NAT 105).

FIG. 6: immunohistochemical staining contrast map of tonsil tissue; the left side is anti-PD 1 protein monoclonal antibody (11F5C5) and the right side is PD1(NAT 105).

Detailed Description

EXAMPLE 1 preparation of recombinant PD-1 protein fragments

First, Gene cloning

The invention selects the extracellular domain of the 32 th to 160 th amino acid fragments of human PD-1(h PD-1) protein as antigen (SEQ ID NO.1), and utilizes software Primer 5.0 to design the specific upstream Primer of PD-1 protein according to the corresponding base sequence (SEQ ID NO.6)

5 'TGAATTCCATATGCCCCCCACCTTCTCCCCAG 3' (cleavage site, Nde I) and downstream primer: 5 'GTACTCGAG TTCTGCCCTTCTCTCTGTCACC 3' (cleavage site, Xho I), reverse transcription amplifying a gene fragment comprising the coding amino acids from position 32 to position 160 from T lymphocytes.

The PCR product was separated by agarose gel electrophoresis and recovered, and the recovered target gene and the plasmid vector pET22b for expression were digested with Nde I and Xho I, respectively, and recovered by electrophoresis again, and ligated with T4DNA ligase. And transforming the connecting product into escherichia coli competent cells BL21, selecting clones on a plate, inoculating, expanding and culturing, extracting plasmid DNA, and performing PCR identification. And (4) sequencing and analyzing the clone with positive target gene shown by PCR, and using the clone with completely correct sequence for next experiment.

FIG. 1 is an agarose gel electrophoresis of PD-1 protein extracellular domain gene clones.

Secondly, protein expression and purification

The recombinant plasmid pET22b-PD-1 with correct sequencing is transformed into host bacteria BL21(DE3), a positive monoclonal colony is selected and inoculated into 10mL of test tube LB culture medium containing 50mg/L ampicillin resistance, the culture solution is inoculated into 1L of triangular flask LB culture medium containing 50mg/L ampicillin resistance after being cultured overnight at 37 ℃, the culture solution is expanded and cultured at 37 ℃ and 200rpm/min until the OD value of the bacterial solution reaches 0.6-0.8, IPTG with the final concentration of 1.0mM is added, the culture is continued for 6h at 30 ℃, and the bacteria are centrifugally collected and ultrasonically crushed. And (3) centrifuging the crushed solution, dissolving the precipitate in a proper amount of PBS (phosphate buffer solution) containing 8M urea, dropwise adding a renaturation buffer solution (10mM Tris-HCl pH 8.0, 400mM L-Arghydrochloride, 2mM EDTA and 0.5mM cysteine) for renaturation, and finally further purifying the renatured PD-1 protein solution by using a Ni-NTA column to obtain the antigen protein solution with high purity and conformational homogeneity. FIG. 2 is a gel electrophoresis image of polyacrylamide gel for identifying PD-1 protein extracellular domain protein expression.

Example 211 establishment of F5C5 hybridoma cell line

Immunization

The PD-1 protein obtained in example 1 was diluted to 1mg/mL, mixed and emulsified with an equal volume of complete Freund's adjuvant (CFA, Sigma Co.), and 18-20g of Balb/c mice (purchased from Wu's laboratory animal, Fuzhou) were immunized by abdominal injection at a dose of 100. mu.g/mouse. Thereafter, the booster was administered every 14 days, and the antigen was emulsified with Freund's incomplete adjuvant (IFA, Sigma Co.) at a dose of 50. mu.g/mouse. The polyclonal titer of the anti-immunogen in the serum of the mice is detected by indirect ELISA (wavelength 450nm) 14 days after the 3 rd boosting immunization, the mice with the highest titer are injected by tail vein for impact immunization, and the antigen is uniformly mixed by normal saline with the dosage of 50 mu g/mouse.

Second, cell fusion

Aseptically preparing mouse spleen cell suspension with qualified immunity, mixing with mouse myeloma cell sp2/0(ATCC) at a ratio of 5:1, centrifuging at 1000rpm for 10min, discarding supernatant, adding 1mL of PEG (Sigma) solution preheated to 37 ℃ from slow to fast within 1 min, and slightly rotating the centrifuge tube during the addition process to make the cells fully contact with PEG. Standing at room temperature for 90s, adding 4mL of serum-free DMEM (Hyclone company) culture medium preheated to 37 ℃ from slow to fast within 2min, then adding 10mL of preheated serum-free DMEM culture medium within 2min, finally adding the rest preheated serum-free DMEM culture medium within 2min, and fixing the volume to 50mL, wherein the centrifugal tube needs to be slowly shaken in the whole adding process to ensure uniform mixing and reduce the damage to cells. Standing at room temperature for 10min, centrifuging (1000rpm, 5min), discarding the supernatant, resuspending the cells in 10-20 mL HAT (Sigma) medium, and diluting with HAT medium to a final concentration of 0.5X 10⁶cells/mL, all solutions were transferred to 96-well plates at 200. mu.L/well and labeled. The 96-well plates were carefully transferred to a 37 ℃ 5% CO2 incubator for incubation. The growth state and potential pollution of cells are regularly checked, and the incubator is opened and closed as little as possible to ensure the stability of the culture environment. On day 5 post-fusion, plates were supplemented with HAT medium at 50. mu.L/well.

Third, ELISA screening positive hybridoma cell

When the diameter of the fused cells is about 1-2 mm, 50-200 μ L of culture supernatant is aspirated for the first cell screening (ELISA, IHC-P and other methods), and HAT medium is added to the culture wells to 200 μ L. And (3) detecting the culture solution supernatant by ELISA, transferring all cell culture solution in the culture hole with the positive result obtained by detection to a 24-hole culture plate, supplementing HT medium, culturing for 3 days at a concentration of 2 mL/hole.

And repeatedly screening each cell strain in the 24-pore plate, and removing the culture well cells which are not positive results to obtain the culture well cells with better positive results. Performing subclone screening on the positive well cells obtained from the 24-well culture plate by limiting dilution method, namely adding cell sap obtained by limiting dilution method into 96-well culture plate, and transferring to CO₂Culturing in incubator for 11 daysAnd when the diameter of the cell to be cloned is 1-2 mm, repeatedly screening the cell. According to the detection result, 4 well-grown monoclonal positive culture wells are selected from each subcloned cell strain, and transferred to a 24-well plate for continuous culture. And after a period of time, screening the positive clone cell strain obtained by cloning in the 24-pore plate again, namely the hybridoma cell strain secreting the specific monoclonal antibody. The cell strain is transferred into a T-75 culture flask to be amplified to a logarithmic growth phase for seed preservation or subsequent experiments are carried out.

EXAMPLE 3 preparation of monoclonal antibody by ascites Induction method

First, preparation of ascites

The cell lines were cultured to a logarithmic growth phase, washed with serum-free medium and resuspended, counted 2X 10⁶one/mL. The suspended cell solution was intraperitoneally injected with 0.5mL of F1 mice primed with paraffin oil for 10 days in advance. Ascites collection was started 6 to 7 days after the mice were bred. Centrifuging the collected ascites at 4 deg.C and 8000rpm for 10min, sucking supernatant, collecting in a centrifuge tube to obtain ascites, and storing at 4 deg.C or-20 deg.C. Secondly, purification of monoclonal antibody

The purification of antibodies from ascites fluid using affinity chromatography column of rProtein A sepharose Fast Flow (GE Co.) is mainly divided into: filling a proper amount of purchased ProteinA filler into a gravity chromatography column, and washing the gravity chromatography column with an equilibrium buffer solution (0.1M Tris solution, pH7.0) until the balance is achieved; secondly, loading the sample, adding the ascites filtered by the filter membrane of 0.22 mu m into the packed chromatographic column, and controlling the flow rate to be 1 drop/second; thirdly, balancing, and washing the sample solution to be balanced by using a balancing buffer solution after the sample solution is loaded; eluting, adding an elution buffer solution (0.1M citric acid solution, pH3.0) to wash the column and collecting the eluent; fifthly, regenerating, adding an equilibrium buffer solution to wash the column to be balanced after the elution is finished, washing the column with 2 times of column volume of 20 percent ethanol, and storing the column at 4 ℃. Finally, the purity of the antibody is identified by an SDS-PAGE method (as shown in figure 3), the purity reaches more than 95%, and the concentration of the antibody is determined by an ultraviolet micro-spectrophotometer method and reaches more than 3.0 mg/mL.

EXAMPLE 4 characterization of monoclonal antibodies

Identification of one, two subtypes

Diluting the immunogen solution to 1 mu g/mL coated enzyme label plate, and adding 100 mu L of immunogen solution per holeThe plates were washed 3 times with PBS containing 0.05% Tween (PBS-T), 200. mu.L of blocking solution (PBS-T solution containing 2% BSA) was added to each well, and incubated at 37 ℃ for 1 h. The liquid was decanted and washed 3 times with PBS-T. 0.1mL of culture supernatant of hybridoma cell line diluted 5 times was added to each well, and incubated at 37 ℃ for 1 hour. The liquid was decanted and washed 3 times with PBS-T. Using a confining liquid 1: HRP-labeled goat anti-mouse (kappa, lambda, IgM, IgG) diluted at 400₁，IgG_2a，IgG_2b，IgG₃IgA) antibody (Southern Biotech) was added in an amount of 0.1mL per well and incubated at 37 ℃ for 1 hour. The liquid was decanted and washed 3 times with PBS-T. 100 μ L of TMB (bioscience, England, Huzhou, Inc.) substrate (A, B equal volume mixed solution) is added into each well for color development, the reaction is carried out for 15min at room temperature, 50 μ L of 1N HCl solution is added into each well to stop the color development reaction, and then the OD value at the wavelength of 450nm is measured by a microplate reader. The results show that the monoclonal antibody of the invention is IgG_2aType murine monoclonal antibodies.

Second, determination of affinity constant

Recombinant PD-1 protein was coated at a concentration of 100. mu.g/ml, 100. mu.l/well, coated overnight at 4 ℃ and washed 3 times with PBS-T. Add 200. mu.l of blocking solution to each well and block for 1h at 37 ℃ and wash 3 times with PBS-T. Example 3 purified monoclonal antibody, diluted to the following concentrations (unit: ng/mL): 2000. 500, 125, 62.5, 31.25, 15.625, 3.125, 0.625, incubation at 37 ℃ for 1h, PBS-T wash 3 times. HRP-labeled goat anti-mouse secondary antibody 1: diluted at 5000, 100. mu.l/well, incubated at 37 ℃ for 1h, and washed 3 times with PBS-T. Mu.l of TMB (Hiroshi Biotech, Inc., England, Huzhou) color developing solution was added to each well, and the reaction was stopped by adding 100. mu.l of 1.0N salt solution for color development for 13 min. And measuring the light absorption value with the wavelength of 450nm by using a microplate reader. The OD values were plotted against the antibody dilution factor to find 1/2 the antibody concentration a corresponding to the "plateau OD value". The affinity constant was calculated to be 7.13X 10 using the following formula⁹L×mol^-1。

III, monoclonal antibody reaction specificity and application effect

Selecting immunogen solution, detecting the recognition specificity of the monoclonal antibody of the invention by an immunoblotting method, and carrying out 15% polyacrylamide gel electrophoresis on PD-1 protein. The gel proteins were transferred to PVDF membrane by conventional wet transfer method. The membrane was placed in a 5% BSA-TBST solution (protein side down) and shaker blocked at 37 ℃ for 1h to eliminate non-specific background. After the blocking is finished, washing off 5% BSA-TBST by using TBST, adding the monoclonal antibody of PD-1 prepared by the invention, and shaking and incubating for 1h in a decoloring shaking table. After washing the membrane with TBST, the secondary antibody was added and incubated for 1h in a decolorizing shaker to allow the secondary antibody to bind fully to the primary antibody. The membrane was washed again with TBST and ECL color development kit was added. The experimental result is shown in an immunoblotting chart of detecting human PD-1 protein by using the PD-1 monoclonal antibody in FIG. 4: the band is single and darker, which indicates that the specific reaction between the antibody and the antigen is obvious.

Example 5 tissue chip staining and characterization

Tissue wax block preparation process

HE section staining was performed on T cell lymphoma and tonsil to determine the tumor lesion site. And (5) circling the lesion site and preparing to punch. When the receptor wax block is manufactured, a plastic frame is placed on a mold, melted paraffin (the melting point is 56-58 ℃) is poured into the mold, the tissue block is placed into wax liquid in the mold, then a proper amount of wax liquid is added to enable the tissue block to be completely embedded in the wax liquid, the mold is placed into a refrigerator with the temperature of-20 ℃ for 6min after being cooled to the room temperature, the wax block is taken out of the mold, and the section is sliced or placed into the refrigerator with the temperature of 4 ℃ for storage. After trimming, continuous slicing is carried out, the thickness is determined to be 4 mu m, the continuous slicing is rinsed in 40% alcohol, the slices are naturally unfolded, then the separated slices are transferred to warm water at 45 ℃ for 30 seconds, a glass slide treated by 2% APES acetone solution is used for mounting the slices, the prepared tissue chip is placed into an oven at 60 ℃ for baking for 2 hours, the slices are taken out for cooling at room temperature, and the tissue chip is placed into a refrigerator at-4 ℃ for storage.

IHC staining and analysis

Conventional xylene dewaxing was performed 3 times for 6 minutes each time with 100%, 95%, 85% gradient ethanol hydration for 3 minutes each time and finally tap water rinse. Antigen retrieval was performed and the sections were then placed in a wet box and washed 3 x 3min with PBS. Dropwise adding 3% H₂O₂Incubate for 10min, wash with PBSWash 3 × 3 min. The PBS was spun off and the peroxidase blocker was added dropwise and incubated for 10 minutes at room temperature. Spin-drying the slices, dripping primary antibody diluted in a proper proportion (the dilution proportion of the antibody is designed according to the concentration of the antibody in the primary dilution) and incubating for 1 hour at room temperature (25 ℃), washing for 3X 3 minutes by PBS, dripping secondary antibody and incubating for 30 minutes at room temperature, washing for 3X 3 minutes by PBS, throwing off the PBS, and developing for 3-10 minutes by using a freshly prepared DAB developing solution. Hematoxylin counterstain for 20 seconds, PBS turns blue. Dehydration was carried out in a gradient of 85% (3 min), 95% (3 min), 100% (3 min) and 100% (3 min) in order, and finally two times xylene was cleared for 10min, followed by sealing with neutral gum. The results were observed under a microscope, recorded and analyzed.

The immunohistochemical staining results were divided into: positive and negative. Positive expression must be at a specific antigenic site in cells and tissues to be considered positive. Under the condition that the tissue staining distribution is clear and the cell positioning is accurate, the staining result is further divided according to the difference of staining intensity, which is as follows:

1. the sample is weakly positive; marked "+";

2. the sample is moderately positive; marked "+";

3. the sample is highly positive; marked as "+ + +".

4. The sample was negative and marked "-".

Thirdly, sample detection results:

the simultaneous detection was carried out in 85 cases of T-cell lymphoma and 63 cases of B-cell lymphoma using an anti-PD 1 protein monoclonal antibody (11F5C5) and a control antibody, commercially available PD1(NAT105), with the results shown in the following table:

and (3) displaying a detection result: the anti-PD 1 protein monoclonal antibody (11F5C5) has accurate staining location on cell membranes, clear staining without non-specific staining and clean background, which indicates that the anti-PD 1 protein monoclonal antibody (11F5C5) has strong specificity. Meanwhile, the positive and negative results of the commercial antibody PD1(NAT105) are consistent, which indicates that the specificity of the antibody is equivalent to that of the commercial antibody PD1(NAT 105).

In some cases, the positive staining intensity of the anti-PD 1 protein monoclonal antibody (11F5C5) was higher than that of the control reagent, indicating that the anti-PD 1 protein monoclonal antibody (11F5C5) had higher sensitivity than the commercial antibody.

And the anti-PD 1 protein monoclonal antibody (11F5C5) and the control antibody-commercial anti-PD 1 protein monoclonal antibody (murine monoclonal antibody NAT105) are used for synchronous detection on a normal tissue chip, and the positive and negative results of the sample are consistent, which shows that the specificity of the antibody in the normal tissue is equivalent to that of the commercial antibody.

Sequence listing

<110> Fuzhou mai New Biotechnology development Co., Ltd

<120> anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof

<130> 2018

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 129

<212> PRT

<213> Intelligent (Homo sp)

<400> 1

Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly

1 5 10 15

Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe

20 25 30

Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu

35 40 45

Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe

50 55 60

Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val

65 70 75 80

Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser

85 90 95

Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg

100 105 110

Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser

115 120 125

Pro

<210> 2

<211> 417

<212> DNA

<213> Artificial sequence (Artificial)

<400> 2

atgctgttgg ggctgaagtg ggttttcttt gttgtttttc atcaaggtgt gcattgtgag 60

gtgcagcttg ttgagtctgg tggaggattg gtgcagccta aagggtcaat gaaactctca 120

tgtgcagcct ctggattcac cttcaatacc tacgccatga actgggtccg ccaggctcca 180

ggaaagggtt tggaatgggt tgctcgcata agaactagaa gtaataatta tgtaacatat 240

tatgccgatt cagtgaaagg caggttcacc atctccagag atgattcaca aaacattctc 300

tatctgcaaa tgaacaactt gaaaactgag gactcagcca tgtattactg tgtgcgaccg 360

acagctcggg ggccgtttgc ttactggggc caagggactc tggtcactgt ctctgca 417

<210> 3

<211> 393

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

atggagacag acacactcct gctatgggtg ctgctgctct gggttccagg ttccacaggt 60

aacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 120

atatcctgca gagccactga aagtgttgat agttatgaca atagttttat gtgctggtac 180

cagcagaaac caggacagcc acccaaactc ctcatctatc ttgcatccaa cctagaatct 240

ggggtccctg ccaggttcag tggcagtggg tctgggacag acttcaccct caccattgat 300

cctgtggagg ctgatgatgc tgcaacctat tactgtcagc aaaattatga ggatcccctc 360

acgttcggtg ctgggaccaa gctggagctg aaa 393

<210> 4

<211> 139

<212> PRT

<213> Artificial sequence (Artificial)

<400> 4

Met Leu Leu Gly Leu Lys Trp Val Phe Phe Val Val Phe His Gln Gly

1 5 10 15

Val His Cys Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln

20 25 30

Pro Lys Gly Ser Met Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe

35 40 45

Asn Thr Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

50 55 60

Glu Trp Val Ala Arg Ile Arg Thr Arg Ser Asn Asn Tyr Val Thr Tyr

65 70 75 80

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser

85 90 95

Gln Asn Ile Leu Tyr Leu Gln Met Asn Asn Leu Lys Thr Glu Asp Ser

100 105 110

Ala Met Tyr Tyr Cys Val Arg Pro Thr Ala Arg Gly Pro Phe Ala Tyr

115 120 125

Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala

130 135

<210> 5

<211> 131

<212> PRT

<213> Artificial sequence (Artificial)

<400> 5

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala

20 25 30

Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Thr Glu Ser

35 40 45

Val Asp Ser Tyr Asp Asn Ser Phe Met Cys Trp Tyr Gln Gln Lys Pro

50 55 60

Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser

65 70 75 80

Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

85 90 95

Leu Thr Ile Asp Pro Val Glu Ala Asp Asp Ala Ala Thr Tyr Tyr Cys

100 105 110

Gln Gln Asn Tyr Glu Asp Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu

115 120 125

Glu Leu Lys

130

<210> 6

<211> 387

<212> DNA

<213> Intelligent (Homo sp)

<400> 6

tggaaccccc ccaccttctc cccagccctg ctcgtggtga ccgaagggga caacgccacc 60

ttcacctgca gcttctccaa cacatcggag agcttcgtgc taaactggta ccgcatgagc 120

cccagcaacc agacggacaa gctggccgcc ttccccgagg accgcagcca gcccggccag 180

gactgccgct tccgtgtcac acaactgccc aacgggcgtg acttccacat gagcgtggtc 240

agggcccggc gcaatgacag cggcacctac ctctgtgggg ccatctccct ggcccccaag 300

gcgcagatca aagagagcct gcgggcagag ctcagggtga cagagagaag ggcagaagtg 360

cccacagccc accccagccc ctcaccc 387

<210> 7

<211> 32

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

tgaattccat atgcccccca ccttctcccc ag 32

<210> 8

<211> 31

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

gtactcgagt tctgcccttc tctctgtcac c 31

Claims

1. The monoclonal antibody for resisting PD-1 protein is characterized in that the amino acid sequences of the variable regions of the heavy chain and the light chain of the monoclonal antibody are respectively the amino acid sequences shown in SEQ ID NO.4 and SEQ ID NO. 5.

2. The monoclonal antibody of claim 1, wherein the heavy and light chain variable region amino acid sequences of the monoclonal antibody are encoded by the nucleotide sequences set forth in SEQ ID No.2 and SEQ ID No.3, respectively.

3. The monoclonal antibody according to claim 1, which is secreted by a mouse hybridoma cell line having a accession number of CGMCC No. 16209.

4. The monoclonal antibody of claim 1, wherein the monoclonal antibody specifically recognizes a PD-1 protein.

5. The monoclonal antibody of claim 1, wherein the monoclonal antibody is a mouse IgG_2aSubtype monoclonal antibodies.

6. A hybridoma cell line for secreting anti-PD-1 protein, wherein the cell line is a mouse hybridoma cell line 11F5C5, and the cell line is preserved in the China general microbiological culture Collection center with the preservation number: CGMCC NO. 16209.