CN109206514B - TSLP monoclonal antibody and its preparation method and application - Google Patents

TSLP monoclonal antibody and its preparation method and application Download PDF

Info

Publication number
CN109206514B
CN109206514B CN201710532144.5A CN201710532144A CN109206514B CN 109206514 B CN109206514 B CN 109206514B CN 201710532144 A CN201710532144 A CN 201710532144A CN 109206514 B CN109206514 B CN 109206514B
Authority
CN
China
Prior art keywords
antibody
antigen
binding portion
tslp
variable region
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710532144.5A
Other languages
Chinese (zh)
Other versions
CN109206514A (en
Inventor
魏辉
刘丽平
高荣凯
韩化敏
田雨佳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Basios (beijing) Biotechnology Co Ltd
Original Assignee
Basios (beijing) Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basios (beijing) Biotechnology Co Ltd filed Critical Basios (beijing) Biotechnology Co Ltd
Priority to CN201710532144.5A priority Critical patent/CN109206514B/en
Publication of CN109206514A publication Critical patent/CN109206514A/en
Application granted granted Critical
Publication of CN109206514B publication Critical patent/CN109206514B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244—Interleukins [IL]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/5743—Specifically defined cancers of skin, e.g. melanoma
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52—Assays involving cytokines
    • G01N2333/54—Interleukins [IL]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/24—Immunology or allergic disorders
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Abstract

This application provides the antibody of anti-thymic stromal lymphopoietin (TSLP) or its antigen-binding portion thereofs, the nucleic acid of encoding said antibody or its antigen-binding portion thereof, expression vector comprising the nucleic acid, host cell comprising the expression vector, composition comprising the antibody or its antigen-binding portion thereof, prepare the antibody or the method for its antigen-binding portion thereof, utilize the method for the antibody or its antigen-binding portion thereof detection TSLP, detection kit comprising the antibody or its antigen-binding portion thereof and the antibody or its antigen-binding portion thereof, the nucleic acid, the diagnosis of the expression vector or the composition in preparation for immune system related disease or tumor disease, treat the purposes in the kit of tracking and/or prognosis inspection.

Description

TSLP monoclonal antibody and its preparation method and application
Invention field
Invention relates generally to field of immunology, specifically, this application involves anti-thymic stromal lymphopoietins (TSLP) antibody or its antigen-binding portion thereof, the nucleic acid of encoding said antibody or its antigen-binding portion thereof include the nucleic acid Expression vector, the host cell comprising the expression vector, the composition comprising the antibody or its antigen-binding portion thereof, system The method of the standby antibody or its antigen-binding portion thereof, using the antibody or its antigen-binding portion thereof detection TSLP presence or The method of content, the detection kit comprising the antibody or its antigen-binding portion thereof and the antibody or its antigen-binding portion Point, the nucleic acid, the expression vector or the composition in preparation examining for immune system related disease or tumor disease Purposes in the kit of disconnected, treatment tracking and/or prognosis inspection.
Background of invention
TSLP is a kind of immune cell factor of CD4+T cell response that inducing dendritic is cell-mediated, wherein being lived by TSLP Preceding allogeneic phenotype dendritic cells (DC) lifting in the induction and maintenance of allergia inflammatory Th2 and mast cell response changed It acts on, this is realized by the generation of the cell factor of proallergen, chemotactic factor (CF) and costimulatory molecules, they are instructed originally T cell becomes Th2 cell, generates IL-4, IL-5 and IL-13 critical mediator of allergia inflammation.TSLP is in atopic dermatitis (AtD), the overexpression in netherton syndrome and asthma indicates the cell factor in the morbidity machine of these allergia inflammatory diseases Important function in system.This obtains the support of animal model, in the animal model, transgenosis of the TSLP in skin or lung It is overexpressed and will lead to people's atopic dermatitis or asthma very by the removal of the Gene targeting of the negative regulator of TSLP Similar allergia inflammatory disease.
Therefore, prepare can specific recognition and combine TSLP monoclonal antibody in examining to the disease for being related to TSLP Disconnected, treatment, prognosis etc. are significant.
Summary of the invention
A kind of antibody or its antigen-binding portion thereof be capable of specific recognition and combine TSLP provided herein, coding The nucleic acid of the antibody or its antigen-binding portion thereof, the expression vector comprising the nucleic acid, the host comprising the expression vector Cell, the composition comprising the antibody or its antigen-binding portion thereof prepare the antibody or the method for its antigen-binding portion thereof, It include the antibody or its antigen knot using the method for the presence or content of the antibody or its antigen-binding portion thereof detection TSLP The detection kit of conjunction part and the antibody or its antigen-binding portion thereof, the nucleic acid, the expression vector or described group Close kit of the object in preparation for diagnosis, the treatment tracking and/or prognosis inspection of immune system related disease or tumor disease In purposes, particular content is as follows.
In a first aspect, this application provides the antibody of anti-thymic stromal lymphopoietin (TSLP) or its antigen bindings Part, it includes heavy chain variable regions, wherein the heavy chain variable region includes HCDR-1, SEQ ID shown in SEQ ID NO:1 HCDR-3 shown in HCDR-2 and SEQ ID NO:3 shown in NO:2.
In some embodiments, the antibody of anti-TSLP or its antigen-binding portion thereof also include light chain variable region, described light Chain variable region includes shown in LCDR-2 and SEQ ID NO:6 shown in LCDR-1, SEQ ID NO:5 shown in SEQ ID NO:4 LCDR-3.
In some embodiments, the antibody of anti-TSLP or its antigen-binding portion thereof include weight shown in SEQ ID NO:7 Chain variable region.
In some embodiments, the antibody of anti-TSLP or its antigen-binding portion thereof also include shown in SEQ ID NO:8 Light chain variable region.
In some embodiments, antigen-binding portion thereof be Fab segment, Fab' segment, 2 segment of F (ab'), Fv segment, Sc-Fv and binary.
In some embodiments, heavy chain variable region and light chain variable region include framework region, and the framework region is Humanization.
In some embodiments, the antibody of anti-TSLP also includes constant region, and the constant region is humanization.
In some embodiments, the activity that the antibody of anti-TSLP or its antigen-binding portion thereof block TSLP to mediate.Excellent In the embodiment of choosing, the antibody of anti-TSLP or its antigen-binding portion thereof are by blocking the combination of TSLP and TSLPR to block The activity that TSLP is mediated.
Second aspect, this application provides isolated nucleic acid, encode antibody or its antigen binding described in first aspect Heavy chain variable region in part.
The third aspect, this application provides isolated nucleic acid, encode antibody or its antigen binding described in first aspect Light chain variable region in part.
Fourth aspect, this application provides expression vectors, and it includes the isolated nucleic acid and third party described in second aspect Isolated nucleic acid described in face.
5th aspect, this application provides host cells, and it includes the expression vectors described in fourth aspect.
6th aspect, this application provides the methods of production polypeptide comprising: under conditions of expressing nucleic acid sequence, Host cell described in the 5th aspect of culture in culture medium, so that production includes the polypeptide of light chain and heavy chain variable region；With from institute It states host cell or culture medium recycles the polypeptide.
7th aspect, this application provides compositions, and it includes the antibody or its antigen-binding portion thereof described in first aspect And pharmaceutically acceptable carrier or excipient.
Eighth aspect, this application provides the methods of the presence or content of TSLP in detection Samples subjects comprising mentions For antibody described in first aspect or its antigen-binding portion thereof.
In some embodiments, the subject is mammal, preferably people.
9th aspect, this application provides the thymic stromal lymphopoietins (TSLP) in detection Samples subjects Kit, it includes the antibody or its antigen-binding portion thereof described in first aspect.
In some embodiments, the subject is mammal, preferably people.
Tenth aspect, this application provides described in first aspect antibody or its antigen-binding portion thereof, second aspect or the Composition described in isolated nucleic acid described in three aspects, expression vector described in fourth aspect or the 7th aspect is used in preparation Purposes in the kit of the diagnosis of immune system related disease or tumor disease, treatment tracking and/or prognosis inspection.
In some embodiments, the immune system related disease is selected from inflammatory and allergic inflammation disease.
In some embodiments, the inflammatory and allergic inflammation disease are selected from allergic asthma, allergic dermatitis, mistake Quick property rhinitis, allergic conjunctivitis, atopic dermatitis fibre modification and inflammatory bowel disease.
In some embodiments, the tumor disease is selected from Hodgkin lymphoma, breast cancer, cancer of pancreas, melanoma And lung cancer.
Brief Description Of Drawings
Fig. 1 is the plasmid map of the MBP-TSLP-His expression vector of building.
Fig. 2 shows MBP-TSLP-His fusion protein the host strain Small Amount inducing expression the case where.
Fig. 3 shows expression-form of the MBP-TSLP-His fusion protein in host strain.
Fig. 4 shows the purification result of SDS-PAGE detection MBP-TSLP-His fusion protein.
Fig. 5 shows the purification result of western blot detection MBP-TSLP-His fusion protein.
Fig. 6 show by western blot confirm it is immune after Mice Body in produce the antibody of TSLP specificity.
Fig. 7 shows the hybridoma cell line that secretion TSLP monoclonal antibody has been screened by western blot.
Fig. 8 shows that the hybridoma for detecting secretion TSLP monoclonal antibody by western blot is subcloned three times As a result.
Fig. 9 shows the result of monoclonal antibody classification detection.
Figure 10 shows the testing result of hybridoma supematant and titer of ascites.
Figure 11 shows the result by SDS-PAGE and Western blot analysis antibody purification.
Figure 12 shows that (Figure 12 A is the sequencing knot of K chain to the result of isolated monoclonal antibody H, K chain variable region sequencing Fruit, Figure 12 B are the sequencing result of H chain).
Detailed description of the invention
Present inventor obtains the monoclonal antibody of the anti-TSLP of high-titer a kind of by hybridoma technology, this will It can be very helpful to the diagnosis, treatment and prognosis of the disease for being related to TSLP.
Unless otherwise specified, implementation of the invention will be using the molecular biology of this field routine, microbiology, carefully Born of the same parents' biology, biochemistry and immunological technique.
Unless otherwise specified, term use herein contains with what those skilled in the art were generally understood Justice.
In a first aspect, this application provides the antibody of anti-thymic stromal lymphopoietin (TSLP) or its antigen bindings Part, it includes heavy chain variable regions, wherein the heavy chain variable region includes HCDR-1, SEQ ID shown in SEQ ID NO:1 HCDR-3 shown in HCDR-2 and SEQ ID NO:3 shown in NO:2.
In some embodiments, the antibody of anti-TSLP or its antigen-binding portion thereof also include light chain variable region, described light Chain variable region includes shown in LCDR-2 and SEQ ID NO:6 shown in LCDR-1, SEQ ID NO:5 shown in SEQ ID NO:4 LCDR-3.
In some embodiments, the antibody of anti-TSLP or its antigen-binding portion thereof include weight shown in SEQ ID NO:7 Chain variable region.
In some embodiments, the antibody of anti-TSLP or its antigen-binding portion thereof also include shown in SEQ ID NO:8 Light chain variable region.
In some embodiments, antigen-binding portion thereof be Fab segment, Fab ' segment, 2 segment of F (ab '), Fv segment, Sc-Fv and binary.
In some embodiments, heavy chain variable region and light chain variable region include framework region, and the framework region is Humanization.
In some embodiments, the antibody of anti-TSLP also includes constant region, and the constant region is humanization.
Antigen use herein is fusion protein, is followed successively by maltose-binding protein (MBP) mark from N-terminal to C-terminal The fusion protein of label, TSLP and histidine (6 × His) label.
When for purifying purpose great expression albumen, since many destination proteins are expressed usually in the form of inclusion body, make The purifying for obtaining the later period needs further denaturation and renaturation, not only influences the purity of the albumen of purifying, it is also possible to influence The biological property of albumen.Thus need to express that destination protein in the form of soluble.Although known in the art can lead to It crosses and selects the specific temperature for expressing bacterial strain, co-expressing with molecular chaperones, reducing destination protein inducing expression, adjustment inducer dense The serial of methods such as degree improve the solubility of recombinant protein, are but not always effective.Inventors have found that selection by destination protein with MBP label connects construction of fusion protein, can be realized the solubility expression of destination protein.
MBP (maltose-binding protein) label protein size is 40kDa, is encoded by the malE gene of e. coli k12. MBP can increase the dissolubility of the fusion protein of overexpression in bacterium.MBP tag fusion protein can be affine by crosslinked starch Chromatograph a step purifying, in conjunction with fusion protein can be eluted in physiological buffer with 10mM maltose, to recombinant protein into Row isolates and purifies.But due to during protein expression, the great expression of MBP sky label protein, so that utilizing crosslinked starch What is purified when affinity chromatography is the mixture of the fusion protein of MBP albumen and MBP and destination protein, and is difficult to MBP egg White and MBP albumen is separated with the fusion protein of destination protein, therefore inventor is further by the fusion protein of MBP- destination protein Histidine tag is added in favor of the purifying of fusion protein, in the fusion protein double labels and destination protein put in order by N-terminal to C-terminal is followed successively by MBP label, destination protein and histidine tag, so that by-product MBP and MBP- destination protein is equal Not with metal ion affinity chromatography resin-bonded.
TSLP (thymic stromal lymphopoietin) is the cell factor as derived from epithelial cell.It is initially identified as The molecule secreted by tfd substrate plays a role in T cell and B cell development.And TSLP is some outside thymus gland in recent years Effect also is accredited.Existing research proves the crosstalk between TSLP mediated cancerous cell and immune system.Tumour cell or Cancer associated fibroblast cell produces TSLP, and TSLP promotes the maturation of immature dendritic cell (iDC), and passes through Monocytes-derived dendritic cells (MoDC) promote the generation of CCL17, CCL22 and OX40 ligand.Therefore TSLP is exempting from Epidemic disease plays a significant role in adjusting, and can be used for the diagnosis, treatment tracking and/or prognosis inspection of TSLP immune system related disease Cha Zhong.
The term as used herein " antibody " refers to any type of antibody or its segment that can show desired bioactivity. Therefore, it is used with broadest meaning, specifically cover monoclonal antibody (including full length monoclonal antibodies), polyclonal antibody, Multi-specificity antibody (such as bispecific antibody) and antibody fragment, as long as they can show desired bioactivity.
The term as used herein " antigen-binding portion thereof of anti-TSLP antibody " or " its antigen-binding portion thereof " include antibody Substantially retain its inhibit the active bioactivity of TSLP segment or derivative.Therefore, term " its antigen-binding portion thereof " Refer to a part of full length antibody, usually its antigen binding domain or variable region.The example of antigen-binding portion thereof include: Fab segment, Fab ' segment, 2 segment of F (ab '), Fv segment, binary, single-chain antibody molecules such as sc-Fv and the mostly spy formed from antibody fragment Heterogenetic antibody.In general, antigen-binding portion thereof or derivative retain at least the 10% of its TSLP inhibitory activity.Preferably, antigen knot It closes part or derivative retains at least the 25% of its TSLP inhibitory activity, 50%, 60%, 70%, 80%, 90%, 95%, 99% Or 100% (or more).It is also believed that the antigen-binding portion thereof of anti-TSLP antibody may include that will not substantially change its bioactivity Conservative amino acid replacement.
" Fab segment " includes CH1 and the variable region of a light chain and heavy chain.The heavy chain of Fab molecule cannot with it is another One heavy chain molecule forms disulfide bond.
The part of " Fab ' segment " containing a light chain and heavy chain or segment, the part or segment contain VH knot Structure domain and CH1 structural domain and the region between CH1 and CH2 structural domain, so that between two heavy chains of 2 Fab ' segments Interchain disulfide bond can be formed, to form 2 molecule of F (ab ').
" 2 segment of F (ab ') " contains between CH1 and CH2 structural domain containing two light chains and two heavy chains, the heavy chain Constant region a part so that forming interchain disulfide bond between two heavy chains.2 segment of F (ab ') is thus by two Fab ' pieces Duan Zucheng, and two Fab ' segments are linked together by the disulfide bond between two heavy chains.
" Fv segment " includes variable regions from the heavy and light chains, but is the absence of constant region.
" scFv " or " scFv " refers to the antibody fragment of the VH structural domain comprising antibody and VL structural domain, wherein these Structural domain exists in the form of single polypeptide chain.In general, Fv polypeptide also includes the peptide linker between VH structural domain and VL structural domain, The connector makes scFv be capable of forming desired structure to carry out antigen binding.
" binary " refers to tool there are two the small antibody fragment of antigen binding site, and the segment includes weight in same polypeptide chain Chain variable domains (VH) and the light variable domains (VL) (VH-VL or VL-VH) being attached thereto.It cannot by using being so short that The connector matched between two structural domains allowed on same chain, each structural domain is forced and the complementary domain of another chain is sent out Raw pairing, to generate two antigen binding sites.
" humanized antibody " refers to the antibody formation of the sequence of the sequence containing inhuman (such as mouse) antibody and human antibody.This Kind antibody contains the minimal sequence spread out from non-human immunoglobulin.In general, humanized antibody include at least one, Usual two variable domains, wherein hypervariable region corresponds to non-human immunoglobulin, and the area FR is human immunoglobulin sequence. Humanized antibody optionally can also include at least part of constant region for immunoglobulin (Fc), and the constant region is usually that people is immune The constant region of globulin.The humanization form of rodent animal antibody, it will usually the CDR sequence comprising parent's rodent animal antibody, It but may include certain amino acid replacements, to improve affinity or increase the stability of humanized antibody.
" hypervariable region " refers to the amino acid residue of the responsible antigen binding of antibody.Hypervariable region include from " complementary determining region " or Amino acid residue (such as residue 24-34 (LCDR-1), 50-56 (LCDR-2) and the 89- in light variable domains of " CDR " Residue 31-35 (HCDR-1), 50-65 (HCDR-2) and 95-102 (HCDR- in 97 (LCDR-3) and heavy-chain variable domains 3)；Kabat et al., (1991) Sequences of Proteins of Immunological Interest, the 5th edition, Public Health Service, National Institutes of Health, Bethesda, Md., and/or from " super Variable loop " amino acid residue (residue 26-32 (L1), 50-52 (L2) and 91-96 (L3) i.e. in light variable domains and Residue 26-32 (H1), 53-55 (H2) and 96-101 (H3) in heavy-chain variable domains；Chothia and Lesk, (1987) J.Mol.Biol.196:901-917." framework region " or " FR " residue, refer to be defined herein as CDR residue hypervariable region residue it Those of outer variable domains residue.
In some embodiments, the activity that the antibody of anti-TSLP or its antigen-binding portion branch block TSLP to mediate.? In preferred embodiment, the antibody of anti-TSLP or its antigen-binding portion thereof are by blocking the combination of TSLP and TSLPR to block The activity that TSLP is mediated,
" TSLPR " is the abbreviation of tslp receptor, belongs to hematopoietic cytokine receptor family, The activity of TSLP can be mediated by the interaction with TSLP.
Second aspect, this application provides isolated nucleic acid, encode the weight chain variable in antibody described in first aspect Area.
The third aspect, this application provides isolated nucleic acid, encode the light chain variable in antibody described in first aspect Area.
Fourth aspect, this application provides expression vector, it includes described in second aspect nucleic acid and the third aspect described in Nucleic acid.
5th aspect, this application provides host cells, and it includes the expression vectors described in fourth aspect.
6th aspect, this application provides the methods of production polypeptide comprising: under conditions of expressing nucleic acid sequence, Host cell described in the 5th aspect of culture in culture medium, so that production includes the polypeptide of light chain and heavy chain variable region；With from institute It states host cell or culture medium recycles the polypeptide.
For the antibody in recombinant production the application, the nucleic acid for being separately encoded heavy chain and light chain is isolated, and be inserted into one Or in multiple reproducible carriers, for further cloning the amplification or expression of DNA.Using conventional scheme (such as by using Being capable of oligonucleotide probe in conjunction with the gene specific of the heavy chain of encoding antibody and light chain) it is easily isolated and that coding is sequenced is single The DNA of clonal antibody.Many carriers are available.Carrier component generally comprises but is not limited to signal sequence, replication orgin, one A or multiple marker gene, enhancer element, promoter and transcription terminator.In one embodiment, in the application Both light chain and heavy chain of the antibody of anti-TSLP are expressed by identical carrier (such as plasmid or adenovirus vector).
The antibody of the application and its antigen-binding fragment can be produced by any method known in the art.In a reality It applies in scheme, antibody is expressed in the mammal of culture or insect cell, such as Chinese hamster ovary (CHO) cell, people's embryo 293 cell of kidney (HEK), mouse myeloma NSO cell, baby hamster kidney (BHK) cell.
7th aspect, this application provides compositions, and it includes the antibody or its antigen-binding portion thereof described in first aspect And pharmaceutically acceptable carrier or excipient.
Eighth aspect, this application provides thymic stromal lymphopoietins (TSLP) in the sample of detection subject In the presence of or content method comprising provide first aspect described in antibody or its antigen-binding portion thereof.
In some embodiments, the subject is mammal, preferably people.
9th aspect, this application provides the thymic stromal lymphopoietins (TSLP) in detection Samples subjects Kit, it includes the antibody or its antigen-binding portion thereof described in first aspect.
In some embodiments, the subject is mammal, preferably people.
Tenth aspect, this application provides described in first aspect antibody or its antigen-binding portion thereof, second aspect or the Composition described in isolated nucleic acid described in three aspects, expression vector described in fourth aspect or the 7th aspect is used in preparation Purposes in the kit of the diagnosis of immune system related disease or tumor disease, treatment tracking and/or prognosis inspection.
In some embodiments, the immune system related disease is selected from inflammatory and allergic inflammation disease.
In some embodiments, the inflammatory and allergic inflammation disease are selected from allergic asthma, allergic dermatitis, mistake Quick property rhinitis, allergic conjunctivitis, atopic dermatitis fibre modification and inflammatory bowel disease.
In some embodiments, the tumor disease is selected from Hodgkin lymphoma, breast cancer, cancer of pancreas, melanoma And lung cancer.
Embodiment
There is provided following embodiment is only that some embodiments of the application are illustrated, not any restrictions Purpose or property.Experimental method used in following embodiment is conventional skill in the art if be not described in Art.
The preparation of embodiment 1:TSLP antigen
The building of MBP-TSLP-His prokaryotic expression carrier and protein purification
The building of MBP-TSLP-His prokaryotic expression carrier
MBP-TSLP-His segment is expanded using following amplification system and PCR program.
PCR amplification system: PrimerStar, 25 μ L；MBP-TSLP-His-F, 1 μ L；MBP-TSLP-His-R, 1 μ L； PBMC cDNA, 2 μ L；Amplification system is complemented into 50 μ L.The wherein RNA that PBMC cDNA is extracted by the PBMC that human peripheral separates Reverse transcription obtains, and peripheral blood sample is provided by our company healthy volunteer.
PCR program: 98 DEG C, 5min；98 DEG C, 10s；55 DEG C, 5s；72 DEG C, 5s；Totally 30 circulations.72 DEG C of extensions later 10min。
Primer sequence used are as follows:
MBP-TSLP-His-F:5 '-CGCGGATCCATGTACGACTTCACTAAC-3’
(BamHI restriction enzyme site) (SEQ ID NO:15)
MBP-TSLP-His-R:5 '-CGAAGCTTTTAGTGGTGGTGGTGGTGGTGCTGTTGTTTCAGTAAAGGTCG- 3 ' (HindIII restriction enzyme sites) (SEQ ID NO:16)
Obtained PCR product gel electrophoresis is recycled.Then use following digestion systems by PCR product and expression vector PMAL-C2X (this carrier is saved by this laboratory) digestion is overnight: smartcut buffer, 5 μ L；BamHI-HF, 1 μ L； HindIII-HF, 1 μ L；PCR product/pMAL-C2X, 25 μ L；ddH2O, 18 μ L.Gel electrophoresis recycle digestion after PCR product and Expression vector.PCR product is then connect 3h:T4DNA ligase buffer solution, 2 μ with 16 DEG C of expression vector by following linked systems L；T4DNA ligase, 1 μ L；PCR digestion products, 12 μ L；PMAL-C2X digestion products, 5 μ L.
Connection product is converted into DH5 α host strain (this bacterial strain is saved by this laboratory).
The recombinant clone of acquisition is subjected to PCR verifying and digestion verification.
Single bacterium on picking plate, which is fallen within, stays overnight shaking flask culture (revolving speed in LB (Amp 50mg/L) fluid nutrient medium 200rpm, 37 DEG C of temperature).Bacterium solution after taking culture carries out PCR verifying.PCR system are as follows: PrimerStar, 10 μ L；MBP- TSLP-His-F, 1 μ L；MBP-TSLP-His-R, 1 μ L；Bacterium solution, 1 μ L；Reaction system is complemented into 20 μ L.The PCR program of use Are as follows: 98 DEG C, 5min；98 DEG C, 10s；55 DEG C, 5s；72 DEG C, 5s, totally 30 recycle.72 DEG C of extension 10min later.By PCR product Agarose gel electrophoresis is carried out, determines positive colony using positive PCR bands.
Obtained bacterium solution is extracted recombinant plasmid, and is stayed overnight recombinant plasmid digestion using following systems: smartcut is slow Fliud flushing, 5 μ L；BamHI-HF, 1 μ L；HindIII-HF, 1 μ L；Plasmid, 8 μ L；ddH2O, 35 μ L.Digestion products are subjected to agarose Gel electrophoresis determines positive colony using positive PCR bands.
The plasmid map of the positive colony of acquisition is as shown in Figure 1.
The purifying of MBP-TSLP-His fusion protein
A small amount of inducing expressions of MBP-TSLP-His fusion protein:
The carrier built is converted into prokaryotic expression bacterial strain DH5 α, the single bacterium on picking streak plate falls within LB (100mg/ L, Amp) in fluid nutrient medium, bacterium is shaken overnight.Overnight bacterium solution is taken to be inoculated in new 20mL liquid LB in the ratio of 1:100 In (100mg/L, Amp).When bacterium solution OD600 reaches 0.6,100 μ L glucoses (40%) and 6 μ L 1M IPTG (IPTG are added Final concentration of 0.3mM) it is induced, inductive condition is 37 DEG C, 250rpm, induces 3h.Take 1mL bacteria liquid sample.By bacteria liquid sample 13000rpm is centrifuged 1min to collect thallus, and 1 × sample-loading buffer of 100mL is added after abandoning supernatant.Acutely thallus is resuspended in concussion Afterwards, boiling water 10min, ice bath 5min, 4 DEG C of 13000rpm are centrifuged 1min, the thallus electrophoresis inspection after taking the control and induction not induced Survey whether express express target protein.As a result as shown in Fig. 2, mesh can be induced after the IPTG of final concentration of 0.3mM is added as the result is shown Albumen MBP-TSLP-His expression.
A large amount of inducing expressions of MBP-TSLP-His fusion protein
The bacterial strain identified is lined on LB (100mg/L, Amp) plate, picking monoclonal is in 10mL LB (100mg/ L, Amp) it is incubated overnight in fluid nutrient medium, second day ratio with 1:100 is forwarded to the new LB of 330mL (100mg/L, Amp) In culture medium, when culture to OD600nm is 0.6,1.65mL glucose (40%) and 99 μ L (final concentration 0.3mM) 1M are added IPTG, 16 DEG C of induction 20h.Every 330mL bacterium solution is collected as 1 pipe, and 4 DEG C, 4700rpm is centrifuged 8min and collects thallus, and -80 DEG C freeze.
With 50mL MCAC-0 buffer (TrisHCl (pH 8.0), 20mM；NaCl, 500mM；Glycerol 10% (V/V)) It sufficiently suspends, sequentially adds 10%Triton X-100 and 0.1M PMSF, the ultrasonic 5s of 1/100 volume, be spaced 5s, altogether ultrasound 20min, until liquid is clarified.Supernatant is taken after 20,000g, 4 DEG C of centrifugation 20min, uses 0.45 μm of membrane filtration degerming as sample. Supernatant precipitating after centrifugation is subjected to electrophoresis, detects the expression of MBP-TSLP-His fusion protein.As a result such as Fig. 3 institute Show, MBP-TSLP-His fusion protein is mainly expressed in the form of soluble as the result is shown.
MBP-TSLP-His protein purification
With 50mL MCAC-0 buffer (TrisHCl (pH 8.0), 20mM；NaCl, 500mM；Glycerol 10% (V/V)) Abundant suspension thalline sequentially adds 10%Triton X-100 and 0.1M PMSF, the ultrasonic 5s of 1/100 volume, is spaced 5s, altogether Ultrasonic 20min, until liquid is clarified.Supernatant is taken to use 0.45 μm of membrane filtration degerming as sample after 20,000g, 4 DEG C of centrifugation 20min Product.
Chromatographic column is carried out as follows to use pre-treatment: cleaning Ni with the deionized water of 10X bed volume2+Affine layer Analyse column；With the 0.1M NiSO of 4X bed volume4Cross column；It is cleaned with the deionized water of 10X bed volume；With 10X bed volume MCAC-0 buffer balances pillar.With 10~15mL/h flow velocity by sample upper prop, for about 2.5~3h.MCAC-50 buffer is clear Pillar is washed, MCAC-250 buffer elutes destination protein, carries out SDS-PAGE and western blot to destination protein of collection etc. Detection.
SDS-PAGE and western blot detecting step are as follows:
Take 50 μ L samples that 2 × sample-loading buffer is added, after sufficiently oscillation mixes, denatured by boiling 10min, ice bath in boiling water 5min.12,000rpm, 4 DEG C of centrifugation 1min prepare loading.
Separation gel (glue equipment installation method is shown in " III electrophoresis tank of Mini Protean installs and uses guide ") is recorded, according to The size of target protein prepares the concentration of separation gel:
The volume (mL/10mL) of each ingredient needed for preparing 10mL SDS-PAGE separation gel
After encapsulating, one layer of ddH is covered on upper layer2There is obvious boundary in O, standing 30min to separation gel and water layer, to the greatest extent Residual liquid may be exhausted with blotting paper.5% concentration glue is directly perfused on the separation gel having polymerize, is immediately inserted into comb.
The volume (mL) of each ingredient needed for preparing 5mL and 10mL 5%SDS-PAGE concentration glue
After being gelled admittedly, glue groove is assembled, electrophoretic buffer is added, takes the sample loading handled well in right amount.80V voltage is extremely Bromophenol blue forward position is run in separation gel, then has just run out of glue lower edge with 120V voltage to bromophenol blue forward position.
Electrotransfer: PAGE gel is cut into extra glue side, is placed in transfering buffering liquid, cuts 4 and glue same size Whatman 3M filter paper and 1 same size nitrocellulose filter.The filter paper sheared, nitrocellulose filter, sponge are turned in electricity It is impregnated in buffer.Plastic stent is laid flat, one piece of sponge is put on black plastic plate (cathode).2 filter paper alignment are placed on On sponge, it is sequentially placed gel, cellulose membrane, 2 filter paper, sponges.When placing each layer, it is intended to remove the gas between them Bubble.Above layers finally are clamped with plastic stent, are put into electrotransfer slot, pay attention to cellulose membrane side by anode (red), glue Cathode (black) is leaned in side.Power on, 2h is shifted in 200mA constant current, after transfer, takes out plastic stent, is successively removed each Layer, film front (contact gel face) are placed on upward in container appropriate.
Closing: shifting the NC film finished and rinse 1 time in TBST buffer, be transferred in 10mL confining liquid, 37 DEG C of closing 1h.
Primary antibody reaction: after the completion of closing, renew confining liquid, and source of mouse His monoclonal is added by 1:3000 extension rate and resists Body, room temperature shake 1.5h.TBST washes film 3 times, each 10min.
Secondary antibody reaction: the IgG secondary antibody with the diluted sheep anti mouse HRP label of confining liquid 1:3000 is added, reacts 1h.It uses again TBST washes film 3 times, each 10min.
Colour developing: under the conditions of being protected from light, NC film is placed in developing solution and is developed the color, until band is clear, with distilled water flushing to terminate Reaction.
As shown in Figures 4 and 5, pass through Ni2+Affinity column can obtain purity and the relatively high MBP-TSLP-His of concentration Fusion protein.
Antigen buffer in the antigen of above-mentioned purifying is changed to PBS using 10kd super filter tube, and is concentrated to 1 μ g/ μ L.
The preparation of embodiment 2:TSLP antibody
1. immune mouse
The strain of immune mouse is BALB/C, and female mice or male mouse are ok, and mouse age of mouse is 4-6 weeks, and general 20g is left The right side, health is disease-free, and 3 mouse are immunized in every kind of antigen in parallel.By antigen and immunologic adjuvant, (QuickAntibody-Mouse5W is won Dragon difficult to understand, KX0210041, water-soluble novel adjuvant) 1:1 mixing by volume, using back and subcutaneous abdomen multi-point injection side Formula, each point do not exceed 50 μ L.Second of first time immune progress after two weeks immune, immune for the second time to be reinforced after three weeks It is immune, adjuvant is not added at this time and only carries out peritoneal immunity with antigen, cell fusion can be carried out after booster immunization 3 days.It is immune every time Employed in the type of antigen, dosage and the quantity of immune mouse it is as shown in table 1.
Table 1
2.ELISA method detects antibody titer
Second of immune eye socket angular vein sinus blood sampling progress ELISA that passes through after two weeks detects antibody titer.
Sample message:
Mouse 2 of control mice 1 (immune physiological saline), immune 80 μ g MBP-TSLP-His antigens (order respectively Entitled antigen 80-1 and antigen 80-2), mouse 2 of immune 40 μ g MBP-TSLP-His antigens (are respectively designated as antigen 40-1 It with antigen 40-2), is taken a blood sample by eye socket angular vein sinus, blood sample is centrifuged 5min collection in 4 DEG C of placements 3h or more, 3000rpm Serum, using PBS buffer solution (0.2M, pH=7.4) to the serum of collection according to 1:10,1:100,1:1000,1:10000,1: 100000, the ratio of 1:1000000,1:10000000 are diluted.
Experiment reagent:
Coating buffer: 0.2mol/L Na is taken2CO38mL, 0.2mol/L NaHCO317mL mixing, then plus 75mL distilled water, Adjust PH to 9.6；
PBS buffer solution: KH2PO40.2g, KCl 0.2g, Na2HPO4.12H2O 2.93g, NaCl 8.0g, adds distilled water extremely 1L adjusts PH to 7.4；
Cleaning solution (PBST): 0.5% Tween-20 is added in PBS buffer solution；
Confining liquid: 10%BSA, PBS buffer solution dissolution；
One-component TMB developing solution: it is purchased from Suo Laibao Biotechnology Co., Ltd；
Terminate liquid: 1M H2SO4。
The step of ELISA method
A. purifying antigen MBP-TSLP-His is diluted with coating buffer, and every hole is coated with 0.1 μ g antigen.Each sample does three in parallel Part, PBS is as negative control；
B. it is added in ELISA Plate hole with the amount in 100 holes μ L/, sets 4 DEG C of overnight or 37 DEG C of absorption 2h；
C. the liquid in hole is discarded, while being washed 2 times with 200 μ L of cleaning solution, each 5min is patted dry；
D. every hole adds 4 DEG C of 200 μ L confining liquid overnight or 37 DEG C of closing 2h；
E. 200 μ L of cleaning solution is washed 2 times, and each 5min is patted dry；
F. every hole adds the 100 μ L as above primary antibody to be detected diluted, 37 DEG C of incubation 30min；200 μ L of cleaning solution is washed 4 times, is clapped It is dry；
G. plus the IgG secondary antibody (1:10000 dilution) of sheep anti mouse HRP label, every hole 100 μ L, 37 DEG C of incubation 30min are washed Liquid 200uL is washed 4 times, is patted dry；
Plus TMB developing solution 100 μ L, 37 DEG C of 20min h.；
I. 1M H is added in every hole2SO450 μ L terminate reaction, read OD under 450nm wavelength on enzyme linked immunological reading apparatus Value.
The potency result of second of immune mouse internal antibody after two weeks is referring to table 2
Table 2
Note: hypographous data are data of the PBS as negative control
Thus table can be seen that antigen MBP-TSLP-HIS and the antibody titer highest generated be immunized in 80 μ g dosage, resist Body potency is 105。
Antibody titer reaches 104Cell fusion can be carried out above, so antigen is selected to exempt from for MBP-TSLP-HIS-80 μ g Mouse after epidemic disease carries out cell fusion.
3.Western trace detects antibody specificity
Antigenic information:
Control antigen is that (albumen of our company other staff purifying, is shown in GP96 protein purification patent, CN to GP96-GST 106279393 A), experimental antigen is the MBP-TSLP-His of purifying.
Primary antibody information:
Control mice (immune physiological saline), the mouse of immune 80 μ g MBP-TSLP-HIS antigens, immune 40 μ g The mouse of MBP-TSLP-HIS antigen carries out the diluted serum of 1:10000.
Secondary antibody information:
The IgG secondary antibody of sheep anti mouse HRP label, dilutes according to 1:3000.
SDS-PAGE and western blot detecting step are as described in Example 1.
Can be seen that from the western blot testing result of Fig. 6 produced in immunized mice body TSLP specificity it is anti- Body.
4. cell fusion and screening
Cell fusion is carried out using PEG method, HAT Screening of Media takes cell conditioned medium to carry out Western print after 7-14 days Positive hole is screened in mark detection.
Agents useful for same:
HAT culture medium: complete RPMI-1640 culture medium, 20%FBS (Hyclone), dual anti-(100 ×) 5mL, HT storage Liquid (100 ×) 5mL, A store liquid (100 ×) 5mL, are settled to 500mL.
Aminopterin-induced syndrome (A) storage liquid (100 ×, 4 × 10-5Mol/L): weigh 1.76mg aminopterin-induced syndrome (Aminopterin, MW=440.4), it is dissolved in 100mL ultrapure water, filtration sterilization, dispenses bottle, -20 DEG C of preservations.
Hypoxanthine and thymidine (HT) storage liquid (100 ×, H:10-2Mol/L, T:1.6 × 10-3mol/L): Weigh 136.1mg hypoxanthine (Hypoxanthine, MW=136.1) and 38.8mg thymidine (Thymidine, MW =242.2) 1mol/L NaOH, which is added dropwise, makes to be completely dissolved, and adds ultrapure water to 100mL, and filtration sterilization dispenses bottle, -20 DEG C of jellies It deposits.
Penicillin and streptomycin (dual anti-) solution (100 ×): 1,000,000 unit of benzyl penicillin (sodium salt) and streptomysin (sulfate) are taken 1g is dissolved in 100mL sterilizing ultrapure water, dispenses bottle (5mL/ bottles), -20 DEG C freeze.
Method and step:
A. by 1 × 108Splenocyte and 3 × 107-5×107Myeloma cell SP2/0-Ag14 (ratio 5:1-2:1) mixing In Yu Yizhi 50mL fusion pipe, complete RPMI-1640 culture medium is added to 30mL, is mixed well；
B.1000r/min it is centrifuged 5min, supernatant is exhausted as far as possible；
C. bottom of fusion pipe is tapped on palm, keeps sedimentation cell loosely uniform, is set in 40 DEG C of water-baths and is preheated；
D. added with 1mL suction pipe in 1min or so and be preheated to 40 DEG C 50%PEG1450 (PH 8.0) 1mL, side edged is gently Stirring, the speed that strict control is added dropwise is fast after first slow, controls time for adding in 1min；
E. 1mL1640 incomplete culture medium (preheated) and then rapidly is added dropwise in 1min, 2mL is added dropwise in 2min, It is added dropwise to 10mL when 5min, adds to 40mL.The speed that strict control is added dropwise, fast after first slow, side edged is gently mixed, room temperature Stand 5min；
F.1000r/min it is centrifuged 5min, is discarded supernatant；
G. 5mL HAT culture medium is added, gently pressure-vaccum sedimentation cell, makes it suspend and mix, and then adds HAT culture medium To 160mL, general packing to 8 96 orifice plates, every hole 0.2mL sets 37 DEG C, culture in 5%CO2 incubator；
H. liquid was partly changed with HAT culture medium every 3 days；
I. Growth of Hybridoma Cell situation is often observed, supernatant is sucked out for antibody when its length to 1/10 or more hole floor space Detection.General 5 days it can be seen that several cells cell mass, 10 days visible obvious cell masses.It can generally be resisted within 10-14 days Physical examination is surveyed.
Western blot detects hybridoma cell line, and specific steps are as described in Example 1, and wherein antigen is purifying MBP-TSLP-His；Primary antibody is hybridoma supernatant, and every Kong Weiyi cell line is numbered；Secondary antibody is sheep anti mouse HRP mark The IgG secondary antibody of note, dilutes according to 1:3000.
As a result referring to Fig. 7.From figure 7 it can be seen that detecting that No. 42 hybridoma cell line is by western blot The cell line of TSLP specificity.
No. 5.42 hybridoma cell line subclones
It is subcloned by limiting dilution assay
A. hybridoma suspension to be cloned is prepared, is diluted to each hole with the HAT culture medium containing 20% fetal calf serum 0.5-1 cell is dispensed into 96 orifice plates.
B.37 DEG C, 5%CO2Wet culture 7-10 days, macroscopic clone occur can be detected antibody；It is micro- being inverted Under the microscope, the hole for marking only single clonal growth, takes supernatant to make antibody test.
C. the cell expansion culture in antibody test positive hole is taken, and is frozen.
Source of mouse TSLP monoclonal antibody is obtained by hybridoma technology, 3 subclones have been carried out at present, sub- gram three times It is grand to be respectively designated as 42-75,42-24 and 42-38, cell line is stored in liquid nitrogen.
Western blot detection:
Western blot detection is carried out to the cell line after being subcloned three times, specific steps are as described in Example 1. The antigen protein of western blot detection is TSLP-GST (for a kind of antigen obtained before our company by prokaryotic expression). Primary antibody is 42-75,42-24 and 42-38 hybridoma supernatant stoste, and secondary antibody is the IgG secondary antibody of sheep anti mouse HRP label, according to 1:3000 dilution.
Testing result is as shown in Figure 8.From figure 8, it is seen that 3 subclones obtain the cell line of specificity.
6. the large scale preparation of monoclonal antibody
The large scale preparation of antibody is carried out using the method for producing monoclonal antibody in animal body
A, material:
Adult BALB/c mouse, atoleine, the hybridoma in logarithmic growth phase.
B, method:
A. intraperitoneal inoculation norphytane or atoleine, every mouse 0.2mL.
B.7-10 intraperitoneal inoculation PBS or the diluted hybridoma of serum free medium, every mouse 5 × 10 behind day5/ 0.2mL。
C. after being spaced 5 days, mouse ascites production is observed daily, if abdomen obviously expands, when touching, skin has Tension, i.e., available No. 16 syringe needles acquire ascites, generally can continuously adopt 2-3 times, and usual every mouse can adopt 5-10mL ascites；
D. ascites is centrifuged 5min with 2000r/min, removes cell component and other sediments, collect supernatant, measurement Antibody titer (method is same as above), packing, -70 DEG C freeze it is spare, or freeze-drying save.
7mL ascites is obtained by the method for producing monoclonal antibody in animal body, is stored in -80 DEG C.
7. the classification and subgroup identification of monoclonal antibody immunity globulin
Buy mouse monoclonal antibody IgG subclass detection card (Bo Aolong, BF06038).
As a result as shown in figure 9, the monoclonal antibody of No. 42 cell strains secretion is IgG2a subclass.
8. antibody titer detects
Antibody titer, antigen TSLP-GST are detected using western blot, primary antibody is 10 times and is serially diluted The cell conditioned medium of mouse ascites and No. 42 cell line, secondary antibody are the IgG secondary antibody of sheep anti mouse HRP label, are diluted according to 1:3000, are had Body step is as described in Example 1.
As the result is shown in Figure 10, from fig. 10 it can be seen that titer of ascites is 105, cell conditioned medium potency is 102。
9. monoclonal antibody-purified
(1) pretreatment-silica absorption method
The ascites frozen is centrifuged 15min with 2000r/min, removes cell component (or the solid formed in frozen storage process Substance) etc.；The ascites that upper layer is limpid is taken, PBS (PH=7.4) dilution is added in equivalent；Then add 150mg in every 10mL dilution ascites SiO 2 powder mixes, and in incubation at room temperature 30min, shakes frequently；2000g is centrifuged 20min, and lipid etc. is removed by the method, Clear ascites can be obtained.
(2) the thick of monoclonal antibody mentions-ammonium sulfate precipitation method
A. the preparation of saturated ammonium sulfate solution: 500g ammonium sulfate is added in 500mL distilled water, is heated to being completely dissolved, room Overnight, the crystallization of precipitation is allowed to stay in bottle temperature.Required amount is taken before use, with 2mol/L NaOH tune PH to 7.8.
B. it saltouts: drawing the ascites that 10mL is handled well and move into small beaker, under stiring, saturated ammonium sulfate solution is added dropwise 5.0mL；Continue to be slowly stirred 30min；10000r/min is centrifuged 15min；Discard supernatant liquid, 1/3 saturation degree sulfuric acid of sediment Ammonium suspends, stirring action 30min, is centrifuged with method；It repeats back 1-2 times；Sediment is dissolved in 1.5mL PBS (0.1mol/L, PH =7.4) in.
C. desalination: the sample that will saltout is fitted into slide-A-lyzer cassette 10k MWCO dialysis cassette, uses 50-100 The PBS buffer solution dialysis (4 DEG C) of times volume 12-24 hour, therebetween 5 dialyzates of replacement.
(3) purifying-Protein G affinity chromatography of monoclonal antibody
A. sample solution is taken out from slide-A-lyzer cassette 10k MWCO dialysis cassette, is added to combine and delays Fliud flushing (20mM phosphate, 150mM NaCl buffer (PH=7.2)) constant volume is to 50mL；
B. the use pre-treatment of chromatographic column: 2mL Protein G filler is taken to be added in column tube, with going for 10 × bed volume Ionized water cleaning, with 10 × bed volume binding buffer balance column；
C. loading: connection AKATA instrument, loading flow velocity are 1min/mL, about 50min；
D. clean: combination buffer cleans 20mL；
E. elute: elution buffer (0.1M glycine buffer (PH=2.75)) elutes destination protein, collects elution egg It is white, every pipe 2mL；
F.SDS-PAGE and western blot detection are monoclonal antibody-purified as a result, specific steps are referring to embodiment 1.
As a result as shown in figure 11.SDS-PAGE and western blot are the results show that TSLP monoclonal antibody purity compares It can be used for subsequent experimental after height, concentration and displacement buffer.
10. monoclonal antibody sequences determine
RNA is extracted, murine heavy chain and light chain primer are designed, determines monoclonal antibody sequences by being sequenced.
(1) RNA extraction-Trizol method
A. by No. 42 cell lines of culture with 1200g be centrifuged 5min, collect cell precipitation, every 107Cell is added 1mLTrizol buffer acutely shakes 1min on the oscillator immediately, stands 5min on ice；
B. 200 μ L chloroforms are added, acutely shakes 30s, stands 3min on ice；
C.4 DEG C 12,000rpm is centrifuged 15min, turns supernatant into the pipe of another 1.5ml, isometric isopropanol is added, It mixes, is placed at room temperature for precipitating 10min；
D.4 DEG C 12,000rpm is centrifuged 15min, abandons supernatant, stays precipitating, primary with 70% ethanol washing, and 4 DEG C 8,000rpm It is centrifuged 5min recycling precipitating, 15~20min of room temperature is drying precipitated；
E. it is precipitated with 50 μ L RNase-free water (Tiangeng is biochemical) dissolution, 4 μ L DNaseI is added, 37 DEG C of reactions half are small When；
F. 1/10 volume 3M NaAc (pH 5.2) is added, mixes, adds the dehydrated alcohol of 2.5 times of volumes, put after mixing Set -20 DEG C of precipitating 30min；
G.4 DEG C 12,000rpm is centrifuged 15min, abandons supernatant, stays precipitating, primary with 70% ethanol washing, 4 DEG C of 8000rpm from Heart 5min recycling precipitating；
H. blotting paper blots water, and placing 10~20min or so then at room temperature lower open mouth keeps ethyl alcohol volatilization clean, with 30 μ L RNase-free water dissolution precipitating, and take 2 μ L testing results；
I.RNA electrophoresis detection: the RNA for taking 2 μ L RNase-free water to dissolve, the detection of 1% agarose gel electrophoresis.To two Bar indicator is separated gel to be placed under gel imaging system after 1cm and be observed, if the master of 28S rRNA closer from loading wells The width of band and brightness are two times of another 18S rRNA, then show that RNA is undegraded.
(2) reverse transcription of RNA
Reverse transcription system: 2 μ g, oligo dT of RNA18(TAKARA) 2 μ L, Rnase free water complement to 15 μ L, it is of short duration from The heart, 70 DEG C, 5min is immediately placed on 5min on ice.Following component: 5 × MLV buffer (Promega), 5 μ L, dNTP Mix is added (TAKARA, each 2.5mM) 1.5 μ L, RNA Inhibitor (TAKARA) 0.5 μ L, MLV reverse transcriptase (promega) 1 μ L, RNase free water complements to 25 μ L, and above-mentioned reaction mixture is uniformly mixed, immediately of short duration centrifugation, 42 DEG C of 1h, and 70 DEG C 15min。
The amplification and analysis of (3) No. 42 cell line H, K chain variable regions
K chain expands the primer:
MKF:5 '-GGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATTGTGCTCACCCAGTCTCCA-3 ' (SEQ ID NO:11)
MKR:5 '-GAGTCATTCTGCGGCCGCCCGTTTGATTTCCTGCTTGGTGCC-3 ' (SEQ ID NO:12)
H chain expands the primer:
MHF:5 '-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCGAGGTGAAGCTTCTCGAGTCTGG-3’ (SEQ ID NO:13)
MHR:5 '-AGAGCCACCTCCGCCTGAACCGCCTCCACCTGAGGAGACGGTGACCATGGTCCC-3 ' (SEQ ID NO:14)
The variable region fragment of No. 42 cell line H, K chains is expanded using following amplification system and PCR program.
PCR amplification system: PrimerStar (TAKARA), 25 μ L；MHF, 1 μ L；MHR, 1 μ L, No. 42 2 μ of cell line cDNA L；Sterilizing distilled water is added, amplification system is complemented into 50 μ L.
PCR program: 98 DEG C, 5min；98 DEG C, 10s；55 DEG C, 5s；72 DEG C, 5s；Totally 30 circulations.72 DEG C of extensions later 10min。
Obtained PCR product gel electrophoresis is recycled, then connects PCR product and cloning vector by following linked systems It connects: 5 μ L of PCR product, 1 μ L of cloning vector (Simple Cloning Vector, Quan Shijin), 16 DEG C are overnight Connection.
Connection product is converted into Trans-T1 competent cell (buying from Quan Shijin biotech firm): connection product is added to In 100 μ L Trans-T1 competent cells, mixes gently, mixture is placed into 30min on ice.Mixture is placed in 42 DEG C of water Heat shock 90s in bath；It is immediately placed in ice bath, continues 3min.In superclean bench to mixture be added 600 μ L LB culture solutions, 37 DEG C 150rpm shaken cultivation 45min.5,000g centrifugation 4min, collect thallus.500 μ L supernatants are discarded, it will be remaining with pipettor About 200 μ L liquid are blown and beaten uniformly with suspension thalline.Recipient bacterium is applied to LB (containing 50 μ g/mL Amp) solid culture primary surface, in 12~16h is cultivated in 37 DEG C of baking ovens.
The recombinant clone of acquisition is subjected to PCR verifying.
Single bacterium on picking plate, which is fallen within, stays overnight shaking flask culture (revolving speed in LB (Amp 50mg/L) fluid nutrient medium 200rpm, 37 DEG C of temperature).Bacterium solution after taking culture carries out PCR verifying.PCR system are as follows: PrimerStar, 10 μ L；MHF, 1 μ L； MHR, 1 μ L；2 μ L of bacterium solution；Sterilizing distilled water is added to supply amplification system to 20 μ L.The PCR program of use are as follows: 98 DEG C, 5min； 98 DEG C, 10s；55 DEG C, 5s；72 DEG C, 5s；Totally 30 recycle, later 72 DEG C of extension 10min.PCR product is subjected to Ago-Gel Electrophoresis determines positive colony using positive PCR bands.
The bacterial strain of positive PCR bands is sent into sequencing, sequence alignment is carried out, finally determines No. 42 cell line H chain variable regions Sequence.
Using clone and the sequencing for carrying out K chain with the completely the same scheme of above-mentioned H chain, difference is only that primer therein The primer for changing K chain into finally determines No. 42 cell line K chain variable region sequences by sequence alignment.
No. 42 cell line H chain variable region amino acid sequences are
Nucleotides sequence is classified as
GAGGTCCAGCTGAAGGAGTCAGGGGCTGAACTGGCAAAACCTGGGGCCTCAGTGAAGATGTCCTGCAA GGCTTCTGGCTACACCTTTACTAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATT GGATACATTAATCCTAGCACTGGTTATACTGAGTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTGCAGACA AATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATC GCGGGGGATTACGACGGGGTTTGCTTACTGGGGCCAAGGGACCATGGTCACCGTCT CCTCA (SEQ ID NO:9)
No. 42 cell line K chain variable region amino acid sequences are
Nucleotides sequence is classified as
GACATTGTGCTCACCCAGTCTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGC AGATCTAGTCA
GAGCATTGTACATAGTAATGGAAACACCTATTTAGAATGGTACCTGCAGAAACCAGGCCAGTCTCCAAA GCTCCTGATCT
ACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCA CACTCAAGATC
AGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGTTCCGTGGACGTTC GGTGGAGGCAC
CAAGCAGGAAATCAAACGG (SEQ ID NO:10)
Sequencing result is as shown in Figures 12 A and 12 B.
From sequencing result as can be seen that No. 42 cell line K chain CDR sequences are as follows: LCDR1:24-32ASGYTFTSY (SEQ ID NO:4)；LCDR2:73-78DKSSST (SEQ ID NO:5)；LCDR3:99-108SRGITTGFAY (SEQ ID NO:6).No. 42 Cell line H chain CDR sequence are as follows: HCDR1:25-36SSQSIVHSNGNT (SEQ ID NO:1)；HCDR2:51-55LLIYK (SEQ ID NO:2)；HCDR3:96-102GSHVPWT (SEQ ID NO:3).
Wherein K chain variable region sequence is identical as Mouse Ig kappa-chain (GenBank:M34588.1).
Without departing from spirit and scope disclosed in the present application, each embodiment disclosed in the present application can be carried out It is a variety of to change and use equivalent replacement.Unless be otherwise noted in context, otherwise any feature, the step of the embodiment of the disclosure Rapid or embodiment can be used with any other feature, step or combination of embodiment.
Sequence table
<110>Bai Xiousi (Beijing) Bioisystech Co., Ltd
<120>TSLP monoclonal antibody and its preparation method and application
<130> 17C10871CN
<160> 16
<170> PatentIn version 3.5
<210> 1
<211> 12
<212> PRT
<213>mouse
<400> 1
Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr
1 5 10
<210> 2
<211> 5
<212> PRT
<213>mouse
<400> 2
Leu Leu Ile Tyr Lys
1 5
<210> 3
<211> 7
<212> PRT
<213>mouse
<400> 3
Gly Ser His Val Pro Trp Thr
1 5
<210> 4
<211> 9
<212> PRT
<213>mouse
<400> 4
Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
1 5
<210> 5
<211> 6
<212> PRT
<213>mouse
<400> 5
Asp Lys Ser Ser Ser Thr
1 5
<210> 6
<211> 10
<212> PRT
<213>mouse
<400> 6
Ser Arg Gly Ile Thr Thr Gly Phe Ala Tyr
1 5 10
<210> 7
<211> 119
<212> PRT
<213>mouse
<400> 7
Glu Val Gln Leu Lys Glu Ser Gly Ala Glu Leu Ala Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Asn Pro Ser Thr Gly Tyr Thr Glu Tyr Asn Gln Lys Phe
50 55 60
Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Ser Arg Gly Ile Thr Thr Gly Phe Ala Tyr Trp Gly Gln Gly
100 105 110
Thr Met Val Thr Val Ser Ser
115
<210> 8
<211> 113
<212> PRT
<213>mouse
<400> 8
Asp Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly
85 90 95
Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Gln Glu Ile Lys
100 105 110
Arg
<210> 9
<211> 357
<212> DNA
<213>mouse
<400> 9
gaggtccagc tgaaggagtc aggggctgaa ctggcaaaac ctggggcctc agtgaagatg 60
tcctgcaagg cttctggcta cacctttact agctactgga tgcactgggt aaaacagagg 120
cctggacagg gtctggaatg gattggatac attaatccta gcactggtta tactgagtac 180
aatcagaagt tcaaggacaa ggccacattg actgcagaca aatcctccag cacagcctac 240
atgcaactga gcagcctgac atctgaggac tctgcagtct attactgtgc aagatcgcgg 300
gggattacga cggggtttgc ttactggggc caagggacca tggtcaccgt ctcctca 357
<210> 10
<211> 339
<212> DNA
<213>mouse
<400> 10
gacattgtgc tcacccagtc tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60
atctcttgca gatctagtca gagcattgta catagtaatg gaaacaccta tttagaatgg 120
tacctgcaga aaccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180
tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240
agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300
tggacgttcg gtggaggcac caagcaggaa atcaaacgg 339
<210> 11
<211> 54
<212> DNA
<213>artificial sequence
<400> 11
ggcggaggtg gctctggcgg tggcggatcg gacattgtgc tcacccagtc tcca 54
<210> 12
<211> 42
<212> DNA
<213>artificial sequence
<400> 12
gagtcattct gcggccgccc gtttgatttc ctgcttggtg cc 42
<210> 13
<211> 56
<212> DNA
<213>artificial sequence
<400> 13
gtcctcgcaa ctgcggccca gccggccatg gccgaggtga agcttctcga gtctgg 56
<210> 14
<211> 54
<212> DNA
<213>artificial sequence
<400> 14
agagccacct ccgcctgaac cgcctccacc tgaggagacg gtgaccatgg tccc 54
<210> 15
<211> 27
<212> DNA
<213>artificial sequence
<400> 15
cgcggatcca tgtacgactt cactaac 27
<210> 16
<211> 50
<212> DNA
<213>artificial sequence
<400> 16
cgaagctttt agtggtggtg gtggtggtgc tgttgtttca gtaaaggtcg 50

Claims (19)

1. the antibody or its antigen-binding portion thereof of a kind of anti-thymic stromal lymphopoietin, it includes heavy chain variable region and gently Chain variable region, wherein the heavy chain variable region includes HCDR- shown in HCDR-1, SEQ ID NO:2 shown in SEQ ID NO:1 HCDR-3 shown in 2 and SEQ ID NO:3, and the light chain variable region includes LCDR-1, SEQ shown in SEQ ID NO:4 LCDR-3 shown in LCDR-2 and SEQ ID NO:6 shown in ID NO:5.
2. the antibody or its antigen-binding portion thereof of anti-thymic stromal lymphopoietin as described in claim 1, wherein institute It states antibody or its antigen-binding portion thereof includes light chain shown in heavy chain variable region shown in SEQ ID NO:7 and SEQ ID NO:8 Variable region.
3. the antibody or its antigen-binding portion thereof of anti-thymic stromal lymphopoietin as described in claim 1, wherein institute It states antigen-binding portion and is selected from Fab segment, Fab ' segment, 2 segment of F (ab '), Fv segment, sc-Fv and binary.
4. the antibody or its antigen-binding portion thereof of anti-thymic stromal lymphopoietin as described in claim 1, wherein institute It states heavy chain variable region and light chain variable region includes framework region, and the framework region is humanization.
5. the antibody or its antigen-binding portion thereof of anti-thymic stromal lymphopoietin as claimed in claim 4, wherein institute Stating antibody also includes constant region, and the constant region is humanization.
6. the antibody or its antigen of anti-thymic stromal lymphopoietin (TSLP) according to any one of claims 1 to 5 Bound fraction, wherein the activity that the antibody or its antigen-binding portion thereof block TSLP to mediate.
7. the antibody or its antigen-binding portion of anti-thymic stromal lymphopoietin according to any one of claims 1 to 5 Point, wherein the antibody or its antigen-binding portion thereof block the combination of TSLP and TSLPR.
8. a kind of isolated nucleic acid encodes in antibody of any of claims 1-7 or its antigen-binding portion thereof Heavy chain variable region and light chain variable region.
9. a kind of expression vector, it includes isolated nucleic acid according to any one of claims 8.
10. a kind of host cell, it includes expression vectors as claimed in claim 9.
11. a kind of method for producing polypeptide, which comprises
Under conditions of expressing nucleic acid sequence, host cell described in any one of claim 10 is cultivated in the medium, to produce packet Polypeptide containing light chain and heavy chain variable region；With
The polypeptide is recycled from the host cell or culture medium.
12. a kind of composition, it includes antibody of any of claims 1-7 or its antigen-binding portion thereofs and pharmacy Upper acceptable carrier or excipient.
13. a kind of for detecting the kit of the thymic stromal lymphopoietin in Samples subjects, it includes rights to want Ask antibody described in any one of 1-7 or its antigen-binding portion thereof.
14. kit as claimed in claim 13, wherein the subject is mammal.
15. kit as claimed in claim 13, wherein the subject is people.
16. antibody of any of claims 1-7 or its antigen-binding portion thereof, isolated core according to any one of claims 8 Composition described in expression vector sour, as claimed in claim 9 or claim 12 is used for immune system related disease in preparation Or the purposes in the kit of diagnosis, treatment tracking and/or the prognosis inspection of tumor disease.
17. purposes as claimed in claim 16, wherein the immune system related disease is selected from inflammatory and allergia inflammation disease Disease.
18. purposes as claimed in claim 17, wherein the inflammatory and allergic inflammation disease are selected from allergic asthma, allergy Property dermatitis, allergic rhinitis, allergic conjunctivitis, atopic dermatitis fibre modification and inflammatory bowel disease.
19. purposes as claimed in claim 16, wherein the tumor disease be selected from Hodgkin lymphoma, breast cancer, cancer of pancreas, Melanoma and lung cancer.
CN201710532144.5A 2017-07-03 2017-07-03 TSLP monoclonal antibody and its preparation method and application Active CN109206514B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710532144.5A CN109206514B (en) 2017-07-03 2017-07-03 TSLP monoclonal antibody and its preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710532144.5A CN109206514B (en) 2017-07-03 2017-07-03 TSLP monoclonal antibody and its preparation method and application

Publications (2)

Publication Number Publication Date
CN109206514A CN109206514A (en) 2019-01-15
CN109206514B true CN109206514B (en) 2019-10-08

Family

ID=64992709

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710532144.5A Active CN109206514B (en) 2017-07-03 2017-07-03 TSLP monoclonal antibody and its preparation method and application

Country Status (1)

Country Link
CN (1) CN109206514B (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112021024112A2 (en) * 2019-06-04 2022-03-22 Jiangsu Hengrui Medicine Co Antibody capable of binding to thymic stromal lymphopoietin and its use
WO2021043221A1 (en) * 2019-09-04 2021-03-11 Biosion Inc. Antibodies binding tslp and uses thereof
CN111171150B (en) * 2020-02-05 2020-12-08 北京智仁美博生物科技有限公司 Anti-human TSLP antibodies and uses thereof
CN111196850B (en) * 2020-02-07 2020-10-30 北京汇智和源生物技术有限公司 Human thymic stromal lymphopoietin monoclonal antibody and application thereof
CN114437212B (en) * 2020-11-06 2023-03-14 上海麦济生物技术有限公司 Anti-human thymic stromal lymphopoietin antibody and preparation method and application thereof
CN113501878B (en) * 2021-02-03 2022-12-02 北京智仁美博生物科技有限公司 Antibodies against human TSLP and uses thereof
CN115028722A (en) * 2021-03-05 2022-09-09 拜西欧斯（北京）生物技术有限公司 anti-TSLP antibody, preparation method and application thereof
CN113069543B (en) * 2021-06-07 2021-08-06 迈威(上海)生物科技股份有限公司 Liquid composition comprising monoclonal antibodies against thymic stromal lymphopoietin
CN113683694B (en) * 2021-09-03 2022-05-13 江苏荃信生物医药股份有限公司 Anti-human TSLP monoclonal antibody and application thereof
CN117106084B (en) * 2021-12-02 2024-03-22 北京东方百泰生物科技股份有限公司 anti-TSLP monoclonal antibody, antigen binding fragment thereof and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104231081A (en) * 2007-09-10 2014-12-24 安美基公司 Antigen binding proteins capable of binding thymic stromal lymphopoietin

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104231081A (en) * 2007-09-10 2014-12-24 安美基公司 Antigen binding proteins capable of binding thymic stromal lymphopoietin

Also Published As

Publication number Publication date
CN109206514A (en) 2019-01-15

Similar Documents

Publication Publication Date Title
CN109206514B (en) TSLP monoclonal antibody and its preparation method and application
JP6783886B2 (en) Anti-CTLA4 monoclonal antibody or antigen-binding fragment thereof, pharmaceutical composition and use
KR102503084B1 (en) Anti-CTLA4 and anti-PD-1 bifunctional antibodies, pharmaceutical compositions thereof and uses thereof
EP3689909A1 (en) Tigit antibody, antigen-binding fragment thereof, and medical use thereof
JP5631733B2 (en) Anti-EpCAM antibodies and uses thereof
CN110914304B (en) CD96 antibody, antigen binding fragment thereof and medical application
US20230250168A1 (en) Anti-human claudin 18.2 antibody and application thereof
CN111744013B (en) Methods and pharmaceutical combinations for treating diseases using anti-TIGIT antibodies in combination with PD-1 inhibitors
CN107056945A (en) New Regulator and application method
CN112500485B (en) anti-B7-H3 antibody and application thereof
CN109438576A (en) A kind of preparation and its application of anti-human CD47 monoclonal antibody
CN113508139A (en) Antibodies that bind human LAG-3, methods of making, and uses thereof
CN110872349A (en) Antibodies that bind human IL-4R, methods of making, and uses thereof
WO2023125888A1 (en) Gprc5d antibody and application thereof
CN101701039B (en) Variable regions of light chains and heavy chains of FMU-EPCAM-2A9 monoclonal antibodies
CN113906053A (en) anti-CEA antibodies and uses thereof
KR102249981B1 (en) Monoclonal anti-gpc-1 antibodies and uses thereof
CN109651509B (en) Humanized monoclonal antibody for resisting CD20 and preparation thereof
CN113840836A (en) Anti-connective tissue growth factor antibody and application thereof
CN106029094A (en) Novel anti adam17 antibody and its use for the treatment of cancer
CN109593134B (en) Humanized monoclonal antibody against CD20 and preparation thereof
CN115386006A (en) anti-GPRC 5D antibody, preparation method and application thereof
CN115505043A (en) Antibodies specifically binding glycosylated CEACAM5
CN105646712B (en) Monoclonal antibody and its application
CN101988067B (en) Prion isomer monoclonal antibody gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Wei Hui

Inventor after: Liu Liping

Inventor after: Gao Rongkai

Inventor after: Han Huamin

Inventor after: Tian Yujia

Inventor before: Liu Liping

Inventor before: Gao Rongkai

Inventor before: Li Xiaoyu

Inventor before: Han Huamin

Inventor before: Tian Yujia

GR01 Patent grant
GR01 Patent grant