CN109251923B

CN109251923B - Serine racemase mutants

Info

Publication number: CN109251923B
Application number: CN201811229177.3A
Authority: CN
Inventors: 闫博; 田方; 焦华阳
Original assignee: Tianjin Brave Biopharma Technology Co ltd
Current assignee: Tianjin Brave Biopharma Technology Co ltd
Priority date: 2018-10-22
Filing date: 2018-10-22
Publication date: 2021-06-15
Anticipated expiration: 2038-10-22
Also published as: CN109251923A

Abstract

The invention discloses a serine racemase mutant, a mutated serine racemase amino acid sequence, wherein the 162 th amino acid of rice is changed from proline to serine, the carbon end amino acid is cut off, and the nucleotide sequence is optimized so that the serine racemase mutant can be expressed in escherichia coli. The invention modifies serine racemase gene sequence, carries out site-directed mutation and random mutation on the serine racemase gene sequence, improves racemization activity, reduces dehydration activity, improves DL-serine preparation efficiency, reduces product hydrolysis and improves yield. The codons were then optimized for expression in E.coli. Making it suitable for industrial production.

Description

Serine racemase mutants

Technical Field

The invention belongs to the field of bioengineering, and relates to a serine racemase mutant.

Background

Serine is one of the 20 naturally occurring amino acids, commonly referred to as L-serine. DL-serine contains two equal optical isomers, is a key intermediate of a decarboxylase inhibitor benserazide hydrochloride, and is also a raw material for synthesizing a plurality of compounds. The preparation method mainly comprises a protein hydrolysis extraction method, a chemical synthesis method and a biological enzyme catalysis method. Although serine is abundant in some proteins such as sericin, the raw material cost is high and the subsequent separation and purification are difficult to obtain the serine by hydrolyzing the silkworm cocoon skin, so that the total cost is high. The chemical synthesis method for preparing DL-serine involves many reaction steps, complex process and low total reaction yield; the raw materials or intermediate products have toxicity and are not easy to separate, so that the products are difficult to separate and purify and are not environment-friendly; the total cost of chemical synthesis for preparing DL-serine is still high. The enzymatic catalytic preparation of serine generally obtains serine with a single configuration, and then L or D serine is converted into DL-serine by serine racemase. The method has the advantages of low cost, little pollution and low toxicity, but the wild serine racemase is a bifunctional enzyme, has racemization and dehydration activities, and can convert L- \ D-serine into corresponding D- \ L-serine and convert L- \ D-serine into pyruvic acid. The wild racemase has low racemization efficiency and consumes a large amount of the target product due to the existence of dehydration activity.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides a serine racemase mutant, which solves the problems that the racemization efficiency of wild racemase is low and a large amount of target products are consumed by dehydration activity in the prior art.

The technical scheme of the invention is as follows: a serine racemase mutant, wherein the amino acid sequence of the serine racemase mutant is SEQ ID NO. 1.

The serine racemase mutant is characterized in that the 162 th amino acid of the serine racemase is changed into serine from proline, and the carbon terminal amino acid of the serine racemase is cut off.

The invention also provides a gene for coding the serine racemase mutant.

The nucleotide sequence of the gene is SEQ ID NO. 3.

The invention also provides a recombinant expression vector which carries a gene for coding the serine racemase mutant.

The invention also provides a recombinant bacterium which is a host bacterium transformed with a recombinant expression vector carrying the gene encoding the serine racemase mutant.

The host bacterium is escherichia coli.

Compared with the prior art, the invention has the beneficial effects that:

the invention modifies serine racemase gene sequence, carries out site-directed mutation and random mutation on the serine racemase gene sequence, improves racemization activity, reduces dehydration activity, improves DL-serine preparation efficiency, reduces product hydrolysis and improves yield. The codons were then optimized for expression in E.coli. Making it suitable for industrial production.

Detailed Description

The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.

Example 1

Cloning of the serine racemase gene.

1. Firstly, synthesizing a serine racemase gene according to a gene database sequence and designing a primer:

the gene Sequence was biosynthesized in Shanghai with Reference to NCBI Reference Sequence XM-015781742.2, the Sequence being derived from Oryza sativa Japonica Group (SEQ ID NO. 2).

2. The serine racemase gene was amplified by error-prone PCR.

The upstream primer is F1: with BamHI endonuclease recognition site

CATATGGATCCATGGGGAGCAGAGGTGGA, the downstream primer is R1: with HindIII endonuclease recognition site CATATAAGCTTTCAACGTTTATAGAGAGACTC, amplifying the target fragment by using error-prone PCR kit (Beijing Tian Enze). The reaction system is as follows:

reaction procedure: 95 ℃ for 3min

95℃30s

60℃30s

72℃2min

30 cycles

72℃5min

PCR products were recovered using the SanPrep column PCR product purification kit of Shanghai Biotech.

Example 2:

the error-prone PCR product of the serine racemase gene obtained in example 1 was ligated into pET28a-sumo vector.

1. The product of step 2 of example 1 was digested with the restriction enzymes BamHI and HindIII as follows:

the reaction conditions were 37 ℃ for 3 hours. And (3) recovering the enzyme digestion product by using a Shanghai worker SanPrep column type PCR product purification kit.

2. The pET28a-sumo (purchased from Wuhan vast Ling organisms) vector was digested with restriction enzymes BamHI and HindIII as follows:

the reaction conditions were 37 ℃ for 3 hours. And (3) recovering the enzyme digestion product by using a Shanghai worker SanPrep column type PCR product purification kit to obtain the enzyme digested pET28a vector.

3. The first cleavage products obtained in step 1 of this example were ligated with the cleaved pET28a-sumo vector, respectively, using T4DNA ligase. The reaction system is as follows:

the reaction condition is 16 hours at 4 ℃, and the expression vector with the enzyme digestion product is obtained.

Example 3: expressing serine racemase and comparing the expression products of different mutant genes.

The expression vector obtained in step 3 of example 2 was transformed into competent cells of E.coli strain BL 21. The method comprises the following steps:

1.

1.1 sucking 500ul BL21 bacterial liquid, inoculating in 50ml LB liquid culture medium, culturing at 37 deg.C and 180r/min for 2-3h until OD600 reaches about 0.5.

1.2, transferring the bacteria liquid into a 50ml centrifuge tube, and placing the centrifuge tube on ice for 10 min.

The cells were recovered by centrifugation at 4000rpm for 10min at 1.3, 4 ℃.

1.4, abandoning the culture solution and inverting for 1 min.

1.5 adding 10ml of precooled 0.1mol/L CaCl into each 50ml of bacteria produced by the bacteria liquid₂Resuspend the cells, and keep them on ice for 10 min.

The cells were recovered by centrifugation at 4000rpm for 10min at 1.6, 4 ℃.

1.7, abandoning the supernatant and inverting for 1 min.

1.8 adding 2ml of precooled 0.1mol/L CaCl into each 50ml of bacteria produced by the bacteria liquid₂And re-suspending the thallus to obtain competent cells.

1.9 pipette 100ul of competent cells into a 1.5ml sterile centrifuge tube.

1.10, add 10ul of the product of step 3 of example 2 and ice-bath for 30 min.

Water bath at 1.11 and 42 ℃ for 90 s.

1.12, ice bath for 1-2 min.

1.13, adding 400ul LB culture medium without antibiotic, culturing at 37 ℃ for 45 min.

1.14, 5000rpm centrifugation for 3min, suction 300ul of supernatant, with the remaining 200ul of thallus heavy suspension.

1.15, 100ul of the bacterial liquid is sucked and spread on an LB solid culture medium containing 50ng/ml kan resistance to be cultured for 12 h.

1.16, the positive transformants were inoculated into 50ml of liquid LB medium containing 50ng/ml kan, respectively, shake-cultured overnight at 37 ℃ on a shaker, and induced with IPTG at a final concentration of 0.4mM for 4 hours.

1.17, the cells were collected and disrupted by sonication in a 150mM NaCl system with 20mM Tris-HCl (pH 8.5).

2. Purification of serine racemases

2.1 centrifuging the bacteria-breaking solution at 10000rpm for 10 min.

2.2 the centrifuged supernatant was purified by 5mL Ni affinity column at a flow rate of 2mL/min and a volume of 50mL of the disrupted supernatant of the cells produced from the fermentation broth. The sample was eluted with a gradient of 20mM Tris-HCl (pH 8.5), 150mM NaCl, 500mM imidazole, etc., and 2ul Sumo protease was added to the eluted sample to cleave the Sumo tag.

2.3 the digested solution was passed through a 5mL Ni affinity column and passed through the protein of interest.

2.4 the protein concentration was determined by the bradford method using BSA as standard protein.

3. Detection of racemization activity and dehydration activity

3.1 serine racemase Activity assay: 20mM Tris-HCl (pH 8.5),10uM PLP, 10mM L-serine, 1mM CaCl₂1nM FAD, 50ug/mg OPA, 3U/ml D-amino acid oxidase, 3U/ml horseradish catalase, 20ug purified serine racemase, water to make up 500ul, and reacting at 37 deg.C for 60 min. The absorbance of D-serine was measured at 411nm and the optical rotation of the solution was measured.

3.2 dehydratase Activity assay: 20mM Tris-HCl (pH 8.5),10uM PLP, 10mM L-/D-serine, 1mM CaCl₂20ug of purified serine racemase was reacted at 37 ℃ for 60 min. The reaction was stopped with 0.5mL of 2M HCl, 1mL of 2M NaOH was added after 5min, and the absorbance of pyruvate was measured at 520 nm.

4. Sequence analysis

Sequencing the positive transformants inoculated in the liquid medium. Sequence analysis shows that the mutations at the K68 and S93 can lose two enzyme activities, and the change of p (proline) 162 into S (serine) can greatly improve the activity of the racemase and greatly reduce the activity of the dehydratase on the premise of ensuring that the K68 and the S93 are not changed. And the more the C (carbon) terminal mutation, the more the dehydratase activity decreases. Through the analysis, P162 is mutated into S on the basis of the original sequence, and the C end is cut off by 20 amino acids and 40 amino acids. The two sequences are transformed into escherichia coli according to the methods of examples 1-3, and are expressed and purified, and the activity detection shows that the racemization activity of the serine racemase with 20 amino acids cut off by C is improved by 5 times of that of the wild type, and the dehydratase activity is only one tenth of that of the wild type. And the activity of the serine racemase of C cutting off 40 amino acids is also greatly reduced, so that the P at the 162 th site of the mutation is selected as S, the protein sequence of the serine racemase of C cutting off 20 amino acids is the final sequence, and the codon optimization is carried out on the basis, and the sequence is SEQ ID NO. 3.

The sequence was transformed into E.coli by the method of examples 1-3, and the expression and purification were carried out to obtain the high-efficiency serine racemase.

The above description is only a preferred embodiment of the present invention, and all modifications and variations that can be made by the present invention in the specification or directly or indirectly applied to other related technical fields should be considered to be within the scope of the present invention.

<110> Tianjin Boruiwei biomedical science and technology Co

<120> serine racemase mutants

<130>

<160> 3

<170>

<210> 1

<211> 319

<212> PRT

<213> Artificial sequence

<400> 1

Met Gly Ser Arg Gly Gly Ser Gly Gly Asp Gly Ala Glu Ser His Gly

1 5 10 15

Tyr Ala Ala Asp Ile His Ser Ile Arg Glu Ala Gln Ala Arg Ile Ala

20 25 30

Pro Tyr Val His Lys Thr Pro Val Leu Ser Ser Thr Ser Ile Asp Ala

35 40 45

Ile Val Gly Lys Gln Leu Phe Phe Lys Cys Glu Cys Phe Gln Lys Ala

50 55 60

Gly Ala Phe Lys Ile Arg Gly Ala Ser Asn Ser Ile Phe Ala Leu Asp

65 70 75 80

Asp Asp Glu Ala Ser Lys Gly Val Val Thr His Ser Ser Gly Asn His

85 90 95

Ala Ala Ala Val Ala Leu Ala Ala Lys Leu Arg Gly Ile Pro Ala Tyr

100 105 110

Ile Val Ile Pro Arg Asn Ala Pro Ala Cys Lys Val Asp Asn Val Lys

115 120 125

Arg Tyr Gly Gly His Ile Ile Trp Ser Asp Val Ser Ile Glu Ser Arg

130 135 140

Glu Ser Val Ala Lys Arg Val Gln Glu Glu Thr Gly Ala Ile Leu Val

145 150 155 160

His Ser Phe Asn Asn Lys Asn Thr Ile Ser Gly Gln Gly Thr Val Ser

165 170 175

Leu Glu Leu Leu Glu Glu Val Pro Glu Ile Asp Thr Ile Ile Val Pro

180 185 190

Ile Ser Gly Gly Gly Leu Ile Ser Gly Val Ala Leu Ala Ala Lys Ala

195 200 205

Ile Asn Pro Ser Ile Arg Ile Leu Ala Ala Glu Pro Lys Gly Ala Asp

210 215 220

Asp Ser Ala Gln Ser Lys Ala Ala Gly Lys Ile Ile Thr Leu Pro Ser

225 230 235 240

Thr Asn Thr Ile Ala Asp Gly Leu Arg Ala Phe Leu Gly Asp Leu Thr

245 250 255

Trp Pro Val Val Arg Asp Leu Val Asp Asp Ile Ile Val Val Asp Asp

260 265 270

Asn Ala Ile Val Asp Ala Met Lys Met Cys Tyr Glu Met Leu Lys Val

275 280 285

Ala Val Glu Pro Ser Gly Ala Ile Gly Leu Ala Ala Ala Leu Ser Asp

290 295 300

Glu Phe Lys Gln Ser Ser Ala Trp His Glu Ser Ser Lys Ile Gly

305 310 315

<210> 2

<211> 1020

<212> DNA

<213> Artificial sequence

<400> 2

atggggagca gaggtggaag tggcggcgat ggcgcagaaa gccatggcta tgccgcggac 60

atccactcca tcagggaggc gcaggctcgc atcgcaccat acgtgcacaa gacgcccgtt 120

ctgtcatcaa catcgatcga tgccatagtg gggaagcagc tgttcttcaa gtgcgagtgc 180

ttccagaagg caggggcgtt caagatccga ggcgcttcca attcgatatt tgcgcttgat 240

gatgatgagg catccaaggg cgttgtgacg catagcagtg ggaaccatgc tgctgcagtg 300

gctcttgctg caaagctacg cggaatacct gcttacattg tcattccaag aaatgcaccg 360

gcatgtaagg ttgacaatgt taagcggtac ggtggccata ttatctggag tgatgtctcc 420

attgaatcaa gagaatctgt tgctaaaaga gttcaggagg aaactggtgc tattcttgtt 480

cacccattca ataataaaaa cactatcagt ggtcaaggta cagtgtctct cgaacttttg 540

gaggaagtcc ctgaaattga cacaataatt gttccaatca gtggtggtgg tttaatttct 600

ggtgtggcac tggctgccaa ggccataaac ccttcaatac gtattctggc agcagaacca 660

aagggtgctg atgattctgc ccagtccaag gctgctggaa agatcataac attgccttca 720

accaacacca ttgctgatgg acttcgagct tttcttggtg acctgacatg gccggtggtg 780

cgcgacttgg tggatgatat cattgttgtg gatgacaatg ccattgtgga cgccatgaaa 840

atgtgctacg agatgctgaa ggtggctgtt gagccgagtg gagcaatagg cctcgcagcc 900

gccctctctg acgagtttaa gcaaagctct gcttggcatg agagcagtaa gatagggatc 960

attgtttctg gaggcaatgt tgacctcggt gtcctctggg agtctctcta taaacgttga 1020

<210> 3

<211> 960

<212> DNA

<213> Artificial sequence

<400> 3

atggggagcc gtggtggaag tggcggcgat ggcgcagaaa gccatggcta tgccgcggac 60

atccactcca tccgtgaggc gcaggctcgc atcgcaccat acgtgcacaa gacgcccgtt 120

ctgtcatcaa catcgatcga tgccattgtg gggaagcagc tgttcttcaa gtgcgagtgc 180

ttccagaagg caggggcgtt caagatccgt ggcgcttcca attcgatttt tgcgcttgat 240

gatgatgagg catccaaggg cgttgtgacg catagcagtg ggaaccatgc tgctgcagtg 300

gctcttgctg caaagttacg cggaattcct gcttacattg tcattccacg taatgcaccg 360

gcatgtaagg ttgacaatgt taagcggtac ggtggccata ttatctggag tgatgtctcc 420

attgaatcac gtgaatctgt tgctaaacgt gttcaggagg aaactggtgc tattcttgtt 480

cacagcttca ataataaaaa cactatcagt ggtcaaggta cagtgtctct cgaacttttg 540

gaggaagtcc ctgaaattga cacaattatt gttccaatca gtggtggtgg tttaatttct 600

ggtgtggcac tggctgccaa ggccattaac ccttcaattc gtattctggc agcagaacca 660

aagggtgctg atgattctgc ccagtccaag gctgctggaa agatcattac attgccttca 720

accaacacca ttgctgatgg acttcgtgct tttcttggtg acctgacatg gccggtggtg 780

cgcgacttgg tggatgatat cattgttgtg gatgacaatg ccattgtgga cgccatgaaa 840

atgtgctacg agatgctgaa ggtggctgtt gagccgagtg gagcaattgg cctcgcagcc 900

gccctctctg acgagtttaa gcaaagctct gcttggcatg agagcagtaa gattgggtga 960

Claims

1. A serine racemase mutant, wherein the amino acid sequence of the serine racemase mutant is SEQ ID No. 1.

2. A gene encoding the serine racemase mutant according to claim 1.

3. The gene of claim 2, wherein the nucleotide sequence of the gene is SEQ ID No. 3.

4. A recombinant expression vector carrying the gene of claim 2 or 3.

5. A recombinant bacterium which is a host bacterium transformed with the recombinant expression vector according to claim 4.

6. The recombinant bacterium according to claim 5, wherein the host bacterium is Escherichia coli.