CN109234362A - Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample - Google Patents
Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample Download PDFInfo
- Publication number
- CN109234362A CN109234362A CN201811198808.XA CN201811198808A CN109234362A CN 109234362 A CN109234362 A CN 109234362A CN 201811198808 A CN201811198808 A CN 201811198808A CN 109234362 A CN109234362 A CN 109234362A
- Authority
- CN
- China
- Prior art keywords
- cltc
- tfe3
- sample
- probe
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is disclosed for detecting the oligonucleotides of CLTC-TFE3 fusion, method and kit in sample comprising for the upstream and downstream primer and probe of CLTC-TFE3, and for the upstream and downstream primer and probe of β-actin reference gene.The present invention can quickly detect in sample with the presence or absence of CLTC-TFE3 fusion and its expression quantity number.The testing result completed using the present invention is accurate and sensitive, can formulate individualized treatment scheme for mankind Xp11.2 transposition/TFE3 fusion correlation patients with renal cell carcinoma auxiliary.
Description
Technical field
The invention belongs to bioscience and field of biotechnology, in particular to CLTC-TFE3 is merged in a kind of detection sample
Method, oligonucleotides and the kit of gene detect mankind Xp11.2 transposition/TFE3 fusion phase using Fluorescence PCR assay
The expression of CLTC-TFE3 fusion in closing property patients with renal cell carcinoma body.
Background technique
Xp11.2 transposition/TFE3 Gene Fusion associated renal cell carcinoma (abbreviation Xp11.2 transposition kidney) is newest understanding
A kind of different subtypes renal cell carcinomas, take place mostly in teenager, clinical rare, grade malignancy is higher.There is the site Xp11.2 with genome
Balanced translocation, formed TFE3 fusion, height expression TFE3 fusion protein with the characteristics of.Xp11.2 transposition kidney is lost in molecule
It passes, treatment and prognosis etc. and differs markedly from other clear-cell carcinomas, the country recognizes the type kidney also very limited at present.
At least 8 kinds of fusion involved in Xp11.2 transposition kidney, but only 5 kinds at present of clear site, point
It Wei not t (x；17)(p11.2；Q25) chromosome translocation forms ASPL-TFE3 fusion；t(x；1)(p11.2；Q21 it) dyes
Body transposition forms PRCC-TFE3 fusion；inv(x)(p11；Q12) chromosome translocation forms NonO-TFE3 fusion；
t(x；1)(p11.2；P34) chromosome translocation forms PSF-TFE3 fusion；t(x；17)(p11.2；Q23) chromosome is easy
Position forms CLTC-TFE3 fusion.t(x；3)(p11.2；Q23) pattern of fusion kidney, t (x；10)(p11.2；Q23) pattern of fusion
Kidney and t (x；19)(p11.2；Q13.1) the not yet clear chromosome translocation site of pattern of fusion kidney.Every Xp11.2 transposition kidney
Cancer only has single translocated forms.
The translocated forms of Xp11.2 transposition kidney are different, their grade malignancy is also different.Research has shown that compare t
(x；1), t (x；17) the Xp11.2 transposition kidney prognosis that transposition is formed is poor.ASPL-TFE3 positive Xp11.2 transposition kidney
Invasion is most strong, and prognosis is worst, the characteristic that tumour has delay to recur, and long term follow-up is very necessary.
Xp11.2 transposition kidney disease incidence is low, clinical rare, and people lack its biological behaviour, clinical disease course enough
Understanding.Its biological behaviour is different from the difference of biological behaviour between the mechanism of common kidney, different transposition tumor types
Also imperfectly understand.As clinician, Pathology Doctors ' are to the attention of the type tumour and cytogenetics, molecular Biological Detection
The progress of method, more and more Xp11.2 transposition kidneys are detected, and people, which recognize it, to deepen continuously.
CLTC-TFE3 fusion detection common technology have immunohistochemistry, fluorescence in situ hybridization technique (FISH), in real time
The methods of quantitative PCR technique (RQ-PCR).Immunohistochemical staining nucleus TFE3 protein positive is considered Xp11.2 transposition kidney
The characteristic markers of cancer, the sensibility of diagnosis are 97.5%, and specificity is 99.6%.But recent is some research shows that people
Seem that having over-evaluated TFE3 albumen acts on Xp11.2 transposition Diagnosis of Renal Cell Carcinoma.Prompt nucleus TFE3 albumen should not become Xp11.2
The marker of transposition kidney only prompts Xp11.2 transposition kidney possibility big, makes a definite diagnosis and still rely upon cytogenetic.Fluorescence
Hybridization in situ technique (FISH) can detect TFE3 gene rearrangement, and rapid sensitive, specificity are good, research sample is required it is low, can be
Retrospective analysis is carried out on paraffin sample, in recent years by high praise, TFE3 separation probe is more considered as diagnosis Xp11.2 transposition
Property the most perfect mode of kidney, but the test process of FISH detection is cumbersome, and it is various to be related to reagent type, time-consuming and laborious, and ties
Fruit needs seasoned professional to carry out interpretation, and there are biggish subjectivities for as a result interpretation.Real-time quantitative PCR (RQ-PCR)
The expression of detection TFE3 fusion gene mRNA can also be used for the diagnosis of the tumour.Common method has SYBR Green in RQ-PCR
I dye method, double probe hybrid methods and Taqman technology etc..Wherein SYBR GreenI is due to being non-saturable dye, and specificity is not
Such as double probe hybrid methods and Taqman method, it is necessary to judge its specificity by observation solubility curve；And two probe method hybridizes
Method cost again costly.In Taqman technology, RQ-PCR use Taqman fluorescence probe quantitative technology, integrative biology,
Zymetology and fluorescence chemical carry out under PCR reaction tube closed state from amplification to interpretation of result in one, solve PCR production
The problem of object pollutes and leads to false positive, while susceptibility is also improved, result is indicated with copy number, is realized and is produced to PCR
The accurate quantitative analysis of object is easy to seek unity of standard, and compared with qualitative PCR technology, has specificity good, and high sensitivity, linear relationship is good,
It is easy to operate, it is high degree of automation, anti-pollution, there is the biggish range of linearity.
Summary of the invention
The present invention devises detection internal reference/target gene primer, probe sequence, using fluorescent quantitative PCR technique, utilizes
The method of double standard curves constructs the quantitation curves of reference gene β-actin and target gene CLTC-TFE3, inspection respectively
Survey expression of the target gene CLTC-TFE3 relative to reference gene β-actin.By adjusting target gene and reference gene
Primed probe ratio and PCR reaction condition, reach amplification efficiency and rate most preferably, so as to meet CLTC-
The detection of TFE3 fusion, for evaluating therapeutic effect, prediction prognosis.
" CLTC-TFE3 cDNA sequence " in the present invention refers to what CLTC-TFE3 fusion generated after transcribing
The cDNA sequence that mRNA is generated after reverse transcription, or directly synthesized according to this cDNA sequence by chemical synthesis means.
Reverse transcription will whether be passed through or passing through the CLTC-TFE3 cDNA sequence that chemical synthesis means directly generate is inserted into properly
Plasmid after, can be used as positive reference substance carry out using.
The present invention is provided to detect the oligonucleotides of CLTC-TFE3 fusion in sample, the oligonucleotides includes:
For the upstream and downstream primer and probe of CLTC-TFE3, base sequence is respectively SEQ ID NO:1,2 and 3.
Further, the oligonucleotides further includes the upstream and downstream primer and probe for β-actin reference gene, alkali
Basic sequence is respectively SEQ ID NO:4,5 and 6.
The present invention also provides a kind of methods of CLTC-TFE3 fusion in detection sample, and the method includes following steps
It is rapid:
(1) RNA in sample is extracted；
(2) the RNA reverse transcription for extracting (1) is cDNA；
(3) cDNA described in (2) is added into reaction tube, utilizes the upstream and downstream primer and probe for being directed to CLTC-TFE3
The fluorescence signal of the CLTC-TFE3 fusion in sample is detected, base sequence is respectively SEQ ID NO:1,2 and 3；It utilizes
For the fluorescence signal of the β-actin reference gene in the upstream and downstream primer and probe in detecting sample of β-actin reference gene,
Base sequence is respectively SEQ ID NO:4,5 and 6；
(4) fluorescence signal of the fluorescence signal of the CLTC-TFE3 fusion in basis (3) and β-actin reference gene,
Determine the relative expression quantity of the CLTC-TFE3 fusion in sample.
The present invention also provides a kind of kits of CLTC-TFE3 fusion in detection sample, and the kit includes inspection
Survey system PCR reaction solution, the detection architecture PCR reaction solution include: the upstream and downstream primer and probe for CLTC-TFE3,
Base sequence is respectively SEQ ID NO:1,2 and 3.
Further, the primer and probe further includes the upstream and downstream primer and probe for β-actin reference gene,
Base sequence is respectively SEQ ID NO:4,5 and 6.
Further, the kit further includes positive reference substance, negative controls and blank control product, and the positive is right
It is the positive plasmid solution containing CLTC-TFE3 cDNA sequence according to product, the negative controls are without containing CLTC-TFE3
The plasmid solution of cDNA sequence, the blank control product is physiological saline or any substance is not added.
Further, the kit further includes that sample rna extracts reagent, and the sample rna extracts reagent and includes
TRIzol, chloroform, isopropanol, 75% ethyl alcohol and RNase-free water.
Further, it further includes erythrocyte cracked liquid that the sample rna, which extracts reagent, and the erythrocyte cracked liquid includes 16
μm ol/L ammonium chloride, 1mmol/L sodium bicarbonate and 12.5 μm of ol/L EDTA-Na2。
Beneficial effects of the present invention: real-time fluorescent PCR technology is combined and uses Taqman probe, utilizes double standard curves
Method constructs the quantitation curves of reference gene β-actin and CLTC-TFE3 target gene respectively, detects in testee's body
The expression of CLTC-TFE3.Compared to detection means such as previous FISH and △ △ CT methods, this method has accuracy height, as a result
The advantages that convenient for interpretation.In addition primer needed for reaction system, probe are carried out rational proportion and optimization by this method, make to test item
Part reaches most preferably, so that eliminating cumbersome condition gropes link, greatly improves conventional efficient.This method is specific after tested
Good, high sensitivity is easy to operate, can provide for the treatment of mankind Xp11.2 transposition/TFE3 fusion correlation patients with renal cell carcinoma
With reference to and foundation, facilitate the formulation of Personalized medicine scheme.
Detailed description of the invention
Fig. 1 is amplification curve diagram of the PMD18-T/CLTC-TFE3 positive plasmid under various concentration.
Fig. 2 be PMD18-T/CLTC-TFE3 positive plasmid as standard items the manufactured standard drawing under various concentration.
Fig. 3 is the amplification curve diagram of 100 copies/ μ L PMD18-T/CLTC-TFE3 positive plasmids.
Fig. 4 is the amplification curve diagram of 10 blood samples.
Fig. 5 is the amplification curve diagram of 10 nephridial tissue samples.
Specific embodiment
Combined with specific embodiments below and attached drawing, the present invention is further explained.It should be noted that not specified in embodiment
Normal condition and method, usually routinely use method according to fields experimenter: for example, Ao Sibai and James Kingston chief editor
" fine works molecular biology experiment guide " fourth edition, or according to step proposed by manufacturer and condition.
Embodiment 1
For detecting the oligonucleotides of CLTC-TFE3 fusion in sample, the oligonucleotides includes: for CLTC-
The upstream and downstream primer and probe of TFE3, base sequence are respectively SEQ ID NO:1,2 and 3.
Further, the oligonucleotides further includes the upstream and downstream primer and probe for β-actin reference gene, alkali
Basic sequence is respectively SEQ ID NO:4,5 and 6.
A kind of method of CLTC-TFE3 fusion in detection sample, the described method comprises the following steps:
(1) RNA in sample is extracted；
(2) the RNA reverse transcription for extracting (1) is cDNA；
(3) cDNA described in (2) is added into reaction tube, utilizes the upstream and downstream primer and probe for being directed to CLTC-TFE3
The fluorescence signal of the CLTC-TFE3 fusion in sample is detected, base sequence is respectively SEQ ID NO:1,2 and 3；It utilizes
For the fluorescence signal of the β-actin reference gene in the upstream and downstream primer and probe in detecting sample of β-actin reference gene,
Base sequence is respectively SEQ ID NO:4,5 and 6；
(4) fluorescence signal of the fluorescence signal of the CLTC-TFE3 fusion in basis (3) and β-actin reference gene,
Determine the relative expression quantity of the CLTC-TFE3 fusion in sample.
The kit of CLTC-TFE3 fusion in a kind of detection sample, the kit include detection architecture PCR reaction
Liquid, the detection architecture PCR reaction solution include: the upstream and downstream primer and probe for CLTC-TFE3, and base sequence is respectively
SEQ ID NO:1,2 and 3.
Further, the oligonucleotides further includes the upstream and downstream primer and probe for β-actin reference gene, alkali
Basic sequence is respectively SEQ ID NO:4,5 and 6.
Further, the kit further includes positive reference substance, negative controls and blank control product, and the positive is right
It is the positive plasmid solution containing CLTC-TFE3 cDNA sequence according to product, the negative controls are without containing CLTC-TFE3
The plasmid solution of cDNA sequence, the blank control product is physiological saline or any substance is not added.
The detection architecture PCR reaction solution of the kit further includes THNDERBIRD Probe qPCR Mix (2 ×)
(TOYOBO company).
The kit may also include sample extraction reagent, the optional self-organizing RNA extraction agent of sample extraction reagent
And/or blood rna extraction agent.Organize the commercially available commercialization reagent from companies such as TOYOBO and QIAGEN of RNA extraction agent
Box can also be prepared voluntarily certainly；Blood rna extraction agent includes erythrocyte cracked liquid, TRIzol, chloroform, isopropanol, 75% second
Pure and mild RNase-free water, wherein erythrocyte cracked liquid includes 16 μm of ol/L ammonium chlorides, 1mmol/L sodium bicarbonate and 12.5 μ
mol/L EDTA-Na2.Certainly, blood rna extraction agent also buys the commercialization reagent from companies such as TOYOBO and QIAGEN
Box.
The kit may also include RNA reverse transcription reagents, and the RNA reverse transcription reagents can be prepared voluntarily, also be can purchase
From the commercial kit of the companies such as TOYOBO, such as the Rever Tra Ace qPCR RT Kit kit of TOYOBO company.
The base sequence of last NO:1~6 primer and probe SEQ ID used in the present invention is as shown in table 1.
The sequence of 1. primer and probe of table
| Primer, probe/primer, probe | Sequence number | Sequence/Sequence (5 ' → 3 ') |
| CLTC-TFE3-F | SEQ ID NO:1 | TGCCACGCCTTGACTACTGT |
| CLTC-TFE3-R | SEQ ID NO:2 | GCCAATGTGATCTGGAACTTATTAA |
| CLTC-TFE3-Probe | SEQ ID NO:3 | FAM-ACACATCAAGCAGATTCCCTGACACA-TAMRA |
| β-actin-F | SEQ ID NO:4 | TGAGCGAGGCTACAGCTT |
| β-actin-R | SEQ ID NO:5 | TCCTTGATGTCGCGCACGATTT |
| β-actin-Probe | SEQ ID NO:6 | FAM-ACCACCACGGCCGAGCGG-TAMRA |
Embodiment 2
The operating process of the method for the present invention:
(1) it extracts the tissue RNA in blood: being added in the centrifuge tube of clean 1.5ml red thin in 1ml embodiment 1
Cellular lysate liquid takes anticoagulation 0.5ml to mix, is stored at room temperature 10min；5000rpm is centrifuged 5min, abandons supernatant, collects the thin of bottom
Born of the same parents；The erythrocyte cracked liquid in 0.5ml embodiment 1 is added again, 5000rpm is centrifuged 5min, abandons supernatant, collects the thin of bottom
Born of the same parents；1ml TRIzol is added into cell, piping and druming is completely dissolved until precipitating repeatedly, the static 5min of room temperature；0.2ml chlorine is added
Imitative, concussion is uniform；4 DEG C of centrifugation 10min of 14000rpm, absorption supernatant layer are transferred in another new centrifuge tube and (not draw white
Color middle layer)；Isometric isopropanol is added, mixes well up and down, is stored at room temperature 10min；4 DEG C of 14000rpm centrifugations
10min abandons supernatant, and 75% ethyl alcohol 1ml is added, gently turns upside down and washs tube wall；4 DEG C of centrifugation 5min of 14000rpm abandon second
Alcohol；20ulRNase-free water dissolution precipitating is added in drying at room temperature 10-15min.
In addition, also can extract the RNA of nephridial tissue sample, preparation method are as follows: cutting tissue or scraping paraffin slide sample
This is added 1ml transparency of organization liquid (the Hangzhou mountain Xi Nai Biotechnology Co., Ltd) in 1.5ml centrifuge tube, after oscillation mixes
13000rpm is centrifuged 1min；Supernatant is removed, is added 500ml transparency of organization liquid (the Hangzhou mountain Xi Nai Biotechnology Co., Ltd), vibration
13000rpm is centrifuged 1min after swinging mixing；Supernatant is removed, 1ml dehydrated alcohol is added, 13000rpm is centrifuged 1min after oscillation mixes；
Supernatant is removed, 37 DEG C of metal baths to drying is placed in and (uncaps)；Addition 150ul PKD buffer (RNeasy FFPE KIT is come from,
QIAGEN company), oscillation mixes；10ul PK (coming from RNeasy FFPE KIT, QIAGEN company) is added, turns upside down mixed
It is even；In 56 DEG C of metal baths 15min, rear 80 DEG C of metal bath 15min；After placing 3min on ice, 13200rpm is centrifuged 15min, draws
Supernatant is managed to new 1.5ml EP, and DNase Booster buffer (coming from RNeasy FFPE KIT, QIAGEN company) is added
Low-speed centrifugal after 16ul and DNase1 (coming from RNeasy FFPE KIT, QIAGEN) 10ul oscillation mix, is stored at room temperature 15min；
It is mixed that addition 720ul dehydrated alcohol after 320ul RBC buffer (coming from RNeasy FFPE KIT, QIAGEN company) is mixed is added
It is even；700ul back liquid, 10000rpm is added into chromatographic column (coming from RNeasy FFPE KIT, QIAGEN company)
15s discards liquid in pipe, and remaining liquid is added into chromatographic column, and 10000rpm 15S discards liquid in pipe；Into chromatographic column
500ul RPE buffer (coming from RNeasy FFPE KIT, QIAGEN company) is added, 10000rpm 15s discards waste liquid；To
500ul RPE buffer, 10000rpm 2min are added in chromatographic column, discards waste liquid, opens lid, is centrifuged 5min at full speed；It will
Chromatographic column is placed in new 1.5ml EP pipe, and 30ul DEPC water is added into chromatographic column, after standing 2min, is centrifuged 1min at full speed.It adopts
With (being purchased from Thermo Scientific company) the detection RNA concentration of NanoDrop 2000 and purity, -30 DEG C are saved backup.
(2) prepared by cDNA:, will with reference to the Rever Tra Ace qPCR RT Kit kit specification of TOYOBO company
(1) RNA prepared in is reversed to cDNA.
(3) preparation of reagents: each X ul of detection architecture PCR reaction solution is configured by detection person-portion number, every person-portion 23ul is dispensed, such as
Shown in table 2:
X=23ul reaction solution × (8 parts of internal references (standard curve)+8 parts of target gene (standard curve)+1 part of sun of+n parts of samples
Property control+1 part of blank control of+1 part of negative control)；
2 CLTC-TFE3 reaction system of table
Wherein Forward Primer, Reverse Primer and Taqman Probe be respectively selected from CLTC-TFE3-F,
CLTC-TFE3-R and CLTC-TFE3-Probe β-actin-F, β-actin-R and β-actin-Probe.
(4) it is loaded: the cDNA2 μ l prepared in the detection architecture PCR reaction solution and step (2) prepared in (3) is added
Into the hole of 96 orifice plates or reaction tube；Positive control and negative control directly add 2 μ l positive reference substances and negative controls；It is empty
Any substance is not added in white control plus 2 μ l physiological saline.
(5) detect: detection carries out on real-time fluorescence PCR instrument, can include ABI7300,7500 (U.S. Appl with instrument
Ied Biosystems company) etc..Reaction condition: 95 DEG C of initial denaturation 1min；95 DEG C of 15s, 58 DEG C of 35sec 40 circulations, fluorescence
Signal acquires when 58 DEG C of 35sec.
(6) result judges: threshold line is adjusted to more than background signal and negative amplification line, system according to standard curve and
Ct value calculates copy number automatically.
1) when the internal reference positive, testing result just thinks effective；
2) positive judgment criteria: Ct < 36, for the positive；35≤Ct≤38 are the doubtful positive, need to verify again；Ct >
38, for feminine gender.
The detection of 3 positive plasmid of embodiment and sensitivity technique
When preparing positive plasmid, first directly synthesize CLTC-TFE3 cDNA, then be inserted respectively into the matter selected in advance
In grain plasmid (being illustrated by taking PMD18-T plasmid as an example here), PMD18-T/CLTC-TFE3 positive matter can be thus prepared
Grain.
The PMD18-T/CLTC-TFE3 positive plasmid prepared is subjected to gradient dilution, obtaining copy number is 108、107、
106、105、104、103、102The positive plasmid of copies/ μ l, and using the positive plasmid of these various concentrations as template, by real
Apply example 2 to be detected, as a result as shown in Figure 1, wherein in Fig. 1 the corresponding positive plasmid concentration of each amplification curve from a left side to
The right side is respectively 108、107、106、105、104、103、102copies/uL.As shown in Figure 1, CLTC-TFE3 and β-actin rises
Line, primer and probe of the invention can be used to detect PMD18-T/CLTC-TFE3 positive plasmid.Then, with the sun of various concentration
Property grain logarithm is made as abscissa with carrying out detected Ct value by embodiment 2 by the positive plasmid of every kind of concentration
For ordinate, standard curve is drawn, as a result as shown in Figure 2.The calculation shows that, the slope of the standard curve in Fig. 2 are -3.51,
Amplification efficiency is 92.75%, it can be seen that the discovery present invention can reach requirement to the amplification efficiency of positive plasmid.
By 102、101、100The PMD18-T/CLTC-TFE3 positive plasmid of copies/ μ l is detected by embodiment 2, often
The positive plasmid of kind various concentration repeats detection 10 times, as a result as shown in figure 3, from the figure 3, it may be seen that the present invention is to this positive plasmid
Monitoring lower-cut be 100copies.
Embodiment 4 detects clinical blood sample
Peripheral blood sample number 10 for fetching and delivering inspection extract sample rna, reagent preparation by 2 the method for embodiment and detect.
2ul in detection architecture PCR reaction solution is added in every sample.Positive, negative and blank control, reference gene/purpose base are done simultaneously
Each portion of the standard curve of cause.Show the internal reference base of all samples in 10 clinical samples for the testing result of this 10 samples
Because of the equal initial line of β-actin, reference gene CLTC-TFE3 not initial line, this illustrates that this 10 samples are all CLTC-TFE3 feminine genders
's.Experimental result is as shown in table 3 and fig. 4.
3 10 clinical blood sample CLTC-TFE3mRNA expressions of table
Embodiment 5 detects clinical nephridial tissue sample
Nephridial tissue sample number 10 for fetching and delivering inspection extract sample rna, reagent preparation by 2 the method for embodiment and detect.
2ul in detection architecture PCR reaction solution is added in every sample.Positive, negative and blank control, reference gene/purpose base are done simultaneously
Each portion of the standard curve of cause.Show the internal reference base of all samples in 10 clinical samples for the testing result of this 10 samples
Because of the equal initial line of β-actin, reference gene CLTC-TFE3 not initial line, this illustrates that this 10 samples are all CLTC-TFE3 feminine genders
's.Experimental result is as shown in table 4 and fig. 5.
4 10, table clinical nephridial tissue sample CLTC-TFE3 mRNA expressions
Sequence table
<110>Beijing Ai Dikang Laboratory of medical test Co., Ltd
<120>oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample are detected
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tgccacgcct tgactactgt 20
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gccaatgtga tctggaactt attaa 25
<210> 3
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
acacatcaag cagattccct gacaca 26
<210> 4
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
tgagcgaggc tacagctt 18
<210> 5
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
tccttgatgt cgcgcacgat tt 22
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
accaccacgg ccgagcgg 18
Claims (8)
1. for detecting the oligonucleotides of CLTC-TFE3 fusion in sample, which is characterized in that the oligonucleotides includes:
For the upstream and downstream primer and probe of CLTC-TFE3, base sequence is respectively SEQ ID NO:1,2 and 3.
2. oligonucleotides according to claim 1, which is characterized in that the oligonucleotides further includes in β-actin
Join the upstream and downstream primer and probe of gene, base sequence is respectively SEQ ID NO:4,5 and 6.
3. a kind of method of CLTC-TFE3 fusion in detection sample, which is characterized in that the described method comprises the following steps:
(1) RNA in sample is extracted；
(2) the RNA reverse transcription for extracting (1) is cDNA；
(3) cDNA described in (2) is added into reaction tube, utilizes the upstream and downstream primer and probe in detecting for being directed to CLTC-TFE3
The fluorescence signal of CLTC-TFE3 fusion in sample, base sequence are respectively SEQ ID NO:1,2 and 3；Using being directed to
The fluorescence signal of β-actin reference gene in the upstream and downstream primer and probe in detecting sample of β-actin reference gene, base
Sequence is respectively SEQ ID NO:4,5 and 6；
(4) it according to the fluorescence signal of the fluorescence signal of the CLTC-TFE3 fusion in (3) and β-actin reference gene, determines
The relative expression quantity of CLTC-TFE3 fusion in sample.
4. the kit of CLTC-TFE3 fusion in a kind of detection sample, the kit include detection architecture PCR reaction
Liquid, which is characterized in that the detection architecture PCR reaction solution includes: the upstream and downstream primer and probe for CLTC-TFE3, alkali
Basic sequence is respectively SEQ ID NO:1,2 and 3.
5. kit according to claim 4, which is characterized in that the primer and probe further includes in β-actin
Join the upstream and downstream primer and probe of gene, base sequence is respectively SEQ ID NO:4,5 and 6.
6. kit according to claim 4, which is characterized in that the kit further includes positive reference substance, negative right
According to product and blank control product, the positive reference substance is the positive plasmid solution containing CLTC-TFE3cDNA sequence, the feminine gender
Reference substance is the plasmid solution without containing CLTC-TFE3cDNA sequence, and the blank control product are physiological saline or are not added any
Substance.
7. kit according to claim 4, which is characterized in that the kit further includes that sample rna extracts reagent, institute
Stating sample rna and extracting reagent includes TRIzol, chloroform, isopropanol, 75% ethyl alcohol and RNase-free water.
8. kit according to claim 7, which is characterized in that it further includes that red blood cell is split that the sample rna, which extracts reagent,
Liquid is solved, the erythrocyte cracked liquid includes 16 μm of ol/L ammonium chlorides, 1mmol/L sodium bicarbonate and 12.5 μm of ol/L EDTA-Na2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811198808.XA CN109234362A (en) | 2018-10-15 | 2018-10-15 | Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811198808.XA CN109234362A (en) | 2018-10-15 | 2018-10-15 | Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109234362A true CN109234362A (en) | 2019-01-18 |
Family
ID=65053512
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811198808.XA Pending CN109234362A (en) | 2018-10-15 | 2018-10-15 | Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109234362A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2742324A1 (en) * | 2008-10-30 | 2010-06-03 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Methods for assessing rna patterns |
| WO2012018613A2 (en) * | 2010-07-26 | 2012-02-09 | The Johns Hopkins University | Genetic make-up modifies cancer outcome |
| CN102676663A (en) * | 2012-04-27 | 2012-09-19 | 杭州艾迪康医学检验中心有限公司 | Nucleic acid detection kit for detecting BRCA1mRNA |
| CA2944717A1 (en) * | 2014-05-23 | 2015-11-26 | Genentech, Inc. | Mit biomarkers and methods using the same |
| CN108315422A (en) * | 2018-04-08 | 2018-07-24 | 南京鼓楼医院 | A kind of CLTC-TFEB fusions and its detection primer and application |
| CN109321640A (en) * | 2018-10-15 | 2019-02-12 | 南京艾迪康医学检验所有限公司 | Detect oligonucleotides, method and the kit of PSF-TFE3 fusion in sample |
-
2018
- 2018-10-15 CN CN201811198808.XA patent/CN109234362A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2742324A1 (en) * | 2008-10-30 | 2010-06-03 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Methods for assessing rna patterns |
| WO2012018613A2 (en) * | 2010-07-26 | 2012-02-09 | The Johns Hopkins University | Genetic make-up modifies cancer outcome |
| CN102676663A (en) * | 2012-04-27 | 2012-09-19 | 杭州艾迪康医学检验中心有限公司 | Nucleic acid detection kit for detecting BRCA1mRNA |
| CA2944717A1 (en) * | 2014-05-23 | 2015-11-26 | Genentech, Inc. | Mit biomarkers and methods using the same |
| CN108315422A (en) * | 2018-04-08 | 2018-07-24 | 南京鼓楼医院 | A kind of CLTC-TFEB fusions and its detection primer and application |
| CN109321640A (en) * | 2018-10-15 | 2019-02-12 | 南京艾迪康医学检验所有限公司 | Detect oligonucleotides, method and the kit of PSF-TFE3 fusion in sample |
Non-Patent Citations (3)
| Title |
|---|
| PEDRAM ARGANI等: "A novel CLTC-TFE3 gene fusion in pediatric renal adenocarcinoma with t(X;17)(p11.2;q23)", 《ONCOGENE》 * |
| 宋善俊等: "《白血病》", 31 May 2004, 湖北科学技术出版社 * |
| 李自刚等: "《生物检测技术》", 31 August 2016 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107523647A (en) | Detect the LncRNA combinations of early stage cancer of the esophagus prognosis situation and the kit containing the combination | |
| CN109576370A (en) | Biomarker and detection kit for Diagnosis of Bladder and recurrence monitoring | |
| CN108315429A (en) | The primer and kit of EML4-ALK fusions are detected based on vesica | |
| US10370720B2 (en) | Kit and method for detecting bladder cancer | |
| CN107881239A (en) | The miRNA marker related to colorectal cancer transfer and its application in blood plasma | |
| CN110699454A (en) | Oligonucleotide, method and kit for detecting relative expression quantity of MLL5 gene in sample | |
| CN105274100B (en) | People's TWIST1/Vimentin gene methylation detects marker and kit | |
| CN104694623A (en) | Plasma miRNA marker for diagnosis of lung cancer and application | |
| Sugawara et al. | Excessive survivin expression in thyroid lymphomas | |
| CN105648075A (en) | Liver cancer diagnosis composition and kit containing same | |
| CN109371126A (en) | Detect oligonucleotides, method and the kit of TFE3 fusion in sample | |
| CN106636334A (en) | MicroRNA marker group and applications thereof in preparing kit for detecting lymph node metastasis of gastric carcinoma | |
| CN106755309A (en) | Application of the molecular marked compound in cancer of pancreas prognosis evaluation product is prepared | |
| CN109234362A (en) | Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample | |
| CN112391478B (en) | Application of exosome mRNA in diagnosis of breast diseases | |
| CN109136379A (en) | Detect oligonucleotides, method and the kit of NonO-TFE3 fusion in sample | |
| JP2011511635A (en) | Colon cancer associated transcription factor 1 (CCAT-1) as a cancer marker | |
| CN114921531A (en) | Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer | |
| CN109321640A (en) | Detect oligonucleotides, method and the kit of PSF-TFE3 fusion in sample | |
| CN103436621B (en) | Method and kit for quickly detecting expression quantity of CK19 mRNA (messenger ribonucleic acid) | |
| Bozhenko et al. | Mammaglobin in peripheral blood and the tumor of breast cancer patients | |
| CN108728543B (en) | MiRNA combination for detecting lung cancer brain metastasis and kit containing same | |
| WO2009067903A1 (en) | Method for detecting the expression of cyclin b2 gene by real-time quantitative pcr | |
| CN105506131A (en) | Primer pair for detecting people AEG-1 gene expression quantity and relative expression quantity | |
| CN109136380A (en) | Detect oligonucleotides, method and the kit of ASPL-TFE3 fusion in sample |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190118 |
|
| RJ01 | Rejection of invention patent application after publication |