CN114921531A - Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer - Google Patents
Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer Download PDFInfo
- Publication number
- CN114921531A CN114921531A CN202210646485.6A CN202210646485A CN114921531A CN 114921531 A CN114921531 A CN 114921531A CN 202210646485 A CN202210646485 A CN 202210646485A CN 114921531 A CN114921531 A CN 114921531A
- Authority
- CN
- China
- Prior art keywords
- mir
- treatment
- lung cancer
- small cell
- cell lung
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention relates to the technical field of biological detection, in particular to application of exosome RNA in curative effect evaluation of RTK inhibitors on advanced non-small cell lung cancer. The exosome RNA provided by the invention is selected from at least one of miR-34a-5p, miR-27b-5p and PRKAR 2B. Research data of the invention show that the misadjustment phenomenon of miRNA and mRNA exists in the course of the anitinib treatment, and the up-and-down regulation trends in the effective stage and the ineffective stage of the treatment are opposite. Also, deregulated RNA is involved in multiple cancer-related pathways and biological processes, such as the prostate cancer pathway, the pancreatic cancer pathway, the cell adhesion pathway, the IL-17 pathway, and the like. Based on the drug resistance problem of the anitinib in the treatment process, the invention explores the biomarker for evaluating the treatment response of the anitinib and provides scientific reference for further improving the curative effect of the anitinib in the non-small cell lung cancer.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to application of exosome RNA in curative effect evaluation of an RTK inhibitor for treating late non-small cell lung cancer.
Background
Lung cancer is the leading cause of cancer-related death worldwide, with non-small cell lung cancer accounting for 80-85% of all lung cancers, the most common lung cancer type. Non-small cell lung cancer refers to malignant tumors derived from bronchial mucosal epithelium or alveolar epithelium, and can be classified into adenocarcinoma, squamous cell carcinoma and large cell carcinoma according to the pathological types. Over the past two decades, non-small cell lung cancer has made significant progress in the treatment of non-small cell lung cancer, with the primary therapeutic modalities being radiation therapy, chemotherapy, targeted therapy, immunotherapy, and the like. The use of small molecule tyrosine kinase inhibitors also provides unprecedented survival benefits for the treatment of patients with advanced non-small cell lung cancer. However, the overall cure rate and survival rate of patients remains low and the problem of drug resistance of anitinib is not negligible, except for the metastatic nature of the disease. Therefore, the determination of biomarkers that can be used to assess the clinical response to nilotinib in patients with advanced non-small cell lung cancer is an urgent problem to be solved to improve clinical outcomes.
Receptor Tyrosine Kinases (RTKs) are transmembrane glycoproteins that communicate with cellular growth factors and extracellular ligands. RTK activation mediates a number of important physiological processes including cell proliferation, cell growth, cell migration, cell differentiation, and apoptosis, among others. In addition, RTKs are associated with a variety of pathological conditions, including cancer, autoimmune diseases, infectious diseases, neurodegenerative diseases, and the like. To date, targeted RTK inhibitors have been successfully used to treat a variety of cancer types. The erlotinib is a newly developed inhibitor of an oral small molecule RTK target Vascular Endothelial Growth Factor Receptor (VEGFR), platelet-derived growth factor receptor (PDGFR), Fibroblast Growth Factor Receptor (FGFR) and the like. Compared with other RTK inhibitors, the nilotinib can inhibit more targets. Ambrtinib treatment can prolong the median Progression Free Survival (PFS) and median Overall Survival (OS) of refractory advanced non-small cell lung cancer receiving three or more lines of treatment, the underlying mechanism of which may be attributed to ambrtinib-induced angiogenesis block.
A multicenter, double-blind, phase III randomized clinical trial named ALTER 0303 evaluated the efficacy and safety of anitinib in the treatment of advanced non-small cell lung cancer. PFS was significantly increased in the placebo group compared to placebo patients, but OS was only prolonged by 3.3 months. The test data show that the drug resistance phenomenon inevitably occurs in the course of clinical treatment of the nilotinib, the overall life cycle of a patient is not obviously improved, and the anti-angiogenesis treatment only plays a transient role. That is, despite the considerable efficacy and controlled tolerability of erlotinib in non-small cell lung cancer, its efficacy and potential molecular mechanisms remain to be fully characterized.
The exosome is rich in biological signals such as DNA, RNA, protein and the like, serves as a messenger between cells, and plays an important role in the occurrence and development of tumors. Research has now demonstrated that exosomes are potential molecular biomarkers of lung cancer. A large number of researches report that miRNA and mRNA participate in the processes of generation, development, metastasis, drug resistance and the like of tumors, show the potential of miRNA as a cancer biomarker, and influence the processes of tumor immunity, microenvironment and the like by regulating the miRNA, wherein the processes may influence the growth, invasion, angiogenesis and drug resistance of tumors. Furthermore, they are present in human plasma in a very stable and cell-independent form, which makes them a new non-invasive biomarker for physiological and pathological conditions (including cancer) and receives increasing attention. In view of the correlation between the exosome RNA and the non-small cell lung cancer progression, the exosome RNA is expected to be used as a curative effect evaluation marker of the non-small cell lung cancer.
While the erlotinib shows effectiveness in the treatment of non-small cell lung cancer, the drug resistance problem in the later period of cancer treatment is inevitably faced. Therefore, it is crucial for the assessment of efficacy throughout the dynamic course of a patient receiving an nilotinib therapy. The invention aims to find a plasma exosome marker for evaluating the curative effect of the aniotinib on the non-small cell lung cancer, so as to evaluate the curative effect of anti-angiogenesis treatment, help a clinician to timely replace a treatment scheme to control the disease development, and bring good news for effective treatment and survival of a patient.
Disclosure of Invention
The invention aims to effectively evaluate the treatment effect of an RTK inhibitor, namely, nilotinib on non-small cell lung cancer and improve the curative effect of the nilotinib on the non-small cell lung cancer.
The invention is obtained by experimental exploration and can be used for evaluating the biomarker of the curative effect of the amboinib treatment, and the biomarker comprises at least one of the following exosome RNAs: miR-34a-5p, miR-27b-5p and PRKAR 2B.
The invention uses the whole transcriptome sequencing technology to detect the expression change condition of the plasma exosome RNA of the late-stage non-small cell lung cancer patient in the course of receiving the erlotinib treatment, and constructs an exosome RNA expression profile for evaluating the curative effect of the erlotinib treatment on the late-stage non-small cell lung cancer. Exosome miRNA and mRNA markers for predicting the therapeutic efficacy of the anitinib are provided through screening.
In a first aspect, the invention claims the use of an exosome RNA, which is any one of miR-34a-5p, miR-27b-5p, PRKAR2B, in the assessment of the efficacy of a RTK inhibitor in the treatment of advanced non-small cell lung cancer.
The exosomes may be collected from body fluids including blood, cerebrospinal fluid, saliva, breast milk, urine, and the like.
In the application provided by the invention, the detection primer of the miR-34a-5p is shown as SEQ ID NO. 1-2; the detection primer of the miR-27b-5p is shown in SEQ ID NO. 3-4; the detection primer of PRKAR2B is shown in SEQ ID NO. 5-6.
In a second aspect, the present invention claims the use of exosome RNAs in the preparation of a reagent or kit for assessing the efficacy of an RTK inhibitor in the treatment of advanced non-small cell lung cancer; the exosome RNA is any one of miR-34a-5p, miR-27b-5p and PRKAR 2B.
In the above application provided by the present invention, the RTK inhibitor is angutinib; the advanced non-small cell lung cancer comprises one or more of adenocarcinoma, squamous carcinoma and large cell carcinoma.
In the application provided by the invention, if the output value of miR-34a-5p, miR-27b-5p or PRKAR2B is lower than the output value of a control group which does not receive the anitinib treatment, the curative effect of a patient with non-small cell lung cancer is good in the process of taking the anitinib treatment.
In a third aspect, the invention provides a primer for evaluating the treatment effect of the aniotinib, and the sequence of the primer is shown as SEQ ID NO.1-2, SEQ ID NO.3-4 or SEQ ID NO. 5-6.
In a fourth aspect, the invention provides a kit for assessing the efficacy of Arotinib in treating advanced non-small cell lung cancer; which contains a reagent for detecting the expression level of miR-34a-5p, miR-27b-5p or PRKAR 2B.
The kit provided by the invention comprises detection primers shown as SEQ ID NO.1-2, SEQ ID NO.3-4 or SEQ ID NO. 5-6; also comprises an upstream primer and a downstream primer for detecting the reference gene; preferably, the reference genes include U6 and GAPDH.
In a fifth aspect, the invention provides a method for evaluating the curative effect of the anitinib on the advanced non-small cell lung cancer, wherein the primer or the kit is used for detecting the expression level of miR-34a-5p, miR-27b-5p or PRKAR2B and comparing the expression level with a control group which does not receive the anitinib treatment;
preferably, the comparison is: normalizing the expression level of miR-34a-5p, miR-27b-5p or PRKAR2B by using an internal reference gene; carrying out logistic regression treatment on the expression level values of the normalized miR-34a-5p, miR-27b-5p or PRKAR2B to obtain output values of miR-34a-5p, miR-27b-5p or PRKAR 2B; comparing the output value of miR-34a-5p, miR-27b-5p or PRKAR2B with the output value of a control group which does not receive the anirtib treatment, if the output value of miR-34a-5p, miR-27b-5p or PRKAR2B is lower than the output value of the control group, the curative effect of the patient with non-small cell lung cancer is good in the process of taking the anirtib treatment.
The method provided by the invention can be used for researching drug resistance of the nilotinib in patients with advanced non-small cell lung cancer or drug research for treating the non-small cell lung cancer for non-diagnosis purposes; for diagnostic purposes, it can be used to know the health status of patients during the course of the ambrotinib treatment of advanced non-small cell lung cancer.
As a specific embodiment of the present invention, a method for evaluating the efficacy of aniotinib in treating advanced non-small cell lung cancer, comprising:
(1) collecting a body fluid sample of an object to be detected;
(2) extracting and separating exosomes from the body fluid sample in the step (1);
(3) extracting exosome RNA;
(4) detecting the expression levels of miR-34a-5p, miR-27b-5p or PRKAR2B and the reference gene and carrying out differential expression analysis.
Specifically, in the qRT-PCR detection result of the exosome miRNA (miR-34a-5p and miR-27b-5p), when the output value is lower than that of a control (not receiving the anitinib treatment), the curative effect of the patient in the process of treating the non-small cell lung cancer by oral anitinib is good.
In the qRT-PCR detection result of exosome mRNA (PRKAR2B), when the output value is lower than that of a control (not receiving the treatment of the anitinib), the patient is proved to have good curative effect in the process of treating the non-small cell lung cancer by oral anitinib; when the output value is obviously higher than that of a control (not receiving the anitinib treatment), the problem of drug resistance and the like of the patient is possibly caused, and the curative effect is poor.
The invention has the beneficial effects that:
(1) the invention is focused on the curative effect evaluation of the patient in the whole dynamic process of receiving the anitinib treatment, provides scientific basis for the clinician to select or change the treatment scheme in time, controls the disease development and brings important clinical value for the effective treatment of the patient.
(2) The invention provides scientific reference for evaluating whether the drug resistance problem is faced in the process of treating the non-small cell lung cancer by the erlotinib and/or judging the curative effect of the erlotinib.
(3) The invention aims to find the plasma exosome RNA marker for evaluating the curative effect of the anitinib on treating the non-small cell lung cancer, reflects the clinical effect of the anitinib through accurate and efficient curative effect evaluation, is beneficial to timely finding the drug resistance phenomenon of a patient, and has important clinical application value.
Drawings
Figure 1 is a volcano plot of differential expression of exosome mirnas screened using whole transcriptome sequencing in comparison of pre-treatment group (G1) and treatment-effective group (G2).
Figure 2 is a screen of differentially expressed volcano plots of exosome mirnas in comparison of the therapeutically effective (G2) and therapeutically ineffective (G3) groups using whole transcriptome sequencing.
Figure 3 is a screen of differentially expressed volcano plots of exosome mrnas in comparison of the pre-treatment group (G1) and the treatment-effective group (G2) using whole transcriptome sequencing.
Figure 4 is a screening of differentially expressed volcanoes of exosome mrnas in comparison of the treatment-effective (G2) and treatment-ineffective (G3) groups using whole transcriptome sequencing.
Figure 5 is a Venn diagram screening for exosome mirnas useful for assessing an anitinib therapeutic response, where each circle in the Venn diagram represents the number of exosome mirnas differentially expressed between two different groups and their deregulation trends.
Fig. 6 is a Venn diagram of screening for exosome mrnas useful for assessing aniotinib therapeutic response, where each circle in the Venn diagram represents the number of exosome mrnas differentially expressed between two different groups and their dysregulation trends.
Fig. 7 is a graph of the results of analysis of Biological Processes (BP) in GO enrichment of deregulated plasma exosome mirnas.
Fig. 8 is a graph of the results of analysis of Cell Components (CCs) in GO enrichment of deregulated plasma exosome mirnas.
Fig. 9 is a graph of the results of analysis of Molecular Function (MF) in GO enrichment of dysregulated plasma exosome mirnas.
Figure 10 is a graph of the results of analysis of Biological Processes (BP) in GO enrichment of dysregulated plasma exosome mRNA.
FIG. 11 is a graph of the results of analysis of Cell Components (CC) in GO enrichment for dysregulated plasma exosome mRNA.
Figure 12 is a graph of the results of analysis of Molecular Function (MF) in GO enrichment of dysregulated plasma exosome mrnas.
Figure 13 is a graph of KEGG enrichment analysis results for dysregulated plasma exosome mirnas.
FIG. 14 is a graph of the results of a KEGG enrichment assay of dysregulated plasma exosome mRNA.
FIG. 15 is a real-time fluorescent quantitative PCR validation analysis of candidate exosomes miR-34a-5p in advanced non-small cell lung cancer patients, wherein the graph shows the relative expression levels of miR-34a-5p in two comparisons of baseline _ vs _ sensitivity and sensitivity _ vs _ resistance.
FIG. 16 is a real-time fluorescent quantitative PCR validation analysis of candidate exosomes miR-27b-5p in advanced non-small cell lung cancer patients, wherein the graph shows the relative expression levels of miR-27b-5p in two comparisons of baseline _ vs _ sensitivity and sensitivity _ vs _ resistance.
Figure 17 is a real-time fluorescent quantitative PCR validation analysis of candidate exosomes PRKAR2B in advanced non-small cell lung cancer patients, wherein the figure shows the relative expression levels of PRKAR2B in two comparisons of baseline _ vs _ sensitivity, sensitivity _ vs _ resistance.
FIG. 18 is a schematic diagram showing the correlation between candidate exosomes miR-34a-5p and survival prognosis.
FIG. 19 is a diagram showing the correlation between candidate exosome miR-27b-5p and survival prognosis.
FIG. 20 is a schematic representation of the correlation of candidate exosomes PRKAR2B with survival prognosis.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. It is intended that all modifications or alterations to the methods, procedures or conditions of the present invention be made without departing from the spirit and substance of the invention.
Unless otherwise specified, the experimental materials, reagents, instruments and the like used in the examples of the present invention are commercially available; unless otherwise specified, all technical means in the examples of the present invention are conventional means well known to those skilled in the art.
The term "non-small cell lung cancer" in the present invention may refer to adenocarcinoma, squamous carcinoma, large cell carcinoma.
The term "RNA molecule marker" is an RNA molecule associated with a particular disease, indication or trait that can be used to indicate that particular disease, indication or trait. In the invention, the RNA molecular marker is used for indicating the treatment effect of the non-small cell lung cancer, and therefore, the RNA molecular marker can be used as the RNA molecular marker of the non-small cell lung cancer.
The erlotinib is erlotinib hydrochloride, is an oral selective targeted drug, belongs to a novel small molecule multi-target tyrosine kinase inhibitor, and has the effects of resisting tumor angiogenesis and inhibiting tumor growth.
Volcanoes (volcanolplot) is a type of image used to show data of differences between groups, commonly found in RNA expression profiling and data analysis of chips. In the present invention, it is used to analyze the differential expression of genes.
The Venn (Veen) diagram, also called the Venn diagram, is used to show a graphical representation of the overlapping area of a set of elements. In the invention, the method is used for displaying the quantity of the exosome RNA which is differentially expressed among different groups (a pre-treatment group, a treatment effective group and a treatment ineffective group) and the dysregulation trend of the exosome RNA, and then screening candidate exosome RNA which can be used for evaluating the therapeutic response of the nilotinib.
The GO database is called Gene Ontology, and the database divides the functions of genes into three parts, namely: biological Processes (BP), Cellular Components (CC), Molecular Functions (MF). GO analysis has a prompting effect on experimental results, GO classification items enriching differential genes can be found through GO analysis on the differential genes, and the differential genes of different samples are searched to be possibly related to changes of gene functions.
The KEGG (Kyoto Encyclopedia of Genes and genomes) database is the main public database for pathway. By obtaining database resources, the enrichment statistics of the deregulated genes in the KEGG pathways may be detected.
The KM method, product-limit method, is the most commonly used method for survival analysis at present, and is proposed by Kaplan and Meier in 1958, so it is called Kaplan-Meier method, often abbreviated as KM method.
Example 1 patient enrollment and sample Collection
This example provides a patient grouping and sample collection process as follows:
the study procedure of this example was a retrospective, non-interventional clinical study.
The inventive examples were conducted in accordance with the principles promulgated by Helsinki and approved by the ethical Committee of the affiliated Hongyun Hospital, Xuzhou medical university (ethical No.: IKY-20210429002-01). All patients had signed written informed consent. During the period from 3 months to 5 months 2021 in 2019, a total of 48 advanced non-small cell lung cancer patients participated in the study, of which 5 patients participated in screening candidate exosome markers and 43 patients participated in the subsequent marker validation study. The relevant information of the patient is obtained by inquiring the medical record of the hospitalization and the telephone follow-up.
The grouping standard is as follows: (1) male and female aged > 18 years old; (2) the non-small cell lung cancer is diagnosed by histology or cytology, the clinical stage is IIIB/IV (judged according to 7 th edition of the national Lung cancer research Association breast tumor staging handbook), and the medicine is ineffectively treated or cannot tolerate by a two-line standard and accords with the anitinib indication; (3) the expected life span exceeds 3 months, and the condition of admission and reexamination every 1-2 months is provided, and the curative effect of treatment can be evaluated according to RECIST 1.1 standard; (4) the ECOG score is an indicator of a patient's general health and ability to tolerate treatment from their physical strength. The ECOG score of patients in group must be ≦ 2; (5) the blood system was in good condition.
Exclusion criteria were: (1) (ii) suffers from other malignancies; (2) blood transfusion was performed in approximately 2 weeks; (3) any severe or uncontrolled systemic disease that significantly affects the patient's risk-benefit balance, including uncontrolled hypertension, hepatitis b, hepatitis c, aids, rheumatic immune disease, etc.; (4) the blood system state is poor, and bleeding tendency exists; (5) for various reasons, baseline data (treatment information, imaging data, etc.) is not complete.
Collecting a blood sample: 10mL of peripheral blood samples were collected using EDTA K2 anticoagulation tubes before, when, and when the Arotinib treatment was effective, respectively, for the patients in the cohort. Efficacy evaluations were performed with reference to RECIST 1.1, with SD/PR/CR as the criterion for evaluating efficacy of treatment and PD as the criterion for ineffectiveness of treatment.
Example 2 screening for differentially expressed exosome RNAs using whole transcriptome sequencing
This example provides a process for screening for differentially expressed exosome RNAs using whole transcriptome sequencing, as follows.
Whole transcriptome analysis data profile: the results of the complete transcriptome analysis of the RNA profiles of the plasma exosomes of the non-small cell lung cancer patients before the anitinib treatment (G1), effective in the treatment (G2) and ineffective in the treatment (G3) through an Illumina Hiseq platform show that the RNA profiles of the plasma exosomes of the non-small cell lung cancer patients all show different degrees of change in the treatment process of the anitinib. By comparison with the human genome, in this sequencing, a total of 1168 known mirnas and 100 new mirnas were identified, and a total of 15711 mrnas were identified, wherein 15157 known mrnas and 554 potentially unknown mrnas.
Primary screening of differentially expressed exosome mirnas: 359.76MRaw Reads were finally obtained by small RNA sequencing, averaging 23.98M Raw Reads for each sample. Clean data was mapped to the human genome, yielding a total of 1268 mirnas. Before differential expression analysis is carried out by using the edgeR software, samples to be detected are grouped, and the grouping information is shown in table 1.
TABLE 1 grouping of samples
The screening criteria for differential mirnas were: TPM > 10; log2(FC) | ≧ 0.58; p Value ≦ 0.05. Through analysis, 22 miRNAs which are significantly and differentially expressed between the treatment front group and the treatment effective group are found, wherein 13 miRNAs of the treatment effective group are significantly up-regulated compared with the treatment front group, and 9 miRNAs are significantly down-regulated, which is specifically shown in figure 1. In addition, 29 mirnas were significantly differentially expressed between the treatment effective group and the treatment ineffective group, and compared with the treatment effective group, 17 mirnas were significantly up-regulated and 12 mirnas were significantly down-regulated in the treatment ineffective group, as shown in fig. 2.
Primary screening for differentially expressed exosome mrnas: according to the mRNA sequencing result, the mRNA which is differentially expressed in the serum of the pre-treatment group and the serum of the effective treatment group are analyzed by using the edgeR software (the screening standard: FPKM is more than 5; | log2(FC) | is ≧ 0.58; P Value is ≦ 0.05), 518 remarkably differentially expressed mRNAs are obtained, wherein the 518 mRNA is up-regulated and 357 is down-regulated, and the specific scheme is shown in FIG. 3. In comparison of the treatment-effective group and the treatment-ineffective group, 121 mRNAs were screened in total. Compared with the treatment-effective group, the number of mrnas significantly up-regulated in the treatment-ineffective group was 56, and the number of mrnas significantly down-regulated was 65, as shown in fig. 4.
Example 3 screening of candidate exosome markers
This example provides a process of screening candidate exosome markers as follows.
(1) Screening for exosome mirnas and mrnas useful for assessing anitinib therapeutic responses
The basic idea for screening candidate exosome markers useful for assessing an nilotinib therapeutic response is: the screening was carried out by using exosome RNAs which are common in two groups of differential expression analyses (G1_ vs _ G2/G2_ vs _ G3) but have opposite up-and-down-regulation trends, namely, exosome RNAs which are differentially expressed before the treatment effective stage and before the treatment ineffective stage and are also differentially expressed when the treatment ineffective stage is effective, and the differential expression trends of the exosome RNAs in the two different treatment effect stages are opposite and dynamically changed. According to the differential expression analysis and the screening result of differential RNA, combined with Venn diagram, 7 miRNAs and 83 mRNAs were found to be differentially expressed in two groups of comparison G1_ vs _ G2/G2_ vs _ G3, and the up-and-down trend in the treatment effective stage and the treatment ineffective stage is opposite, as shown in FIG. 5 and FIG. 6.
(2) Screening candidate exosome miRNAs and mRNAs
Research results show that the 7 miRNAs and 83 mRNAs are differentially expressed in the treatment process of the erlotinib, and show dynamic changes due to opposite up-down regulation trends in different curative effect stages, so that the 7 miRNAs and the 83 mRNAs are possibly molecular markers for evaluating the curative effect of the erlotinib of the non-small cell lung cancer patient. By removing RNAs with too low expression values and too large differences in groups, 7 miRNAs and 7 mRNAs are finally selected as candidate exosome RNAs and are subjected to subsequent verification, which is specifically shown in Table 2.
Table 2 list of candidate exosome mirnas and mrnas
Example 4 GO enrichment of dysregulated plasma exosome RNA
This example provides a GO enrichment process of dysregulated plasma exosome RNA as follows.
By using the GO database, the target gene can be obtained, which is mainly related to the cell components, molecular functions and biological processes. GO analysis has a prompting effect on an experimental result, GO classification items enriching differential genes can be found through GO analysis on the differential genes, and the differential genes of different samples are searched to be possibly related to changes of gene functions. The invention carries out GO enrichment analysis on the screened dysregulated exosome RNA (7 miRNA and 83 mRNA) which can be used for evaluating the therapeutic response of the anitinib. The main analytical results are as follows:
(1) GO analysis of deregulated exosome miRNAs
Through GO enrichment analysis, the deregulated miRNA is found to be involved in various biological processes and cellular components. For example, in the biological process, the cell components forming or biosynthesis, organic matter biosynthesis, primary metabolic process regulation, cell metabolic process regulation, biological development process, cell stress response, and the like are significantly enriched, and specifically, as shown in fig. 7, the horizontal axis represents an enrichment factor, and the larger the enrichment factor, the larger the enrichment degree. The vertical axis represents the GO entry for major enrichment of deregulated miRNA. The dotted color represents p value, the redder the color represents a higher degree of enrichment; the size of the dots indicates the number of gene enrichments, and larger dots indicates a larger number of genes. Significant enrichment of cellular components involved are intracellular components, intracellular organelles, cytoplasm, etc., as shown in fig. 8. The molecular function is significantly enriched by cell junction, molecular function, protein binding and the like, and is specifically shown in fig. 9.
(2) GO analysis of dysregulated exosome mRNA
The present invention performs GO enrichment analysis of deregulated mRNA. The biological processes with remarkable enrichment comprise cell activation, immune system, granulocyte activation and the like, and are specifically shown in figure 10; the cellular components include secretory granules, secretory vesicles, secretory granule membranes, and the like, as shown in fig. 11. In the molecular function, protein synthesis, enzyme synthesis, cell adhesion linkage, and the like are significantly enriched, as shown in fig. 12.
Example 5 KEGG enrichment of dysregulated plasma exosome RNAs
This example provides a KEGG enrichment process for dysregulated plasma exosome RNAs, as follows.
The KEGG (Kyoto Encyclopedia of Genes and genomes) database is the main public database for pathway. By obtaining database resources, the enrichment statistics of the deregulated genes in the KEGG pathways may be detected. By KEGG enrichment analysis of deregulated miRNA and mRNA, many different pathways were found to be associated with deregulated miRNA, with multiple pathways involved in tumorigenesis development, such as pancreatic cancer pathway, colorectal cancer pathway, prostate cancer pathway, and p53 signaling pathway, etc., as shown in fig. 13. Deregulated mRNA is also associated with multiple pathways, such as the cell adhesion pathway, parathyroid hormone synthesis and secretion pathway, the renin-angiotensin system, the IL-17 signaling pathway, and the like, as shown in particular in fig. 14.
Example 6 confirmatory analysis of candidate exosome RNAs in advanced non-small cell lung cancer patients
This example provides a validated analysis of candidate exosome RNAs in advanced non-small cell lung cancer patients, as follows.
In the potential stage of verifying candidate exosome miRNA and mRNA as biomarkers for evaluating the efficacy of the anitinib, 43 patients with random advanced non-small cell lung cancer were enrolled, and 46 plasma samples were collected together and grouped as follows: blood samples from patients who did not receive androtinib (baseline sample) 16; patients who received at least 1 cycle of anrotinib treatment had 30 blood samples and were classified into sensitivity group (SD/PR/CR, n-16) and resistance group (PD, n-14) according to the criteria of evaluation of Recist 1.1. Two sets of comparisons were also made during the test, baseline _ vs _ sensitivity, and sensitivity _ vs _ resistance, respectively. The relative expression levels of these candidate exosome RNAs in the two above-mentioned group comparisons were assayed using real-time fluorescent quantitative PCR technology.
The qRT-PCR detection system (RNA detection system based on a fluorescent quantitative PCR platform) of candidate exosome RNA is as follows:
(1) plasma exosome and plasma exosome total RNA extraction
Plasma exosome separation was performed using either the Qiagen commercial ExoEasy kit or Exosuurur, Inc. of Enzekangtai, Beijing, by
The Mini kit extracts total RNA from the isolated exosomes. RNA concentration and purity were assessed by the RNA Nano 6000Assay Kit of the Agilent Bioanalyzer 2100 System.
(2) Reverse transcription system
Reverse transcription reaction and qRT-PCR detection were carried out using PrimeScriptRT reagent Kit (Perfect Real Time) and PremixEx TaqTM (Probe qPCR) Kit from TAKARA.
The reverse transcription reaction system was prepared (prepared on ice) according to the composition and amount shown in Table 3. Putting the mixture into a PCR instrument for reaction under the reaction conditions of 37 ℃ for 60min, 85 ℃ for 5s and 12 ℃ infinity. After the program was run, 50. mu.L of DEPC H2O was added to dilute the solution and 3uL was used as a template for qRT-PCR.
TABLE 3 reverse transcription reaction System
(3) qRT-PCR reaction system
The primer for detecting the exosome RNA molecular marker comprises the following components:
the upstream primer and the downstream primer for detecting miR-34a-5p are respectively shown as SEQ ID NO: 1. SEQ ID NO. 2;
the upstream primer and the downstream primer for detecting miR-27b-5p are respectively shown as SEQ ID NO: 3. SEQ ID NO. 4;
the upstream and downstream primers for detecting PRKAR2B are respectively shown in SEQ ID NO: 5. SEQ ID NO. 6;
the upstream primer and the downstream primer for detecting the reference gene U6 are respectively shown as SEQ ID NO: 7. SEQ ID NO. 8;
the upstream and downstream primers for detecting the reference gene GAPDH are respectively shown in SEQ ID NO: 9. SEQ ID NO 10. All the above primer sequences are shown in Table 4.
TABLE 4 primer sequence information
| Sequence numbering | Name of primer | Primer sequence (5'- -3') |
| SEQ ID NO:1 | miR-34a-5p-F | TCAGTGGCAGTGTCTTAGCT |
| SEQ ID NO:2 | miR-34a-5p-R | GTGCAGGGTCCGAGGT |
| SEQ ID NO:3 | miR-27b-5p-F | ACCGAAGAGCTTAGCTGATTG |
| SEQ ID NO:4 | miR-27b-5p-R | GTGCAGGGTCCGAGGT |
| SEQ ID NO:5 | PRKAR2B-F | CACAAGGCGTGCCTCAG |
| SEQ ID NO:6 | PRKAR2B-R | ATGGCATCTAATACTTGAGACATCT |
| SEQ ID NO:7 | U6-F | CTCGCTTCGGCAGCACA |
| SEQ ID NO:8 | U6-R | AACGCTTCACGAATTTGCGT |
| SEQ ID NO:9 | GAPDH-F | TCAGCCGCATCTTCTTTTGC |
| SEQ ID NO:10 | GAPDH-R | GCCCAATACGACCAAATCCG |
The qPCR reaction system was prepared according to the composition shown in table 5 (prepared on ice) and a no template control was set as a negative control. Placed in a real-time fluorescent PCR instrument (ABI7500) and amplified according to the reaction conditions of Table 6.
TABLE 5qRT-PCR reaction systems
TABLE 6qRT-PCR reaction conditions
(4) qRT-PCR verification of differentially expressed candidate exosome miRNA results
Carrying out qRT-PCR verification differential expression detection on the extracted plasma exosome RNA according to the steps (1) to (3), respectively detecting Ct values of 4 candidate exosome miRNAs (miR-34a-5p, miR-27b-5p, miR-203a-3p and miR-150-5p) and internal reference U6 selected in the table 2, and according to the Ct values and a relative quantitative formula 2 -ΔΔCt Fold change in relative expression was analyzed computationally.
The results show that the expression level of miR-34a-5p in the sensitivity group is obviously reduced (p <0.001) compared with the baseline group; compared with the sensitivity group, the expression level in the resistance group is not increased significantly, as shown in fig. 15. The expression level of miR-27b-5p in the sensitivity group is obviously reduced (p <0.05) compared with that of the Baseline group, and the expression level in the resistance group is increased compared with that of the sensitivity group, but the difference has no statistical significance, and is particularly shown in figure 16. The expression level change of the 2 exosome miRNAs in the verification process is consistent with that in the sequencing stage, but the difference is not statistically significant. The expression level changes of miR-203a-3p and miR-150-5p are inconsistent with those in the sequencing stage.
(5) qRT-PCR validation of differentially expressed candidate exosome mRNA results
Carrying out qRT-PCR (quantitative reverse transcription-polymerase chain reaction) verification differential expression detection on the extracted plasma exosome RNA according to the steps (1) to (3), respectively detecting Ct values of 7 candidate exosome mRNA molecular markers and internal reference GAPDH in the table 2, and according to the Ct values and a relative quantitative formula 2 -ΔΔCt Fold change in relative expression was analyzed computationally. Among them, 2 mRNAs (TSC22D1, HIST2H2BE) were not detected in the expression level. The detection results of PRKAR2B, SUSD1 and TRAPPC1 show that the expression level of the 3 mRNAs in the sensitivity group is reduced but not significant compared with the baseline group; compared with the sensitivity group, the expression level in the resistance group is increased, but only PRKAR2B is statistically different (p)<0.01), as shown in fig. 17 in detail. The expression level changes of HIST1H3H and STOM are inconsistent with the sequencing stage, and the difference is not statistically significant.
Example 7 prognostic assay for survival of candidate exosome RNAs
This example attempted the survival prognosis analysis of large samples using the TCGA (the cancer Genome atlas) database to initially investigate the relationship between candidate exosome RNAs and clinical prognosis. In the embodiment, 2 miRNAs (miR-34a-5p, miR-27b-5p) and 1 mRNA (PRKAR2B) with the expression level change consistent with the sequencing stage and part of statistical significance in the qRT-PCR verification process are selected for the exploration of survival prognosis analysis.
This example downloads RNA expression data for lung adenocarcinoma and lung squamous carcinoma as well as progression free survival data for patients in TCGA. For each RNA, the patients were ranked from high to low in the expression level of RNA and evenly divided into high-expression group and low-expression group, i.e., high-risk group and low-risk group. Through Kaplan-Meier survival curves, the low-expression groups of the genes have longer progression-free survival periods but have no statistical significance for differences (the average p is greater than 0.05) compared with the non-small cell lung cancer patients of the high-expression miR-27b-5p and PRKAR2B groups, and the results are particularly shown in FIG. 19 and FIG. 20; in contrast, the miR-34a-5p high expression group has long progression-free survival time and low expression group, and also has no statistical significance (p >0.05), as shown in FIG. 18.
The results of the above embodiments show that the exosome RNA molecular markers miR-34a-5p, miR-27b-5p and PRKAR2B provided by the invention can be potential markers for evaluating the curative effect and/or drug resistance of the erlotinib, and have a certain correlation with clinical prognosis.
Plasma exosome RNA molecular markers miR-34a-5p, miR-27b-5p and PRKAR2B are dysregulated in the process of receiving the nilotinib treatment in a non-small cell lung cancer patient. Experiments prove that in a non-small cell lung cancer patient receiving the ambrtinib to treat effectively, the expression of miR-34a-5p is obviously reduced (p is less than 0.001); miR-27b-5p was identified in the study as significantly down-regulated in therapeutically effective non-small cell lung cancer patients (p < 0.05); during the validation process, PRKAR2B was also found to be significantly upregulated in the treatment-ineffective patients. The TCGA database is used for carrying out survival analysis on candidate exosome RNA with expression level change consistent with a sequencing stage in a verification process in a large sample amount, and data show that the level of expression of deregulated RNAs (miR-27b-5p, miR-34a-5p and PRKAR2B) has influence on the progression-free survival period of a lung cancer patient, but does not have statistical difference.
The invention has the advantages that on one hand, the research is a prospective research, and the research content provides scientific reference for evaluating whether the drug resistance problem is faced in the process of treating the non-small cell lung cancer by the aniotinib and/or judging the curative effect of the aniotinib. On the other hand, in the screening and verification research of the whole marker, the invention focuses on the curative effect evaluation of the patient in the whole dynamic process of receiving the anitinib treatment, provides scientific basis for the clinician to select or timely replace the treatment scheme, controls the disease development and brings important clinical value for the effective treatment of the patient. Preferably, the present invention shows plasma exosome RNA expression changes in advanced non-small cell lung cancer patients receiving nilotinib therapy.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Beijing Enzekangtai Biotechnology Ltd, first-person Hospital, Linyun harbor
<120> application of exosome RNA in curative effect evaluation of RTK inhibitor on treatment of advanced non-small cell lung cancer
<130> KHP221116808.9
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtgcagggtc cgaggt 16
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
accgaagagc ttagctgatt g 21
<210> 4
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gtgcagggtc cgaggt 16
<210> 5
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cacaaggcgt gcctcag 17
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atggcatcta atacttgaga catct 25
<210> 7
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ctcgcttcgg cagcaca 17
<210> 8
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ctcgcttcgg cagcaca 17
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
Claims (10)
1. Application of exosome RNA in curative effect evaluation of RTK inhibitors for treating advanced non-small cell lung cancer, wherein the exosome RNA is any one of miR-34a-5p, miR-27b-5p and PRKAR 2B.
2. The use of claim 1, wherein the detection primer of miR-34a-5p is represented by SEQ ID No. 1-2; the detection primer of the miR-27b-5p is shown in SEQ ID NO. 3-4; the detection primer of PRKAR2B is shown in SEQ ID NO. 5-6.
3. The application of exosome RNA in preparing a reagent or a kit for evaluating the curative effect of an RTK inhibitor on treating advanced non-small cell lung cancer; the exosome RNA is any one of miR-34a-5p, miR-27b-5p and PRKAR 2B.
4. The use of any one of claims 1-3, wherein the RTK inhibitor is Arotinib; the advanced non-small cell lung cancer comprises one or more of adenocarcinoma, squamous carcinoma and large cell carcinoma.
5. The use of claim 4, wherein the output of miR-34a-5p, miR-27b-5p or PRKAR2B is lower than the output of a control group not receiving the Arotinib treatment, which indicates that the non-small cell lung cancer patient has good therapeutic effect during administration of the Arotinib treatment.
6. The primer for evaluating the therapeutic effect of the aniotinib is characterized by having a sequence shown as SEQ ID NO.1-2, SEQ ID NO.3-4 or SEQ ID NO. 5-6.
7. A kit for assessing the efficacy of erlotinib for treatment of advanced non-small cell lung cancer; which contains a reagent for detecting the expression level of miR-34a-5p, miR-27b-5p or PRKAR 2B.
8. The kit according to claim 7, wherein the kit comprises detection primers shown as SEQ ID No.1-2, SEQ ID No.3-4 or SEQ ID No. 5-6; also comprises an upstream primer and a downstream primer for detecting the reference gene; preferably, the reference genes include U6 and GAPDH.
9. A method for assessing the efficacy of anitinib in treating advanced non-small cell lung cancer, which is not diagnostic, characterized in that the primer of claim 6 or the kit of any one of claims 7 to 8 is used to detect the expression level of miR-34a-5p, miR-27b-5p or PRKAR2B, and the expression level is compared with a control group which does not receive anitinib treatment;
preferably, the comparison is: normalizing the expression level of miR-34a-5p, miR-27b-5p or PRKAR2B by using an internal reference gene; carrying out logistic regression treatment on the expression level values of the normalized miR-34a-5p, miR-27b-5p or PRKAR2B to obtain output values of miR-34a-5p, miR-27b-5p or PRKAR 2B; comparing the output value of miR-34a-5p, miR-27b-5p or PRKAR2B with the output value of a control group which does not receive the anirtib treatment, if the output value of miR-34a-5p, miR-27b-5p or PRKAR2B is lower than the output value of the control group, the curative effect of the patient with non-small cell lung cancer is good in the process of taking the anirtib treatment.
10. The method of claim 9, comprising:
(1) collecting a body fluid sample of a to-be-detected object;
(2) extracting and separating exosomes from the body fluid sample in the step (1);
(3) extracting exosome RNA;
(4) and detecting the expression levels of the miR-34a-5p, miR-27b-5p or PRKAR2B and the internal reference gene and carrying out differential expression analysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210646485.6A CN114921531A (en) | 2022-06-08 | 2022-06-08 | Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210646485.6A CN114921531A (en) | 2022-06-08 | 2022-06-08 | Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114921531A true CN114921531A (en) | 2022-08-19 |
Family
ID=82811839
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210646485.6A Pending CN114921531A (en) | 2022-06-08 | 2022-06-08 | Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114921531A (en) |
-
2022
- 2022-06-08 CN CN202210646485.6A patent/CN114921531A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200370127A1 (en) | Biomarkers in Peripheral Blood Mononuclear Cells for Diagnosing or Detecting Lung Cancers | |
| US20200131586A1 (en) | Methods and compositions for diagnosing or detecting lung cancers | |
| US20080305473A1 (en) | Propagation of primary cells | |
| MX2013013746A (en) | Biomarkers for lung cancer. | |
| CN102876676B (en) | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof | |
| WO2021164492A1 (en) | Application of a group of genes related to colon cancer prognosis | |
| CN104160038A (en) | Method for predicting responsiveness to a treatment with an EGFR inhibitor | |
| CA3077746A1 (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
| WO2018127786A1 (en) | Compositions and methods for determining a treatment course of action | |
| US20160376661A1 (en) | A method for predicting responsiveness to a treatment with an egfr inhibitor | |
| CN109234391A (en) | ANXA3 gene or ANXA3 albumen as adenocarcinoma of lung biomarker | |
| CN110229899B (en) | Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer | |
| CN113337613B (en) | Serum exosome tsRNA marker related to liver cancer, probe and application thereof | |
| Rao et al. | Identification of plasma exosomes long non-coding RNA HAGLR and circulating tumor cells as potential prognosis biomarkers in non-small cell lung cancer | |
| CN110541030A (en) | bladder cancer detection kit and application thereof | |
| JP2017529852A (en) | Method for predicting responsiveness to treatment with an EGFR inhibitor | |
| US20120095030A1 (en) | Methods and kits to predict therapeutic outcome of tyrosine kinase inhibitors | |
| CN106164290A (en) | MIRNA ratio is used to determine lung cancer | |
| CN111194356B (en) | Method for detecting plasma cell cachexia | |
| CN116574807A (en) | Immune combined chemotherapy curative effect prediction model based on CD160 derived from lung adenocarcinoma plasma extracellular vesicles | |
| CN115044676A (en) | Application of exosome miRNA in predicting immunotherapy effect of non-small cell lung cancer patient | |
| CN111979315A (en) | Application of annular TP63 as lung squamous carcinoma diagnosis or treatment target | |
| CN110373457A (en) | A kind of mRNA marker and its application for ulcerative colitis diagnosis | |
| CN113667750B (en) | Application of circRNA marker for colorectal cancer diagnosis | |
| CN114921531A (en) | Application of exosome RNA in curative effect evaluation of RTK inhibitor for treating advanced non-small cell lung cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |