CN109207613B - Molecular marker for identifying female parent source of hybrid individual of mytilus coruscus and Mediterranean mussel - Google Patents
Molecular marker for identifying female parent source of hybrid individual of mytilus coruscus and Mediterranean mussel Download PDFInfo
- Publication number
- CN109207613B CN109207613B CN201811437694.XA CN201811437694A CN109207613B CN 109207613 B CN109207613 B CN 109207613B CN 201811437694 A CN201811437694 A CN 201811437694A CN 109207613 B CN109207613 B CN 109207613B
- Authority
- CN
- China
- Prior art keywords
- mytilus coruscus
- mediterranean
- mussel
- mytilus
- mediterranean mussel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention aims to provide a method for identifying the maternal source of a hybridized individual of mytilus coruscus and Mediterranean mussel, so that the maternal source identification of the hybridized individual of the mytilus coruscus and the Mediterranean mussel can be effectively carried out. The invention detects and measures the mitochondrial molecular marker of the hybrid individual female parent source of the mytilus coruscus and the Mediterranean mussel; wherein the nucleic acid sequence in Mytilus coruscus is SEQ ID NO 1; the sequence of Mediterranean mussel is SEQ ID NO 2. The invention determines the snp difference between the mytilus coruscus and the Mediterranean mussel through the screened molecular markers, the HRM curve obtained by amplification can present different dissolution peak temperatures, and the mitochondrial difference of the two mytilus coruscus can be distinguished through the position of the curve peak. The filial generation keeps the same dissolution peak value with the maternal generation, and then the maternal source of the filial generation is judged.
Description
Technical Field
The invention belongs to the technical field of shellfish genetic breeding, and particularly relates to a molecular marker for identifying the source of a female parent of a Mytilus coruscus and Mediterranean mussel hybrid individual.
Background
Mytilus coruscus (Mytilus coruscus) belongs to Mollusca, Bivalvia, Mytilodia and Mytilidae of Mollusca, and has high nutritive value and wide market prospect. The cultured mytilus coruscus finished product is large in size, high in meat yield, rich in nutrition and delicious in taste, and is deeply favored by consumers at home and abroad. The Zhoushan sea area is the origin of the mytilus coruscus and is an important local economic shellfish; the Zhoushan sea area before the 70's of the 20 th century had only mytilus coruscus, but not the Mediterranean mussels. After the introduction of Mediterranean mussels (Mytilus gallophovincialis) from Shandong, Liaoning, etc. for artificial culture in 1973, the culture of Mediterranean mussels has rapidly progressed in Zhoushan. It has been reported that a hybrid population of Mediterranean mussels and Mytilus coruscus, called "hybrid mussels", exists in the Zhoushan sea area. The gene penetration phenomenon exists between the Mediterranean mussel and the perna canaliculus. Interspecific crosses and gene introgression between invasive and indigenous species often result in changes in population architecture from a biological point of view of protection.
In the cross breeding research, the determination of the female parent is the key for analyzing the mating ability of the parent, the female parent effect and the like, and is the premise for the selection of the parent and the establishment of the cross breeding strategy. In addition, in the seedling production, the original source of the parents is determined, so that the process and the importance of selecting the seedling parents can be known, and the seedling production can be ensured to be carried out according to a preset plan.
Disclosure of Invention
The invention aims to provide a molecular marker for identifying the maternal source of a hybridized individual of mytilus coruscus and Mediterranean mussel, and the molecular marker can effectively identify the maternal source of the hybridized individual of the mytilus coruscus and the Mediterranean mussel, thereby making up for the defects of the prior art.
The invention firstly provides a mitochondrial molecular marker for detecting and determining the maternal origin of a hybrid individual of Mytilus coruscus and Mytilus edulis; wherein the nucleic acid sequence in Mytilus coruscus is SEQ ID NO 1; the sequence of Mediterranean mussel is SEQ ID NO. 2;
the method for detecting the mitochondrial molecular marker is to detect the mitochondrial molecular marker by a high-resolution dissolution curve method;
the sequence information of the primer YB-16S-4 used in the method adopting the high-resolution melting curve is as follows:
an upstream primer: GCTTTGGCTTGCTTAAGTAGTTT (SEQ ID NO: 3);
a downstream primer: ACTAAGCACAACTTAAGAGAA (SEQ ID NO: 4).
In another aspect, the invention provides a method for detecting the maternal source of the hybrid individual of Mytilus coruscus and Mytilus edulis by detecting the mitochondrial molecular marker,
the invention determines the snp difference between the mytilus coruscus and the Mediterranean mussel through the screened molecular markers, the HRM curve obtained by amplification can present different dissolution peak temperatures, and the mitochondrial difference of the two mytilus coruscus can be distinguished through the position of the curve peak. The filial generation keeps the same dissolution peak value with the maternal generation, and then the maternal source of the filial generation is judged.
Drawings
FIG. 1: CG hybrid progeny and parent detection maps, wherein red represents the female parent of mytilus coruscus; green represents a male parent of Mediterranean mussel; blue represents CG progeny;
FIG. 2: GC hybrid progeny and parental detection maps, where green represents the mother of mediterranean mussel; red represents the male parent of mytilus coruscus; purple color represents G C hybrid progeny.
Detailed Description
Mussel mitochondria have a double monophyletic inheritance (DUI), under which two types of mitochondrial DNA exist: type F mtDNA, transmitted by females to all offspring; type F mtDNA is transmitted only from male individuals to male offspring. The applicant screens and obtains mitochondrial molecular markers capable of detecting the maternal origin of hybrid offspring of the mytilus coruscus and the Mediterranean mussel, and combines nuclear gene markers capable of distinguishing the mytilus coruscus and the Mediterranean mussel, thereby promoting the invention.
The present invention will now be described in detail with reference to examples
Example 1: screening for mitochondrial molecular markers
The applicant screens F mitochondrial sequences of the obtained Mytilus coruscus and Mytilus edulis, searches a Single Nucleotide Polymorphism (SNP) region by using alignment X (a component of Vector NTI Suite 7.1) software to perform sequence alignment, and screens an 84bp fragment with 6 SNP sites, wherein the F mitochondrial sequence of the Mytilus coruscus is as follows:
GCTTTGGCTTGCTTAAGTAGTTTAGGAAAAACGTAAGATTTTCATTCTTAATTCAGAAATTATTTCTCTTAAGTTGTGCTTAGT(SEQ ID NO:1)
the mytilus edulis F mitochondrial sequence in mediterranean is:
GCTTTGGCTTGCTTAAGTAGTTTAGGGAAAACATAAGATTTTCATTCTTAAGTCAGAAAGCAGTTCTCTTAAGTTGTGCTTAGT(SEQ ID NO:2)
wherein 6 snp sites are located at amplicon 27(A-G), 33(G-A), 52(T-G), 60(T-G), 61(T-C), 63(T-G) positions, respectively.
The primer sequence YB-16S-4 for detecting the fragments is designed according to the primer design principle, and the primer sequence is as follows:
an upstream primer: GCTTTGGCTTGCTTAAGTAGTTT (SEQ ID NO: 3);
a downstream primer: ACTAAGCACAACTTAAGAGAA (SEQ ID NO: 4).
And (3) identifying the female parent source of the offspring seeds by using the primers and adopting a high-resolution dissolution curve method. Use of
480 saturated fluorescent dye HRM kit comprising:
480HRM Master Mix with
dye (Roche diagnostics), forward and reverse primers 10. mu. mol each, 100ng DNA template, 1.6. mu.L Mgcl2, and water to 20. mu.L. The PCR reaction and the melting curve analysis of the product are carried out simultaneously
480 real-time quantitative analyzer (Roche Diagnostics). The reaction procedure was as follows: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 30s, Tm annealing for 30s, annealing at 72 ℃ for 30s, and 45 cycles. The amplification product was raised from 72 ℃ to 95 ℃ for 5s at 4.4 ℃/s, lowered to 65 ℃ for 1min at 2.2 ℃/s, and raised to 95 ℃ at 0.11 ℃/s. Cooling to 40 ℃ at 0.11 ℃/s. After the reaction is finished, usingroche
The Tm value analysis and genotyping were carried out by the Software 480 available from Tm Calling and Gene Scanning Software 1.5. In CG hybridization combination, the peak value of the dissolution curve of two mytilus coruscus female parents is 75.5 ℃, and the peak value of the dissolution curve of two Mediterranean mussel male parents is 78.1 ℃. The dissolution profiles of 10 hybrid progeny are consistent with that of the female parent mytilus coruscus, and all lie at 75.5 ℃. Similarly, the dissolution profiles of the CG backcross combination of 10 offspring are consistent with that of the maternal Mediterranean mussel, and are all at 78.1 ℃. The amplification curves are shown in FIGS. 1 and 2.
The detection results of fig. 1 and fig. 2 show that the dissolution peak curve graphs of the two groups of filial generation are consistent with the female parent, which shows that the amplification result of the primer conforms to the female parent genetic rule of the F mitochondria and can be used as a marker for identifying the source of the female parent of the filial generation.
The construction method of the hybrid offspring of the mytilus coruscus and the Mediterranean mussel used by the invention is as follows:
the method comprises the steps of taking a female mytilus coruscus as a female parent and a male mytilus coruscus as a male parent, heating and flowing water to stimulate to obtain sperm and ovum, and hybridizing to obtain CG orthogonal combination offspring.
The method comprises the steps of taking a female Mediterranean mussel as a female parent and a male Mytilus coruscus as a male parent, heating and flowing water to stimulate to obtain sperm and eggs, and hybridizing to obtain GC backcross combined offspring.
Taking the hybrid combined parent muscle, and fixing with 100% alcohol. After the mussel larvae are incubated for 60 days, 100% alcohol is sampled and fixed. And extracting DNA of 10 individuals of each of the parent and the positive and negative cross filial generation by adopting a phenol chloroform method. The extracted DNA was diluted to 100 ng/microliter and checked for integrity by electrophoresis on a 1.5% agarose gel and stored at-20 ℃ until use.
Example 2: the identification results of the source mussel seedlings in 4 nursery sites are as follows:
103 total Mytilus coruscus seedlings hatched for 60-120 days are collected from 4 Mytilus coruscus seedling farms (named A, B, C and D) in Zhejiang province, and are identified by adopting the method. After single homogenate of the spat, the DNA of the individual is extracted by phenol chloroform method. The extracted DNA was diluted to 100 ng/microliter and checked for integrity by electrophoresis on a 1.5% agarose gel and stored at-20 ℃ until use.
First, whether the individual to be detected is a hybrid offspring is determined, wherein molecular markers for distinguishing the mytilus coruscus and the Mediterranean mussel have the following sequences in the mytilus coruscus:
TCTAGAACCAGTATACAAACCTGTGAATAAGATTCCAACACCATATATATCCAAGAAAAGTTATCCGGCACCATATAAACCGAAAGGCTATTATCCTACGAAACGTTATCAGCCAACATATGGATCAAAGACAAACTATCCGCCAATATATAAGCCcAATTGCAAAGAAGCTATCATCATACAAAGCATTAAGACTCTAGAAG(SEQ ID NO:5)；
the sequence in the Mediterranean mussel is as follows:
TCTAGAACCAGTATACAAACCTGTGAAGACAAGTTATCATCCTACgGAATAGTTATCCGCCAACATATGGATCAAAGACAAACTATCTGCCACTTGCAAAGAAGCTGTCATCATACAAAGCATTAAGACTCTAGA(SEQ ID NO:6)；
the sequence information of the detected primer pair Myti-2 is as follows:
an upstream primer: CTAGAACCAGTATACAAACCTGTGAA (SEQ ID NO: 7);
a downstream primer: CTAGAGTCTTAATGCTTTGTATGATGA (SEQ ID NO: 8).
And amplifying a nuclear gene sequence by adopting a primer Myti-2, carrying out agarose detection, and determining whether hybridization exists, wherein the detection result shows that 29 detection spat in the seedling raising field B and 30 detection spats in the seedling raising field C are single strips, the characteristics of the detection spats are consistent with the strips of the mytilus coruscus, and the detection result is judged to be pure mytilus coruscus spats.
26 detection spats in the nursery site A have 23 single characteristic strips of mytilus coruscus, and two characteristic strips of mytilus coruscus and Mediterranean mussel appear in 3 individuals simultaneously, and the individuals are judged to be hybrid individuals.
18 detection spats in the seedling raising field D have 1 single characteristic stripe of the Mediterranean mussel, and 17 individuals have two characteristic stripes of the Mytilus coruscus and the Mediterranean mussel simultaneously, and are judged as hybrid individuals.
To further determine the parental origin of the hybrid individuals and to re-identify mussel offspring seeds judged to be purebred, i performed a melting curve analysis on all 103 individuals using the F mitochondrial primer YB-16S-4. The results show that: the peak of the dissolution curve of 29 detected spats in the seedling raising field B and the peak of the dissolution curve of 30 detected spats in the seedling raising field C are both at 75.5 ℃, and are the characteristic peaks of the mytilus coruscus. The female parent is determined to be the mytilus coruscus.
The 26 detected spat of the nursery site A all have thick-shell mussel characteristic peak values, which shows that the 26 individual female parents are thick-shell mussels. Combining the nuclear gene detection result, it can be judged that 23 individuals are pure mytilus coruscus seedlings, and 3 hybrid individuals are obtained by hybridizing the mytilus coruscus female parent and the Mediterranean mussel male parent.
18 detected spat of the nursery D all show the characteristic peak value of the Mediterranean mussel, which indicates that the 18 individual female parents are the Mediterranean mussels. Combining the nuclear gene detection result, judging that 1 individual is a pure Mediterranean mussel seedling, and 17 hybrid individuals are obtained by hybridizing the Mediterranean mussel female parent and the Mytilus coruscus male parent.
In conclusion, all 103 spat are effectively identified, and the identification success rate is 100%. Wherein, the seedling raising fields B and C are seedlings of Mytilus coruscus; 88.5 percent of the plants A are seedlings of the thick-shell mussels, and 11.5 percent of the plants A are hybrid seedlings of the thick-shell mussels and the common parent mussels; 5.6 percent of the C plants are Mediterranean mussel seedlings, and 94.4 percent of the C plants are hybrid seedlings of Mediterranean mussel and thick mussel.
The identification result shows that in the production process of seedling farms A and D, the female parents adopted in the parents of the factory A are all the mytilus coruscus, but the male parents are mixed with a small amount of Mediterranean mussels, so that a small amount of hybrid seedlings appear; the D factory adopts female parent Mytilus coruscus, but the male parent is mixed with a large amount of male parent Mytilus coruscus, so that most of the produced seedlings are hybrid seedlings, pure seedlings of Mytilus coruscus and no pure Mytilus coruscus seedlings. The identification result shows the importance of parent selection in the seedling raising process of the mytilus coruscus, the selection error of female parent mussels and male parent mussels, and the difference of the produced mytilus coruscus offspring seed proportions also exists.
Sequence listing
<110> Ningbo university
<120> molecular marker for identifying female parent sources of hybrid individuals of mytilus coruscus and Mediterranean mussel
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 84
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gctttggctt gcttaagtag tttaggaaaa acgtaagatt ttcattctta attcagaaat 60
tatttctctt aagttgtgct tagt 84
<210> 2
<211> 84
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gctttggctt gcttaagtag tttagggaaa acataagatt ttcattctta agtcagaaag 60
cagttctctt aagttgtgct tagt 84
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gctttggctt gcttaagtag ttt 23
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
actaagcaca acttaagaga a 21
<210> 5
<211> 203
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tctagaacca gtatacaaac ctgtgaataa gattccaaca ccatatatat ccaagaaaag 60
ttatccggca ccatataaac cgaaaggcta ttatcctacg aaacgttatc agccaacata 120
tggatcaaag acaaactatc cgccaatata taagcccaat tgcaaagaag ctatcatcat 180
acaaagcatt aagactctag aag 203
<210> 6
<211> 135
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tctagaacca gtatacaaac ctgtgaagac aagttatcat cctacggaat agttatccgc 60
caacatatgg atcaaagaca aactatctgc cacttgcaaa gaagctgtca tcatacaaag 120
cattaagact ctaga 135
<210> 7
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ctagaaccag tatacaaacc tgtgaa 26
<210> 8
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ctagagtctt aatgctttgt atgatga 27
Claims (2)
1. Mitochondrial molecular markers for detecting female parent sources of hybrid individuals of mytilus coruscus and Mediterranean mussel; the molecular marker is characterized in that the nucleic acid sequence of the marker derived from the parent of the Mytilus coruscus is SEQ ID NO. 1; the nucleic acid sequence of the mark of the Mediterranean mussel maternal source is SEQ ID NO. 2.
2. A method for detecting female parent sources of hybridized individuals of Mytilus coruscus and Mediterranean mussel, which is characterized in that the mitochondrial molecular marker in claim 1 is detected by a high resolution dissolution curve method, wherein the sequence of an upstream primer of a primer pair used in the high resolution dissolution curve method is SEQ ID NO. 3, and the sequence of a downstream primer of the primer pair is SEQ ID NO. 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811437694.XA CN109207613B (en) | 2018-11-28 | 2018-11-28 | Molecular marker for identifying female parent source of hybrid individual of mytilus coruscus and Mediterranean mussel |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811437694.XA CN109207613B (en) | 2018-11-28 | 2018-11-28 | Molecular marker for identifying female parent source of hybrid individual of mytilus coruscus and Mediterranean mussel |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109207613A CN109207613A (en) | 2019-01-15 |
| CN109207613B true CN109207613B (en) | 2022-03-04 |
Family
ID=64994502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811437694.XA Active CN109207613B (en) | 2018-11-28 | 2018-11-28 | Molecular marker for identifying female parent source of hybrid individual of mytilus coruscus and Mediterranean mussel |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207613B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110007666A (en) * | 2009-07-17 | 2011-01-25 | 한국해양연구원 | Identifying method of marine species, polynucleotide probe, dna chip and kit for identifying the same |
| CN106701948A (en) * | 2016-12-30 | 2017-05-24 | 青岛农业大学 | Identifying method for purple scallop, bay scallop and filial-generation female parent source |
-
2018
- 2018-11-28 CN CN201811437694.XA patent/CN109207613B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110007666A (en) * | 2009-07-17 | 2011-01-25 | 한국해양연구원 | Identifying method of marine species, polynucleotide probe, dna chip and kit for identifying the same |
| CN106701948A (en) * | 2016-12-30 | 2017-05-24 | 青岛农业大学 | Identifying method for purple scallop, bay scallop and filial-generation female parent source |
Non-Patent Citations (2)
| Title |
|---|
| An effective method for identification of three mussel species and their hybrids based on SNPs;Xingqiang Chen等;《Conservation Genetics Resources》;20180613;第12卷;摘要 * |
| 厚壳贻贝与贻贝遗传渐渗的分子生物学鉴定;沈玉帮;《海洋渔业》;20060831;第28卷(第3期);第195-200页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109207613A (en) | 2019-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TWI721708B (en) | A molecular marker related to papaya fruiting | |
| CN109251995B (en) | CAPS molecular marker for identifying watermelon peel background color and application thereof | |
| CN106868135B (en) | Primer and method for identifying soybean male sterile line | |
| CN108486276A (en) | Capsicum maturity SNP marker and its application | |
| CN102242219B (en) | Method and pair of special primers for identifying purple properties of Chinese cabbages | |
| CN116516049A (en) | Soybean protein content QTL locus qPRO_11_1, molecular marker and application thereof | |
| CN111304337B (en) | SRAP molecular marker, kit and method for identifying pelteobagrus fulvidraco, pelteobagrus vachelli and filial generation and application | |
| CN106591460B (en) | Method for identifying variety of 'Zhongcha 302' tea tree by SSR molecular marker and application | |
| CN110607388B (en) | Wheat stripe rust resistant gene related SNP molecular marker in adult stage, primer and application thereof | |
| CN112961931B (en) | Rapid identification method for purity of Yongtian No.5 melon seeds | |
| CN107881256A (en) | For identifying single nucleotide polymorphism site, primer pair, kit and the application of Peach fruits hardship benevolence/sweet tea benevolence character | |
| CN102747070A (en) | Two CAPs markers tightly linked with muskmelon anti-powdery mildew gene Pm-AN and its application method | |
| CN109468410A (en) | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated | |
| CN109825599B (en) | Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel | |
| CN109207613B (en) | Molecular marker for identifying female parent source of hybrid individual of mytilus coruscus and Mediterranean mussel | |
| CN107586874A (en) | For identifying primer pair and its application of capsicum yellow flower pesticide character | |
| CN109762928B (en) | Molecular marker related to melon vine length and application of molecular marker in identification of melon vine length characters | |
| CN103952403A (en) | Closely-linked molecular marker of new gene Xa39 resistant to rice xanthomonas oryzae | |
| Kyaligonza et al. | Identification of F1 cassava (Manihot esculenta Crantz) progeny using microsatellite markers and capillary electrophoresis | |
| CN107760798B (en) | SSR molecular marker of seedless major QTL (quantitative trait locus) of grape fruit | |
| CN109628636B (en) | SSR molecular marker for identifying hybrid of Xinjiang grape and Kyoho grape and application thereof | |
| CN112159861B (en) | SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof | |
| CN108251542B (en) | Method for identifying Scylla paramamosain and Scylla serrata | |
| CN106636427B (en) | Microsatellite marker primer and method for identifying inbred families of exopalaemon carinicauda | |
| CN113862386B (en) | Indel marker linked with Cucurbita pepo L. Leaf notch gene Cpdll, and primers, kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |