CN109825599B - Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel - Google Patents
Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel Download PDFInfo
- Publication number
- CN109825599B CN109825599B CN201811449272.4A CN201811449272A CN109825599B CN 109825599 B CN109825599 B CN 109825599B CN 201811449272 A CN201811449272 A CN 201811449272A CN 109825599 B CN109825599 B CN 109825599B
- Authority
- CN
- China
- Prior art keywords
- mytilus coruscus
- seq
- sequence
- mytilus
- coruscus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for identifying individual genetic backgrounds of Mytilus coruscus and Mytilus coruscus hybrids, and provides nucleic acid fragments for distinguishing the Mytilus coruscus and the Mytilus coruscus, wherein the sequence in the Mytilus coruscus is SEQ ID NO. 1, and the sequence in the Mytilus coruscus is SEQ ID NO. 2. The method obtains genome molecular markers capable of distinguishing the mytilus coruscus and the Mediterranean mussel by screening, combines mitochondrial markers capable of distinguishing the hybrid offspring of the mytilus coruscus and the Mediterranean mussel, determines which one of the mitochondrial markers is on the basis of determining the hybrid offspring, and distinguishes mitochondrial differences of the two Mytilus coruscus by the position of a curve peak value, wherein an HRM curve obtained by amplification of the mitochondrial markers shows different dissolving peak temperatures; the filial generation keeps the same dissolution peak value with the maternal generation, and then the maternal source of the filial generation is judged.
Description
Technical Field
The invention belongs to the technical field of shellfish genetic breeding, and particularly relates to a method for identifying individual genetic backgrounds of hybrids of mytilus coruscus and Mediterranean mussel.
Background
Mytilus coruscus (Mytilus coruscus) belongs to Mollusca, Bivalvia, Mytilodia and Mytilidae of Mollusca, and has high nutritive value and wide market prospect. The cultured mytilus coruscus finished product has the advantages of large size, high meat yield, rich nutrition and delicious taste, and is deeply favored by domestic and foreign consumers. The Zhoushan sea area is the origin of the mytilus coruscus and is an important local economic shellfish; the Zhoushan sea area before the 70's of the 20 th century had only mytilus coruscus, but not the Mediterranean mussels. After the introduction of Mediterranean mussels (Mytilus gallophovincialis) from Shandong, Liaoning, etc. for artificial culture in 1973, the culture of Mediterranean mussels has rapidly progressed in Zhoushan. It has been reported that a hybrid population of Mediterranean mussels and Mytilus coruscus, called "hybrid mussels", exists in the Zhoushan sea area. The gene penetration phenomenon exists between the Mediterranean mussel and the perna canaliculus. Interspecific crosses and gene introgression between invasive and indigenous species often result in changes in population architecture from a biological point of view of protection.
With the expansion of the thick-shelled mussel consumption market, the demand for thick-shelled mussel offspring seeds is also promoted year by year, and because the mussel offspring seeds are difficult to identify in appearance, a method for identifying the mussel offspring seeds based on a molecular level needs to be developed.
Disclosure of Invention
The invention aims to provide a method for identifying individual genetic backgrounds of hybrids of mytilus coruscus and Mediterranean mussel, so that the individual hybrids of the mytilus coruscus and the Mediterranean mussel can be effectively identified.
The invention firstly provides a nucleic acid fragment for distinguishing mytilus coruscus and Mediterranean mussel, wherein the nucleic acid fragment is amplified in the Mytilus coruscus to obtain a 199bp fragment, and is amplified in the Mediterranean mussel to obtain a 133bp fragment, the sequence of the nucleic acid fragment in the Mytilus coruscus is SEQ ID NO. 1, the sequence in the Mediterranean mussel is SEQ ID NO. 2,
a method for identifying Mytilus coruscus and Mytilus edulis by detecting the above nucleic acid fragments;
one of the detection methods is to amplify the nucleic acid fragment by using PCR amplification primers,
the sequence information of one primer pair is as follows:
an upstream primer: CTAGAACCAGTATACAAACCTGTGAA (SEQ ID NO:3),
A downstream primer: CTAGAGTCTTAATGCTTTGTATGATGA (SEQ ID NO: 4);
the application of the nucleic acid fragment in detecting whether the hybrid individual is a pure line or not.
In another aspect, the invention provides a method for detecting the source of the female parent of the hybrid individual of the perna canaliculus and the Mediterranean mussel; the method comprises the following steps:
1) firstly, determining whether an individual to be detected is a filial generation by using the molecular marker;
2) determining the female parent source of the individual determined as the filial generation by detecting the mitochondrial molecular marker;
the mitochondrial molecular marker; wherein the nucleic acid sequence in Mytilus coruscus is SEQ ID NO. 5; the sequence of Mediterranean mussel is SEQ ID NO 6;
wherein the mitochondrial molecular marker is detected by a high-resolution dissolution curve method;
in the high resolution melting curve method, the sequence information of the primer YB-16S-4 used in the high resolution melting curve method is as follows:
an upstream primer: GCTTTGGCTTGCTTAAGTAGTTT (SEQ ID NO: 7);
a downstream primer: ACTAAGCACAACTTAAGAGAA (SEQ ID NO: 8).
The method obtains genome molecular markers capable of distinguishing the mytilus coruscus and the Mediterranean mussel by screening, combines mitochondrial markers capable of distinguishing the hybrid offspring of the mytilus coruscus and the Mediterranean mussel, determines which one of the mitochondrial markers is on the basis of determining the hybrid offspring, and distinguishes mitochondrial differences of the two Mytilus coruscus by the position of a curve peak value, wherein an HRM curve obtained by amplification of the mitochondrial markers shows different dissolving peak temperatures; the filial generation keeps the same dissolution peak value with the maternal generation, and then the maternal source of the filial generation is judged.
Drawings
FIG. 1: two mussel gene amplified sequence alignment charts, wherein the square frame is the same base sequence of two mussels;
FIG. 2: CG filial generation and parent identification picture, wherein M is marker; a1, A2 is female parent of Mytilus coruscus; b1, B2, male parent of Mediterranean mussel; CG hybrid progeny;
FIG. 3: GC hybrid progeny and parent identification map, wherein M is marker; b3, B4, Mediterranean mussel mother parent; a3, A4, male parent of Mytilus coruscus; 1-10 GC hybrid progeny;
FIG. 4: CG hybrid progeny and parent detection maps, wherein red represents the female parent of mytilus coruscus; green represents a male parent of Mediterranean mussel; blue represents CG progeny;
FIG. 5 is a schematic view of: GC hybrid progeny and parent detection maps, where green represents the mother of mediterranean mussel; red represents the male parent of mytilus coruscus; purple color represents G C hybrid progeny.
Detailed Description
The applicant screens and obtains mitochondrial molecular markers capable of detecting the maternal origin of hybrid offspring of the mytilus coruscus and the Mediterranean mussel, and combines nuclear gene markers capable of distinguishing the mytilus coruscus and the Mediterranean mussel, thereby promoting the invention.
The construction method of the hybrid filial generation in the invention is as follows:
the method comprises the steps of taking a female mytilus coruscus as a female parent and a male mytilus coruscus as a male parent, heating and flowing water to stimulate to obtain sperm and ovum, and hybridizing to obtain CG orthogonal combination offspring.
The method comprises the steps of taking a female Mediterranean mussel as a female parent and a male Mytilus coruscus as a male parent, heating and flowing water to stimulate to obtain sperm and eggs, and hybridizing to obtain GC backcross combined offspring.
Taking the hybrid combined parent muscle, and fixing with 100% alcohol. After the mussel larvae are incubated for 60 days, 100% alcohol is sampled and fixed. And extracting DNA of 10 individuals of each of the parent and the positive and negative cross filial generation by adopting a phenol chloroform method. The extracted DNA was diluted to 100 ng/microliter and checked for integrity by electrophoresis on a 1.5% agarose gel and stored at-20 ℃ until use.
Example 1: screening and identification of nuclear gene molecular marker
The applicant found that there were genomic fragment fragments of size difference in Mytilus coruscus and Mytilus coruscus, wherein the nucleotide sequence of the fragment in Mytilus coruscus is
TCTAGAACCAGTATACAAACCTGTGAATAAGATTCCAACACCATATATATCCAAGAAAAGTTATCCGGCACCATATAAACCGAAAGGCTATTATCCTACGAAACGTTATCAGCCAACATATGGATCAAAGACAAACTATCCGCCAATATATAAGCCcAATTGCAAAGAAGCTATCATCATACAAAGCATTAAGACTCTAGAAG(SEQID NO:1)
The sequence in Mediterranean mussels is:
TCTAGAACCAGTATACAAACCTGTGAAGACAAGTTATCATCCTACgGAATAGTTATCCGCCAACATATGGATCAAAGACAAACTATCTGCCACTTGCAAAGAAGCTGTCATCATACAAAGCATTAAGACTCTAGA(SEQ ID NO:2)
the comparison result shows that the length of the corresponding nucleotide fragment in the mytilus coruscus is 199bp fragments, the length of the corresponding nucleotide fragment in the amplification of the Mediterranean mussel is 133bp fragments, and the difference between the two fragments is 66bp (figure 1); thus can be used for identifying mytilus coruscus and Mediterranean mussel.
Designing PCR amplification primers for detecting the fragments, wherein one primer pair Myti-2 comprises the following sequence information:
an upstream primer: CTAGAACCAGTATACAAACCTGTGAA (SEQ ID NO:3)
A downstream primer: CTAGAGTCTTAATGCTTTGTATGATGA (SEQ ID NO: 4);
the PCR reaction system was 25. mu.L, and included: 100ng of DNA, 2 × Es TaqMasterMix (Dye) (kang is century, China).
Annealing at 52 deg.C for 1min, and extending at 72 deg.C for 1 min; finally, extension is carried out for 10min at 72 ℃. The PCR product was detected by 2.5% agarose gel electrophoresis. The agarose amplification results of the two crosses combined parent and progeny are shown in fig. 2 and 3. The CG hybrid group female parent is two mytilus coruscus and the male parent is two Mediterranean mussels, which respectively present unique single bands, and the hybrid offspring has the characteristic bands of two parents simultaneously, which are expressed as double bands. The GC hybrid group female parent is two Mediterranean mussels, the male parent is two Mytilus coruscus, the unique single bands of the two Mytilus coruscus are respectively presented, and the hybrid filial generation has the characteristic bands of the two parents at the same time and is presented as double bands. The result shows that the screened marker can effectively judge the variety of the mussel seedling and identify the original source of parents of hybrid offspring.
Example 2: screening for mitochondrial markers
F mitochondrial sequences of the Mytilus coruscus and the Mytilus edulis are obtained by screening, a Single Nucleotide Polymorphism (SNP) region is searched by using AlignX (genomic of Vector NTI Suite 7.1) software for sequence alignment, and an 84bp fragment with 6 SNP sites is obtained by screening, wherein the F mitochondrial sequence of the Mytilus coruscus is as follows:
GCTTTGGCTTGCTTAAGTAGTTTAGGAAAAACGTAAGATTTTCATTCTTAATTCAGAAATTATTTCTCTTAAGTTGTGCTTAGT(SEQ ID NO:5)
the mytilus edulis F mitochondrial sequence in mediterranean is:
GCTTTGGCTTGCTTAAGTAGTTTAGGGAAAACATAAGATTTTCATTCTTAAGTCAGAAAGCAGTTCTCTTAAGTTGTGCTTAGT(SEQ ID NO:6)
wherein 6 snp sites are located at amplicon 27(A-G), 33(G-A), 52(T-G), 60(T-G), 61(T-C), 63(T-G) positions, respectively.
The primer sequence YB-16S-4 for detecting the fragments is designed according to the primer design principle, and the primer sequence is as follows:
an upstream primer: GCTTTGGCTTGCTTAAGTAGTTT (SEQ ID NO: 7);
a downstream primer: ACTAAGCACAACTTAAGAGAA (SEQ ID NO: 8).
And (3) identifying the female parent source of the offspring seeds by using the primers and adopting a high-resolution dissolution curve method. Use of
480 saturated fluorescent dye HRM kit comprising: 10 mu L1 is prepared
480HRM Master Mix with
dye (Roche diagnostics), forward and reverse primers 10. mu. mol each, 100ng DNA template, 1.6. mu.L Mgcl2, and water to 20. mu.L. The PCR reaction and the melting curve analysis of the product are carried out simultaneously
480 real-time quantitative analyzer (Roche Diagnostics). The reaction procedure was as follows: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 30s, Tm annealing for 30s, annealing at 72 ℃ for 30s, and 45 cycles. The amplification product was raised from 72 ℃ to 95 ℃ for 5s at 4.4 ℃/s, lowered to 65 ℃ for 1min at 2.2 ℃/s, and raised to 95 ℃ at 0.11 ℃/s. Cooling to 40 ℃ at 0.11 ℃/s. After the reaction is finished, using roche
The Tm value analysis and genotyping were carried out by the Software 480 available from Tm Calling and Gene Scanning Software 1.5. In CG hybridization combination, the peak value of the dissolution curve of two mytilus coruscus female parents is 75.5 ℃, and the peak value of the dissolution curve of two Mediterranean mussel male parents is 78.1 ℃. The dissolution profiles of 10 hybrid progeny are consistent with that of the female parent mytilus coruscus, and all lie at 75.5 ℃. Similarly, the dissolution profiles of the CG backcross combination of 10 offspring are consistent with that of the maternal Mediterranean mussel, and are all at 78.1 ℃. The amplification curves are shown in FIGS. 4 and 5. The detection results of fig. 4 and 5 show that the dissolution peak curve graphs of the two groups of filial generation are consistent with the female parent, and that the amplification result of the primer conforms to the female parent genetic rule of the F mitochondria and can be used as a marker for identifying the source of the female parent of the filial generation.
Example 3: identification results of source mussel seedlings in 4 nursery sites
103 total Mytilus coruscus seedlings hatched for 60-120 days are collected from 4 Mytilus coruscus seedling farms (named A, B, C and D) in Zhejiang province, and are identified by adopting the method. After single homogenate of the spat, the DNA of the individual is extracted by phenol chloroform method. The extracted DNA was diluted to 100 ng/microliter and checked for integrity by electrophoresis on a 1.5% agarose gel and stored at-20 ℃ until use.
Firstly, determining whether a detected individual is a hybrid progeny or not, adopting a primer Myti-2 to amplify a nuclear gene sequence, carrying out agarose detection, and determining whether hybridization exists or not, wherein the detection result shows that 29 detected spats in a nursery site B and 30 detected spats in a nursery site C are single strips, the characteristics of the single strips are consistent with those of the mytilus coruscus strips, and the single-species mytilus coruscus seedlings are determined.
26 detection spats in the nursery site A have 23 single characteristic strips of mytilus coruscus, and two characteristic strips of mytilus coruscus and Mediterranean mussel appear in 3 individuals simultaneously, and the individuals are judged to be hybrid individuals.
18 detection spats in the seedling raising field D have 1 single characteristic stripe of the Mediterranean mussel, and 17 individuals have two characteristic stripes of the Mytilus coruscus and the Mediterranean mussel simultaneously, and are judged as hybrid individuals.
To further determine the parental origin of the hybrid individuals and to re-identify mussel offspring seeds judged to be purebred, i performed a melting curve analysis on all 103 individuals using the F mitochondrial primer YB-16S-4. The results show that: the peak of the dissolution curve of 29 detected spats in the seedling raising field B and the peak of the dissolution curve of 30 detected spats in the seedling raising field C are both at 75.5 ℃, and are the characteristic peaks of the mytilus coruscus. The female parent is determined to be the mytilus coruscus.
The 26 detected spat of the nursery site A all have thick-shell mussel characteristic peak values, which shows that the 26 individual female parents are thick-shell mussels. Combining the nuclear gene detection result, it can be judged that 23 individuals are pure mytilus coruscus seedlings, and 3 hybrid individuals are obtained by hybridizing the mytilus coruscus female parent and the Mediterranean mussel male parent.
18 detected spat of the nursery D all show the characteristic peak value of the Mediterranean mussel, which indicates that the 18 individual female parents are the Mediterranean mussels. Combining the nuclear gene detection result, judging that 1 individual is a pure Mediterranean mussel seedling, and 17 hybrid individuals are obtained by hybridizing the Mediterranean mussel female parent and the Mytilus coruscus male parent.
In conclusion, all 103 spat are effectively identified, and the identification success rate is 100%. Wherein, the seedling raising fields B and C are seedlings of Mytilus coruscus; 88.5 percent of the plants A are seedlings of the thick-shell mussels, and 11.5 percent of the plants A are hybrid seedlings of the thick-shell mussels and the common parent mussels; 5.6 percent of the C plants are Mediterranean mussel seedlings, and 94.4 percent of the C plants are hybrid seedlings of Mediterranean mussel and thick mussel.
The identification result shows that in the production process of seedling farms A and D, the female parents adopted in the parents of the factory A are all the mytilus coruscus, but the male parents are mixed with a small amount of Mediterranean mussels, so that a small amount of hybrid seedlings appear; the D factory adopts female parent Mytilus coruscus, but the male parent is mixed with a large amount of male parent Mytilus coruscus, so that most of the produced seedlings are hybrid seedlings, pure seedlings of Mytilus coruscus and no pure Mytilus coruscus seedlings. The identification result shows the importance of parent selection in the seedling raising process of the mytilus coruscus, the selection error of female parent mussels and male parent mussels, and the difference of the produced mytilus coruscus offspring seed proportions also exists.
Claims (4)
1. A method for identifying Mytilus coruscus and Mytilus coruscus, which is characterized in that the method distinguishes Mytilus coruscus and Mytilus coruscus by detecting nucleic acid fragments for distinguishing Mytilus coruscus and Mytilus coruscus, wherein the sequence of the nucleic acid fragments in Mytilus coruscus is SEQ ID NO. 1, and the sequence of the nucleic acid fragments in Mytilus coruscus is SEQ ID NO. 2;
the method is to use PCR amplification primers to amplify the nucleic acid fragments; the sequence of the upstream primer of the amplification primer is SEQ ID NO. 3, and the sequence of the downstream primer is SEQ ID NO. 4.
2. A method for detecting the source of the female parent of the hybrid individual of the perna canaliculus and the Mediterranean mussel; the method is characterized by comprising the following steps:
1) first determining whether the individual to be tested is a hybrid progeny using the method of claim 1;
2) determining the female parent source of the individual determined as the filial generation by detecting the mitochondrial molecular marker;
the mitochondrial molecular marker; wherein the nucleic acid sequence in Mytilus coruscus is SEQ ID NO. 5; the sequence of Mediterranean mussel is SEQ ID NO 6.
3. The method of claim 2, wherein the mitochondrial molecular signature is detected using a high resolution melting curve method.
4. The method of claim 3, wherein the high resolution melting curve method uses a primer pair having an upstream primer with the sequence of SEQ ID NO. 7 and a downstream primer with the sequence of SEQ ID NO. 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811449272.4A CN109825599B (en) | 2018-11-28 | 2018-11-28 | Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811449272.4A CN109825599B (en) | 2018-11-28 | 2018-11-28 | Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109825599A CN109825599A (en) | 2019-05-31 |
| CN109825599B true CN109825599B (en) | 2022-08-09 |
Family
ID=66859247
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811449272.4A Active CN109825599B (en) | 2018-11-28 | 2018-11-28 | Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109825599B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016207857A1 (en) * | 2015-06-24 | 2016-12-29 | Universidad De Chile | Set of primers and method for detecting and identifying mussel species of the genus mytilus, using high-resolution melting and pcr |
| CN106701948A (en) * | 2016-12-30 | 2017-05-24 | 青岛农业大学 | Identifying method for purple scallop, bay scallop and filial-generation female parent source |
| CN108456735A (en) * | 2018-04-03 | 2018-08-28 | 宁波大学 | A kind of Mytilus galloprovincialis microsatellite locus and its application in hybrid generation identification |
-
2018
- 2018-11-28 CN CN201811449272.4A patent/CN109825599B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016207857A1 (en) * | 2015-06-24 | 2016-12-29 | Universidad De Chile | Set of primers and method for detecting and identifying mussel species of the genus mytilus, using high-resolution melting and pcr |
| CN106701948A (en) * | 2016-12-30 | 2017-05-24 | 青岛农业大学 | Identifying method for purple scallop, bay scallop and filial-generation female parent source |
| CN108456735A (en) * | 2018-04-03 | 2018-08-28 | 宁波大学 | A kind of Mytilus galloprovincialis microsatellite locus and its application in hybrid generation identification |
Non-Patent Citations (2)
| Title |
|---|
| 申望等.舟山海域外来物种地中海贻贝自然分布现状及生态影响.《台湾海峡》.2011,第30卷(第2期),第1-7页. * |
| 舟山海域外来物种地中海贻贝自然分布现状及生态影响;申望等;《台湾海峡》;20110531;第30卷(第2期);第2页最后1段、第3页2.1-2.2节、第4页图2-图3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109825599A (en) | 2019-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TWI721708B (en) | A molecular marker related to papaya fruiting | |
| WO2019128461A1 (en) | Indel molecular marker closely linked to photoperiod insensitivity in pumpkins and application thereof | |
| CN108048597B (en) | SNP molecular marker related to drought resistance of rice and application thereof | |
| CN107012243A (en) | A kind of molecular labeling for identifying the true hybrid of lichee and its application | |
| CN113637789B (en) | Wheat stripe rust resistance gene YrTD121 linked KASP molecular marker, primer, kit and application | |
| CN108220408A (en) | A kind of selection of grain-saving type blueness shank and recessive white meat-type chickens new lines | |
| CN103583470A (en) | Molecular-assisted-selection cultivation method for green-shin recessive-white-feather chicken line | |
| CN104120126B (en) | SRAP molecular marker closely linked with Fructus Lycopersici esculenti male sterility gene and preparation method thereof | |
| CN107881256A (en) | For identifying single nucleotide polymorphism site, primer pair, kit and the application of Peach fruits hardship benevolence/sweet tea benevolence character | |
| CN112961931B (en) | Rapid identification method for purity of Yongtian No.5 melon seeds | |
| CN109280709A (en) | One kind molecular labeling relevant to pig growth and reproductive trait and application | |
| CN108330208B (en) | Molecular marker for detecting cytoplasmic male sterility restoring gene of capsicum | |
| CN114292925A (en) | SSR molecular marker primer related to growth traits of procambarus clarkii and application of SSR molecular marker primer in auxiliary selection | |
| CN116516049A (en) | Soybean protein content QTL locus qPRO_11_1, molecular marker and application thereof | |
| CN107586874A (en) | For identifying primer pair and its application of capsicum yellow flower pesticide character | |
| CN109825599B (en) | Method for identifying individual genetic background of hybrid of mytilus coruscus and Mediterranean mussel | |
| CN109762928B (en) | Molecular marker related to melon vine length and application of molecular marker in identification of melon vine length characters | |
| CN107760798B (en) | SSR molecular marker of seedless major QTL (quantitative trait locus) of grape fruit | |
| CN103605913B (en) | Method applied to identification of pacific oyster family | |
| CN109207613B (en) | Molecular marker for identifying female parent source of hybrid individual of mytilus coruscus and Mediterranean mussel | |
| CN109468410A (en) | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated | |
| CN111996275B (en) | Molecular marker RMD16 for assisting in identifying powdery mildew resistance of soybean to be detected | |
| CN105349677B (en) | Recover round-grained rice Rice Resistance black streak dwarf site and molecule labelling method | |
| CN108085404A (en) | Giant pumpkin female trait molecular marker and the primer pair of identification giant pumpkin female character by force by force | |
| CN109136392B (en) | Genetic diversity identification method and reagent for multi-generation meiotic gynogenesis megalobrama amblycephala |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |