CN112159861B - SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof - Google Patents
SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof Download PDFInfo
- Publication number
- CN112159861B CN112159861B CN202010971420.XA CN202010971420A CN112159861B CN 112159861 B CN112159861 B CN 112159861B CN 202010971420 A CN202010971420 A CN 202010971420A CN 112159861 B CN112159861 B CN 112159861B
- Authority
- CN
- China
- Prior art keywords
- wmv
- cucumber
- mosaic virus
- watermelon mosaic
- snp marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP marker linked with a cucumber watermelon mosaic virus resistant gene wmv, a kit and a method thereof, relating to the field of biotechnology-assisted breeding. The SNP marker linked with the cucumber anti-watermelon mosaic virus gene wmv is positioned on the No. 6 chromosome of the cucumber, and the 22 nd base site has G/A single nucleotide polymorphism; the SNP marker is SNP 10862245G/A; the nucleotide sequence of the SNP marker primer is as follows: WMV-SNP1-F/WMV-SNP 1-R: AACTGCGAATGACTTTTGATC/AGAAAGCAAGCAACGACACG adopts the SNP marker, can judge whether the plant is resistant to watermelon mosaic virus at any stage of candidate materials of the cucumber, screens the resistance of the plant, has the advantages of high efficiency and less limitation, can improve the efficiency of breeding watermelon mosaic virus resistant cucumber materials, and shortens the breeding period.
Description
Technical Field
The invention belongs to the field of biotechnology-assisted breeding, and particularly relates to an SNP marker linked with a cucumber watermelon mosaic virus resistant gene wmv, a kit and a method thereof.
Background
Watermelon Mosaic Virus (WMV) is one of the main viruses harmful to cucumber production in China. WMV is spread in nature mainly by aphids, infected plants can produce symptoms such as leaf mosaic, deformity, newly-grown leaf distortion, slow plant growth, fruit deformity, and the like, and generally yield can be reduced by 10% to 20%, and in severe cases, the yield can reach 40% to 50%, even dead yield, and the economic loss is very serious (panjiu qin, 2009). The breeding of disease-resistant variety is the fundamental way to solve the problem of resistance of watermelon mosaic virus of cucumber, however, people have little knowledge about the disease-resistant gene and molecular mechanism of watermelon mosaic virus for a long time, and the molecular breeding process of WMV resistance is greatly limited. Therefore, the genetic law of cucumber WMV resistance is systematically researched, accurate and efficient molecular markers are developed, and the method has important significance for breeding new disease-resistant varieties.
In the context of the genetic law of resistance to cucumber WMV, Cohen et al (1971) reported the presence of a dominant gene against WMV in cucumber cultivar Kyoto 3 Feet. Wai and Grumet (1995) found that the resistance of WMV in TMG-1 is controlled by two pairs of recessive genes. Zhang Hai Ying et al (2005) performed WMV resistance identification using RILs population (European eighth X autumn shed), found that WMV resistance is controlled by a recessive single gene and that there is a modification of a micro-effect gene. Zhoujian (2012) and Tiangui li (2015) take cucumber infection material 65G and disease-resistant material 02245 as parents and respectively utilize F2Population and F2:3The family carries out WMV resistance analysis and discovers that the WMV resistance is controlled by a recessive monogene.
In the aspects of cucumber WMV resistance gene mining and molecular marker development, Zhang Haiying et al (2005) discovered AFLP marker E-ACT/M-CTT-427 and SCAR marker PWMV-214 linked to WMV resistance gene. Meyer et al (2008) constructed a cucumber plasmid library, and compared eIF4E and eIF (iso)4E with melon homologous genes, found that two genes in cucumber material TMG1 were not linked to potyvirus recessive resistance locus. So far, no effective molecular marker for identifying the Watermelon Mosaic Virus (WMV) resistance of the cucumber exists in the field, and no report on the SNP marker which is closely linked with the Watermelon Mosaic Virus (WMV) resistance is found.
Disclosure of Invention
The invention provides SNP markers which are closely linked with the watermelon mosaic virus resistance gene wmv of the cucumber based on the blank of the field, and provides application of the SNP markers in selection of the germplasm resources of the cucumber for resisting the watermelon mosaic virus.
The technical scheme of the invention is as follows:
an SNP marker linked with the wmv of a watermelon mosaic virus resistance gene of cucumber, which is characterized in that the SNP marker is positioned on the No. 6 chromosome of cucumber and the 22 nd base site thereof has G/A single nucleotide polymorphism; the SNP marker is SNP 10862245G/A.
The nucleotide sequences of the upstream primer and the downstream primer which can amplify the SNP marker fragment are respectively shown as SEQ ID NO.4 and SEQ ID NO. 5.
The nucleotide sequence of the SNP marker and the characteristic fragment of the cucumber watermelon mosaic virus resistant gene wmv linkage is shown as Seq ID No. 1;
the nucleotide sequence of the characteristic fragment of the SNP marker linked with the cucumber watermelon mosaic virus gene Wmv is shown as Seq ID No. 2.
A kit for identifying the cucumber anti-watermelon mosaic virus gene wmv, which is characterized by comprising a primer capable of amplifying the SNP marker linked with the cucumber anti-watermelon mosaic virus gene wmv as claimed in any one of claims 1 to 3.
The upstream and downstream sequences of the primer are respectively shown as SEQ ID NO.4 and SEQ ID NO. 5; preferably, the nucleotide sequence of the characteristic fragment of the SNP marker amplified by the primer and linked with the cucumber watermelon mosaic virus resistant gene wmv is shown as SEQ ID NO. 1;
preferably, the nucleotide sequence of the characteristic fragment of the SNP marker amplified by the primer and linked with the cucumber watermelon mosaic virus gene Wmv is shown as Seq ID No. 2.
The kit for identifying the watermelon mosaic virus resistance gene wmv of the cucumber further comprises a PCR reagent and/or an electrophoresis reagent;
preferably, the PCR reagents comprise: taq enzyme, PCR buffer solution and dNTP; the PCR reagent is preferably 3G Taq Master Mix for PAGE (Red Dye);
preferably, the electrophoresis reagent comprises: electrophoresis buffer solution and polyacrylamide gel;
preferably, the kit further comprises BclI enzyme restriction enzyme, enzyme digestion buffer solution and double distilled water.
A method for identifying the watermelon mosaic virus resistant gene wmv of cucumber is characterized in that a primer which can amplify the SNP marker linked with the watermelon mosaic virus resistant gene wmv of cucumber is adopted, and/or the primer in the kit is used for carrying out PCR amplification on the DNA of a cucumber material to be detected.
The method for identifying the watermelon mosaic virus resistance gene wmv of the cucumber further comprises the following steps: sequencing or enzyme digestion electrophoresis is carried out on the PCR amplification product;
the sequencing result is shown as Seq ID No.1, or the genotype and the phenotype of the cucumber material to be detected with the band of 218bp appearing in the enzyme cutting electrophoresis result are the watermelon mosaic virus resistant gene wmv;
the sequencing result is shown as Seq ID No.2, or the genotype and the phenotype of the cucumber material to be detected with 201bp band appearing in the enzyme cutting electrophoresis result are both watermelon mosaic virus-sensitive genes Wmv.
The PCR amplification system comprises: 0.75 ng/. mu.l DNA template, 5 ng/. mu.l each of upstream and downstream primers, 0.5. mu.l/. mu.l 2X 3G Taq Master Mix for PAGE (Red Dye);
preferably, the PCR amplification system is: 7.5ng DNA template, 50ng each of forward and reverse primers, 5 μ L2X 3G Taq Master Mix for PAGE (Red Dye), double distilled water to 10/. mu.l;
preferably, the PCR amplification procedure is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15 seconds, annealing at 55 ℃ for 15 seconds, and extension at 72 ℃ for 30 seconds are 1 cycle, and 35 cycles are total; the temperature is kept at 72 ℃ for 5 minutes.
The enzyme digestion system comprises: PCR amplification product 0.3. mu.l/. mu.l, BclI endonuclease 0.02. mu.l/. mu.l, NEBuffer 3.10.1. mu.l/. mu.l;
preferably, the enzyme digestion system is: 3 mul of PCR amplification product, 0.2 mul of BclI endonuclease, 3.11 mul of NEBuffer and 5.8 mul of double distilled water;
preferably, the enzyme cutting temperature is 50 ℃, and the enzyme cutting time is 2 h;
the electrophoresis refers to polyacrylamide gel electrophoresis;
preferably, the electrophoresis refers to the adoption of 6% non-denaturing polyacrylamide gel, and the electrophoresis separation is carried out for 1h and 10min at a constant power of 150V, and finally silver staining is carried out for color development.
In the test, an anti-WMV inbred line 02245 and a susceptible WMV inbred line 65G are used as materials to develop SNP markers, and the accuracy of a result marker WMV-SNP1 for molecular marker-assisted selection is 100% through verification by using 140 recombinant inbred line groups.
The test not only lays a foundation for the fine positioning and molecular cloning of the watermelon mosaic virus resistant gene wmv of the cucumber, but also provides an efficient way for the auxiliary breeding of new varieties of cucumbers resistant to the watermelon mosaic virus by utilizing molecular markers. The invention provides a method for auxiliary screening of a new cucumber variety with watermelon mosaic virus resistant genes based on the developed SNP markers. In the method, the SNP10862245 specific primer is adopted to amplify the DNA of a material to be detected, and then the amplified product is sequenced and enzyme-cut. The method provided by the invention can be used for screening the watermelon mosaic virus resistance of the candidate cucumber material at any stage, and has the advantages of high efficiency, less limitation and accuracy.
Drawings
FIG. 1 shows an embodiment of the invention provides a cucumber anti-watermelon mosaic virus gene WMV-SNP1 pair SNP marker WMV-SNP 65G (P) of cucumber parent material1)，02245(P2) And F thereof1Detecting the result of the generation individual plant; p1: 65G (susceptible to watermelon mosaic virus); p2: 02245 (against watermelon mosaic virus).
FIG. 2 shows the results of testing 140 cucumber recombinant inbred line populations with the kit for identifying the watermelon mosaic virus resistance gene wmv according to another embodiment of the present invention.
Detailed Description
The present invention will be described in further detail with reference to specific embodiments, but the scope of the present invention is not limited thereto. Unless otherwise specified, the procedures used in the following examples are conventional, and all reagents used are commercially available.
Sources or documentations of biological materials
The test material used in this study was 65G (P)1)，02245(P2) And 140 parts of the population material. The group material is prepared by an application laboratory and used for researching virus resistance genes, the parents of the group material are 65G and 02245, and the applicant declares that the group material is issued to the public for verifying the effect of the invention within 20 years from the application date of the invention.
65G is European greenhouse cucumber, watermelon mosaic virus. The laboratory has storage to ensure that the laboratory is released to the public for verification experiments within twenty years from the application date.
02245 is North China Stichopus japonicus type cucumber with resistance to watermelon mosaic virus. The laboratory has storage to ensure that the laboratory is released to the public for verification experiments within twenty years from the application date.
dCAPS-BclI labeled primers were designed in this laboratory based on genome information from resequencing using dCAPSFinder software and Primer 3.0 software.
Primary reagent
PCR experiments were carried out using 2X 3G Taq Master Mix for PAGE (Red Dye) from Vazyme; the restriction enzyme BclI of NEBuffer 3.1 is used for enzyme digestion; gel electrophoresis was performed using 40% non-denatured polyacrylamide from Ku Laibobu technologies, Beijing, and was diluted to 6% for use. Sequencing was performed at the Producer company.
In the previous study we used 5 Indel markers to locate the cucumber gene wmv against watermelon mosaic virus on chromosome 6 between markers UW080853 and Indel3, which is a physical distance of 28.5kb, and based on the above results, the present inventors have conducted further studies.
Experimental example 1 obtaining of SNP marker linked to watermelon mosaic Virus disease resistance Gene of cucumber
Combining the data of cucumber genome sequence and the data of amphiphilic re-sequencing, analyzing and positioning SNP in the region by using bioinformatics and the phenotypic identification of genetic population, finding out SNP10862245G/A, and finding out that the SNP is in the cucumber parent material 02245 (P)2) In the genome, the base of the site is G; in material 65G (P)1) In the genome, this base is A.
Based on the obtained SNP marker SNP10862245 linked with the watermelon mosaic virus disease resistance gene of the cucumber, a dCAPS marker (named dCAPS-BclI) linked with the watermelon mosaic virus disease resistance gene of the cucumber is developed. Wherein the forward and reverse primers are respectively:
dCAPS-BclI-F：AACTGCGAATGACTTTTGATC(SEQ ID NO.4)
dCAPS-BclI-R：AGAAAGCAAGCAACGACACG(SEQ ID NO.5)
due to the relationship of the obtained SNPs (SNP ═ G/A), when the base A exists, a recognition sequence of the endonuclease BclI is formed (T ↓ GATCA, ↓ is used as an enzyme cutting site), and the amplified fragment can be cut by the endonuclease BclI; when the base G is present, an endonuclease recognition sequence cannot be formed, and the amplified fragment cannot be cleaved by the endonuclease BclI.
PCR amplification is carried out on the parent material through the primer (dCAPS-BclI-F/dCAPS-BclI-R), and the amplified fragment is cut by combining with endonuclease BclI to obtain a specific band, wherein a band of 218bp is obtained in the material 02245 (resisting watermelon mosaic virus), and a band of 201bp is obtained in the material 65G (susceptible watermelon mosaic virus).
The specific operation method comprises the following steps:
step 1.DNA extraction and PCR amplification
Extracting young leaf of cucumber plant with improved CTAB (cetyl trimethyl ammonium bromide) method to obtain parent 65G (P)1)、02245(P2)、F1And 140 parts of genomic DNA of each individual plant of the recombinant inbred line population.
The dCAPS labeled PCR reaction system is as follows: total reaction 10. mu.L, 3. mu.L of DNA (5.0 ng. mu.L)-1) Forward and reverse primers (50 ng. mu.L)-1) mu.L of each, 5. mu.L of 2X 3G Taq Master Mix for PAGE (Red Dye) (product of Vazyme).
The PCR amplification procedure was: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15 seconds, annealing at 55 ℃ for 15 seconds, extension at 72 ℃ for 30 seconds, and 35 cycles; the incubation was carried out at 72 ℃ for 5 minutes and at 10 ℃ for forever.
Step 2.BclI complete enzyme digestion PCR product
The enzyme cutting system is as follows: mu.l of PCR product, 0.2. mu.l of endonuclease, 1. mu.l of NEBuffer and 5.8. mu.l of double distilled water. The enzyme cutting temperature is 50 ℃, and the enzyme cutting time is 2 h.
Step 3. result judgment
The method comprises the following steps: skipping step 2, directly sequencing the PCR product without enzyme digestion. 02245 (against watermelon mosaic virus) has a G at base position 22; the base of the sequence obtained by 65G (watermelon mosaic virus) at position 22 is A; f1The resulting sequence has two bases at this position, G and A being present simultaneously.
The second method comprises the following steps: completely digesting with endonuclease, separating the digested product with 6% non-denatured polyacrylamide gel, electrophoresis buffer solution of 0.5 × TBE, electrophoresis separation at 150V constant power for 1h10min, silver staining for color development after electrophoresis, and counting banding patterns.
02245 (anti watermelon flower)Leaf virus disease) to obtain a fragment of 218bp, and the banding pattern is marked as a; 65G (watermelon mosaic virus) obtains a 201bp fragment band pattern and marks as b; f1The two bands are detected simultaneously, the band type of the band is recorded as h, the genotype and the phenotype of the heterozygous band type are the cucumber watermelon mosaic virus resistance, because the cucumber watermelon mosaic virus resistance gene wmv is recessive inheritance, the band type is disease resistance, and the band type is b or h.
Experimental example 2 verification of SNP marker of wmv Gene
The marker WMV-SNP1 linked to the WMV gene obtained in example 1 was verified using 140 parts of the recombinant inbred line material saved in this subject to determine the accuracy of the marker for molecular marker assisted selection: the banding patterns marked in 140 parts of the materials of the recombined inbred line are highly consistent with the disease-resistant phenotype compared with the disease-resistant phenotype of the selected materials, and the calculated correct rate is 100%. The amplified bands are shown in FIG. 2.
SEQUENCE LISTING
<110> vegetable and flower institute of Chinese academy of agricultural sciences
<120> SNP marker linked with cucumber anti-watermelon mosaic virus gene wmv, kit and method thereof
<130> P200703/SCH
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 218
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP marker fragment linked with cucumber anti-watermelon mosaic virus gene wmv
<400> 1
aactgcgaat gactttggat cggagataat ccctttctca gcaagagaat tcttgatgaa 60
ggtaggcctt attagagatt tttcaatgct tttgctcgtg ttatgtttta gataagcatg 120
aggtttaaac tcaaaagcag ttggttatga gaagagtaac ccgtgtatta tctttttgat 180
gtgagatttc aacatacacg tgtcgttgct tgctttct 218
<210> 2
<211> 218
<212> DNA
<213> Artificial Sequence
<220>
<223> SNP marker fragment linked to cucumber mosaic virus gene wmv of watermelon
<400> 2
aactgcgaat gactttggat cagagataat ccctttctca gcaagagaat tcttgatgaa 60
ggtaggcctt attagagatt tttcaatgct tttgctcgtg ttatgtttta gataagcatg 120
aggtttaaac tcaaaagcag ttggttatga gaagagtaac ccgtgtatta tctttttgat 180
gtgagatttc aacatacacg tgtcgttgct tgctttct 218
<210> 3
<211> 201
<212> DNA
<213> Artificial Sequence
<220>
<223> fragment sequence of SNP marker fragment enzyme-digested linked with cucumber watermelon mosaic virus gene wmv
<400> 3
gatcagagat aatccctttc tcagcaagag aattcttgat gaaggtaggc cttattagag 60
atttttcaat gcttttgctc gtgttatgtt ttagataagc atgaggttta aactcaaaag 120
cagttggtta tgagaagagt aacccgtgta ttatcttttt gatgtgagat ttcaacatac 180
acgtgtcgtt gcttgctttc t 201
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> dcaps-BclI-F
<400> 4
aactgcgaat gacttttgat c 21
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> dcaps-BclI-R
<400> 5
agaaagcaag caacgacacg 20
Claims (18)
1. Watermelon mosaic virus resistant gene of cucumberwmvIdentification of watermelon mosaic virus resistance gene of cucumber by linked SNP markerwmvThe method is characterized in that the SNP marker and the watermelon mosaic virus resistance gene of cucumberwmvThe nucleotide sequence of the linked characteristic fragment is shown as Seq ID No. 1; the SNP marker has G/A single nucleotide polymorphism at the 22 nd base site of the sequence shown in Seq ID No. 1.
2. The gene of claim 1 for resisting watermelon mosaic virus of cucumberwmvIdentification of watermelon mosaic virus resistance gene of cucumber by linked SNP markerwmvThe application of the aspect is characterized in that the nucleotide sequences of the upstream primer and the downstream primer which can amplify the SNP marker fragment are respectively shown as SEQ ID NO.4 and SEQ ID NO. 5.
3. Detection of watermelon mosaic virus resistance gene of cucumberwmvMethod for preparing and identifying watermelon mosaic virus resistant gene of cucumber by using primer of linked SNP markerwmvThe use of the kit according to (1), wherein the SNP marker isWatermelon mosaic virus resistant gene of cucumberwmvThe nucleotide sequence of the linked characteristic fragment is shown as Seq ID No. 1; the SNP marker has G/A single nucleotide polymorphism at the 22 nd base site of the sequence shown in Seq ID No. 1.
4. The method for detecting watermelon mosaic virus resistance gene of cucumber according to claim 3wmvMethod for preparing and identifying watermelon mosaic virus resistant gene of cucumber by using primer of linked SNP markerwmvThe kit of (1), wherein the upstream and downstream sequences of the primer are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.
5. The method of claim 3 or 4 for detecting watermelon mosaic virus resistance gene of cucumberwmvMethod for preparing and identifying watermelon mosaic virus resistant gene of cucumber by using primer of linked SNP markerwmvThe use of the kit of (1), wherein the kit further comprises PCR reagents, and/or electrophoresis reagents.
6. The method for detecting watermelon mosaic virus resistance gene of cucumber according to claim 5wmvMethod for preparing and identifying watermelon mosaic virus resistant gene of cucumber by using primer of linked SNP markerwmvThe kit of (1), wherein the PCR reagent is: taq enzyme, PCR buffer solution and dNTP.
7. The method of claim 6 for detecting and detecting watermelon mosaic virus resistance gene of cucumberwmvMethod for preparing and identifying watermelon mosaic virus resistant gene of cucumber by using primer of linked SNP markerwmvThe kit according to (1), wherein the PCR reagent is 3G Taq Master Mix for PAGE (Red Dye).
8. The method for detecting watermelon mosaic virus resistance gene of cucumber according to claim 5wmvMethod for preparing and identifying watermelon mosaic virus resistant gene of cucumber by using primer of linked SNP markerwmvThe use of the aspect of a kit of (1), the electrophoresis reagent comprising: electrophoresis buffer, polyacrylamide gel.
9. The method for detecting and detecting watermelon mosaic virus resistance gene of cucumber according to any one of claims 3, 4, 6 and 8wmvMethod for preparing and identifying watermelon mosaic virus resistant gene of cucumber by using primer of linked SNP markerwmvThe kit is characterized by further comprising BclI enzyme restriction enzyme, enzyme digestion buffer solution and double distilled water.
10. Identification of watermelon mosaic virus resistance gene of cucumberwmvThe method is characterized in that the gene capable of amplifying and resisting watermelon mosaic virus of cucumber is adoptedwmvCarrying out PCR amplification on the DNA of the cucumber material to be detected by the primer of the linked SNP marker; the SNP marker and the watermelon mosaic virus resistance gene of cucumberwmvThe nucleotide sequence of the linked characteristic fragment is shown as Seq ID No. 1; the SNP marker is characterized in that the 22 nd base site of the sequence shown by the Seq ID No.1 has G/A single nucleotide polymorphism;
the identification of watermelon mosaic virus resistance gene of cucumberwmvThe method of (2) further comprises: sequencing or enzyme digestion electrophoresis is carried out on the PCR amplification product;
the sequencing result is shown as Seq ID No.1, or the genotype and phenotype of the cucumber material to be detected with the band of 218bp appearing in the enzyme digestion electrophoresis result are the watermelon mosaic virus resistant geneswmv；
The sequencing result is shown as Seq ID No.2, or the genotype and the phenotype of the cucumber material to be detected with 201bp bands appearing in the enzyme cutting electrophoresis result are the watermelon mosaic virus-sensitive genesWmv。
11. The method for identifying watermelon mosaic virus resistance gene of cucumber according to claim 10wmvThe method of (3), wherein said PCR amplification system per microliter comprises: 0.75ng DNA template, 5ng each of the upstream and downstream primers, 0.5. mu.l 2X 3G Taq Master Mix for PAGE (Red Dye); the 2X 3G Taq Master Mix for PAGE (Red Dye) was purchased from Vazyme.
12. The method for identifying watermelon mosaic virus resistance gene of cucumber according to claim 11wmvIn the method of (a) to (b),the PCR amplification system is characterized in that: 7.5ng DNA template, 50ng each of forward and reverse primers, 5. mu.l 2X 3G Taq Master Mix for PAGE (Red Dye), double distilled water to 10. mu.l.
13. The method for identifying watermelon mosaic virus resistance gene of cucumber according to any one of claims 10-12wmvThe method of (3), wherein the PCR amplification procedure is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15 seconds, annealing at 55 ℃ for 15 seconds, and extension at 72 ℃ for 30 seconds are 1 cycle, and 35 cycles are total; the temperature was maintained at 72 ℃ for 5 minutes.
14. The method for identifying watermelon mosaic virus resistance gene of cucumber according to claim 10wmvThe method of (1), wherein the cleavage system per microliter comprises: PCR amplification product 0.3. mu.l, BclI endonuclease 0.02. mu.l, NEBuffer 3.10.1. mu.l.
15. The method for identifying watermelon mosaic virus resistance gene of cucumber as claimed in claim 14wmvThe method is characterized in that the enzyme digestion system is as follows: PCR amplification product 3. mu.l, BclI endonuclease 0.2. mu.l, NEBuffer 3.11. mu.l, double distilled water 5.8. mu.l.
16. The method for identifying watermelon mosaic virus resistance gene of cucumber according to claim 10 or 15wmvThe method is characterized in that the enzyme cutting temperature is 50 ℃, and the enzyme cutting time is 2 h.
17. The method for identifying watermelon mosaic virus resistance gene of cucumber according to claim 10wmvThe method of (1), wherein said electrophoresis is polyacrylamide gel electrophoresis.
18. The method for identifying watermelon mosaic virus resistance gene of cucumber as claimed in claim 17wmvThe method is characterized in that the electrophoresis is performed by adopting 6% non-denaturing polyacrylamide gel, performing electrophoresis separation for 1h10min at 150V constant power, and finally performing silver staining and color development.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010971420.XA CN112159861B (en) | 2020-09-16 | 2020-09-16 | SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010971420.XA CN112159861B (en) | 2020-09-16 | 2020-09-16 | SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112159861A CN112159861A (en) | 2021-01-01 |
| CN112159861B true CN112159861B (en) | 2022-05-10 |
Family
ID=73858970
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010971420.XA Active CN112159861B (en) | 2020-09-16 | 2020-09-16 | SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112159861B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115747363B (en) * | 2022-07-27 | 2023-11-17 | 中国农业科学院蔬菜花卉研究所 | SNP molecular marker for detecting resistance character of cucumber to gray mold and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104372085A (en) * | 2014-11-03 | 2015-02-25 | 中国农业科学院蔬菜花卉研究所 | Indel marker of WMV (watermelon mosaic virus) resisting gene in cucumber and application thereof |
| WO2015143867A1 (en) * | 2014-03-25 | 2015-10-01 | 北京市农林科学院 | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof |
| WO2015192566A1 (en) * | 2014-06-16 | 2015-12-23 | 北京市农林科学院 | Cucumber target leaf spot resistance gene cca as well as linked molecular markers and applications thereof |
| CN107674922A (en) * | 2017-09-01 | 2018-02-09 | 中国农业科学院蔬菜花卉研究所 | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application |
-
2020
- 2020-09-16 CN CN202010971420.XA patent/CN112159861B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015143867A1 (en) * | 2014-03-25 | 2015-10-01 | 北京市农林科学院 | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof |
| WO2015192566A1 (en) * | 2014-06-16 | 2015-12-23 | 北京市农林科学院 | Cucumber target leaf spot resistance gene cca as well as linked molecular markers and applications thereof |
| CN104372085A (en) * | 2014-11-03 | 2015-02-25 | 中国农业科学院蔬菜花卉研究所 | Indel marker of WMV (watermelon mosaic virus) resisting gene in cucumber and application thereof |
| CN107674922A (en) * | 2017-09-01 | 2018-02-09 | 中国农业科学院蔬菜花卉研究所 | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application |
Non-Patent Citations (2)
| Title |
|---|
| 与黄瓜感花叶病毒病基因连锁的分子标记;张桂华等;《农业生物技术学报》;20100428(第02期);84-88页 * |
| 黄瓜抗西瓜花叶病毒性状的序列特征性扩增区域(SCAR)标记;张海英等;《农业生物技术学报》;20090415(第02期);134-138页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112159861A (en) | 2021-01-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN109762920B (en) | SNP marker tightly linked with cucumber fruit thorny gene ns and application thereof | |
| CN109628627A (en) | The SNP marker development and application of broad-spectrum rice-blast resistant gene of paddy rice Pigm | |
| CN107723378A (en) | The seedless main effect QTL site SDL of grape fruit SNP marker and application | |
| CN103184220B (en) | Gene specific molecular marker Pi50N4s for rice blast resistance gene Pi50 and preparation method and application of Gene specific molecular marker Pi50N4s | |
| CN116064904A (en) | Molecular marker closely linked with wheat stem rot resistance QTL Qfcr.sicau.2A and application | |
| CN109628628A (en) | The development and application of the SNP marker of rice blast resistant gene Pi2 | |
| KR100753676B1 (en) | TRIM-Br1 and TRIM-Br2 DNA marker system using the same and classification method using the same | |
| CN112159861B (en) | SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof | |
| CN102747070A (en) | Two CAPs markers tightly linked with muskmelon anti-powdery mildew gene Pm-AN and its application method | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN110628930B (en) | dCAPS molecular marker for identifying panicle length character of rice and application thereof | |
| CN110055351B (en) | Molecular marker BanII-1 related to melon powdery mildew resistance and application thereof | |
| CN116103433B (en) | CAPS molecular marker for identifying rice spike length character and application thereof | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN112159862B (en) | SNP marker linked with cucumber mosaic virus resistance gene cmv as well as kit and method thereof | |
| CN107988337B (en) | Identification method of rice blast resistance rice, gene marking method and application thereof | |
| CN111793706B (en) | Cowpea InDel molecular marker detection primer group and kit | |
| CN105713983B (en) | A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage | |
| CN113943732A (en) | SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application | |
| CN112375838A (en) | T-DNA flanking sequence of transgenic sugarcane SCAG2 and transformation event specificity identification method thereof | |
| CN114369674B (en) | SNP marker linked with Indian pumpkin short vine gene CmDw-1, primer, kit and application thereof | |
| CN112094940B (en) | Indel marker linked with cucumber long hypocotyl gene lh1 as well as primer, kit and application thereof | |
| CN115198030B (en) | SSR molecular marker combination and SSR primer combination for identifying hybrid offspring of hippeastrum and application of SSR molecular marker combination and SSR primer combination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |