CN109207560A - A method of exploitation bougainvillea SSR primer is sequenced based on transcript profile - Google Patents
A method of exploitation bougainvillea SSR primer is sequenced based on transcript profile Download PDFInfo
- Publication number
- CN109207560A CN109207560A CN201811098836.4A CN201811098836A CN109207560A CN 109207560 A CN109207560 A CN 109207560A CN 201811098836 A CN201811098836 A CN 201811098836A CN 109207560 A CN109207560 A CN 109207560A
- Authority
- CN
- China
- Prior art keywords
- primer
- degree
- ssr
- bougainvillea
- seconds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of methods that exploitation bougainvillea SSR primer is sequenced based on transcript profile, it is characterised in that the following steps are included: (1) transcript profile is sequenced；(2) SSR site primer；(3) design of primers；(4) SSR Establishing and detection.The present invention is that the method for obtaining bougainvillea SSR primer is sequenced based on transcript profile, this method has filled up the blank that bougainvillea lacks itself SSR primer, the research such as Relationship iden- tification, analysis of genetic diversity and finger-print foundation between can carrying out leaf flower variety with SSR marker, so that the marker assisted selection for bougainvillea provides theoretical foundation and technical support.
Description
Technical field
It is specifically a kind of that exploitation bougainvillea SSR primer is sequenced based on transcript profile the present invention relates to molecular biology field
Method.
Background technique
Bougainvillea (Bougainvillea spectabilia Willa), which is that Nyctaginaceae bougainvillea is evergreen, to climb up by holding on to or drapes over one's shoulders
Shrub is dissipated, originate in Brazil also known as Bougainvillea spectabilis, strangle cuckoo, precious applique etc., bougainvillea is wide in variety, the original seed of whole world bougainvillea,
Cultivar, mutation, cenospecies quantity have as many as 300 kinds, but most kinds are obtained by modes such as bud mutation or mutation breedings, and
Mostly vegetative propagation causes interracial genetic background and affiliation indefinite in addition, leaf in addition bougainvillea is alien species
The kind of son flower is usually assigned different names in different places, misapplied in production mix, mistake or unsuitable
Kind will necessarily result in the economic value of producing and selling, ornamental etc., practical value heavy losses, even relate to kind
Intellectual property law dispute, meanwhile, very burden is also brought to research work.
There is the advantages such as convenient, efficient, accurate, low in cost, SRR molecule mark based on transcript profile sequencing SSR primers development
Note can be used for the fields such as Genetic Diversity of Germplasm analysis, cultivar identification, Genetic relationship.Currently, about bougainvillea SSR
The developmental research of primer has not been reported.The present invention is by setting bougainvillea progress transcript profile sequencing, SSR site primer, primer
Meter, the foundation of SSR reaction system, primer screening and polymorphic detection, the method for obtaining bougainvillea SSR primer development, this method can
Bougainvillea Genetic Diversity of Germplasm and interracial affiliation are analyzed, provides theory for the marker assisted selection of bougainvillea
Foundation and technical support.
Summary of the invention
It is in view of the deficiencies in the prior art or insufficient, the technical problems to be solved by the present invention are: providing one kind.
The object of the present invention is to provide a kind of methods that exploitation bougainvillea SSR primer is sequenced based on transcript profile, to each step
It is rapid to carry out Exact Analysis screening, primer, detection primer polymorphism are screened in particular by Capillary Electrophoresis, obtaining 16 pairs has
The SSR primer of polymorphism.
The present invention reaches above-mentioned purpose by the following technical programs, and one kind is drawn based on transcript profile sequencing exploitation bougainvillea SSR
The method of object, includes the following steps:
(1) transcript profile is sequenced: to progress transcript profile sequencing after the blade of bougainvillea, bract, tender tip, flower mixed in equal amounts；
(2) it screens the site SSR: being based on bougainvillea transcript profile sequencing data, find microsatellite with SSR Hunter1.3；
(3) design of primers and evaluation, the major parameter that when design primer is arranged design of primers: are carried out using Primer 5
Are as follows: G/C content 40%~70%, 55~60 DEG C of annealing temperature, the long 18~25bp of primer, it is contemplated that amplified production length 120~
250bp, and without secondary structure and dimer.
(4) SSR Establishing and detection:
It selects primer pair from the batch primer of design to be synthesized, using the genomic DNA of 24 leaf flower varieties as mould
Plate is expanded using PCR program, and amplified production uses Capillary Electrophoresis, is carried out to the primer of amplifiable specific band out
Screening, filters out the SSR primer of polymorphism.
Specific screening process are as follows: first from the sequence of transcript profile, pick out microsatellite sequence, 30 sequences is then first selected to carry out
Design of primers and screening, find the primer for having polymorphism, continue later repeat this process, to the last obtain 10 pairs have it is polymorphic
The SSR primer of property
Preferably, the search criterion of microsatellite is found are as follows: repetitive unit length is 2~4bp, and number of repetition is more than or equal to 5
Secondary, mononucleotide number of repetition is more than or equal to 10 times；Dinucleotides number of repetition is more than or equal to 6 times；Three, four, five, Hexanucleotide
Number of repetition is more than or equal to 5 times.
Preferably, SSR Establishing includes PCR reaction system and PCR response procedures: in 10 μ L PCR reaction systems
0.5~0.8 μ L, 10 × PCR Buffer of primers (5uM) 1~1.1 μ L, dNTP (10mM) 0.8~1.2 μ L, Taq enzyme (5U/
μ L) 0.10~0.14 μ L, 0.8~1.2 μ L of DNA profiling, add ddH2O to 10 μ L；
PCR response procedures: 94 degree initial denaturation 2~3 minutes, 94 degree be denaturalized 30~40 seconds, 58~60 DEG C anneal 30 seconds, 72 degree
Extend 30 seconds, each circulation successively reduces by 0.5~1 degree later, and until 50~55 degree, totally 5~10 are recycled；94 degree of denaturation 30
Second, 52~55 degree are annealed 30 seconds, and 72 degree extend 30 seconds, and totally 35 recycle；Last 72 degree extend 5 minutes.
As the preferred of the technical program, SSR Establishing includes PCR reaction system and PCR response procedures are as follows:
PCR reaction system: 0.6 1 μ L of μ L, 10 × PCRBuffer of primers (5uM) in 10 μ L PCR reaction systems,
0.8 μ L of dNTP (10mM), Taq enzyme (5U/ μ L) 0.12 μ L, 1 μ L of DNA profiling add ddH2O to 10 μ L；
PCR response procedures: 94 degree initial denaturation 2 minutes, 94 degree be denaturalized 30 seconds, 60 DEG C anneal 30 seconds, 72 degree extension 30 seconds, with
Each circulation successively reduces by 1 degree afterwards, and until 55 degree, totally 5 are recycled；94 degree are denaturalized 30 seconds, and 55 degree are annealed 30 seconds, and 72 degree extend 30
Second, totally 35 recycle；Last 72 degree extend 5 minutes.
Utilize the method for exploitation bougainvillea SSR primer of the invention, the SSR primer sequence of acquisition such as SEQ ID No.1-32
It is shown.Specific this 16 pairs SSR Primers and sequence number with polymorphism are as follows:
1 16 pairs of the table SSR primers with polymorphism
| Primer | Forward direction primer | Backward primer |
| C4947g1 | ATGGAGTGGTTATGCTGGAGAT | AAACCCTTCTCGCATGCTC |
| C5034g1 | TTTCCTTGATTGGCTTCAGTCT | GCAAGACACGAGGCTGTTCAC |
| c135037g1 | CTACATTGAACCCATCAGTCCAT | CGGGTCAGAATCGGGTTAGT |
| c145994g1 | GGACTGTGGCAATTAGCCCT | ACCCATCTACTGCCATCCCT |
| c151681g1 | ACAACGCTGCTCGCAATT | CGGATATTGCGTCGCTGT |
| c146040g1 | GCAGCGTTTCAAGTTCCCTC | TTCCCCAGGGTTTCCAATCG |
| c146046g1 | CTCCTCCTAGATCGCGCAAA | GAGCTGATTCCCGGTTCGAT |
| c153588g1 | TCGAACTGGGAAAAGGCTCA | TGAAGGTGTTGATGGTGGGT |
| c153594g1 | CCGGGAATTGGTAGAGGTCG | TGCATCATTCCCCTTTGCAC |
| c156871g1 | CACGCACATGACCCCCTC | TCCTTTCCTTGACCGGAACG |
| c153918g1 | GGTGGGGCCTGCATCTTAAT | CACTCCCATCTTTCGCCACT |
| c154046g1 | CCAGAACACGAAGTGGCTCT | AGGCTAATCCCCTGCCATTT |
| c154105-g1 | ATTTTGCACCGGTTTCCCTC | AGCGAGTTTCTGCATCTTCCA |
| c154122-g1 | ATCTGAAAAGCGGCCAAAGC | TGGTTGGGTTCACTTGAGCA |
| c154205-g1 | TTCAGCACCTGCTGCCATAA | TGGGGTTGCTAATTTTGGGTTG |
| C23970g1 | CACCTTGTCCGCATCTATTTCT | GGTTAGACGCACTTGCCAGAT |
Compared with prior art, the present invention having substantive distinguishing features following prominent and marked improvement:
With this method can quick, accurate and effective SSR primers development because the most of interracial relationships of bougainvillea are closed
Be it is close, can more accurate detection primer polymorphism using Capillary Electrophoresis, it is easier to differential variety.
Detailed description of the invention
Fig. 1 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique pale reddish brown to sample light tikka leaf；
Fig. 2 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample eggplant color treasured applique；
Fig. 3 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique orange red to sample blackening leaf；
Fig. 4 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample lemon yellow treasured applique；
Fig. 5 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique purple to sample variegated leaf tower；
Fig. 6 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique bright pink to sample；
Fig. 7 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique purple to sample leafiness；
Fig. 8 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique bright red to sample polyphyll；
Fig. 9 is Capillary Electrophoresis amplification figure of the primer c145994g1 to the precious applique of sample tower orange；
Figure 10 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique orange red to sample；
Figure 11 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique purple to sample variegated leaf tower；
Figure 12 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique pale reddish brown to sample floral leaf；
Figure 13 is the Capillary Electrophoresis amplification figure that primer c145994g1 spills sample the precious applique of gold leaf orange；
Figure 14 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique purple to sample tower；
Figure 15 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample oriental cherry treasured applique；
Figure 16 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample Bright Yellow treasured applique；
Figure 17 is Capillary Electrophoresis amplification figure of the primer c145994g1 to the dark red precious applique of sample wrinkle leaf；
Figure 18 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample gold heart treasured applique；
Figure 19 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique white to sample light leaf leafiness；
Figure 20 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique dark red to sample great Hua；
Figure 21 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample powder make-up treasured applique；
Figure 22 is the Capillary Electrophoresis amplification figure of primer c145994g1 precious applique dark purple to sample great Hua；
Figure 23 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample Snow White；
Figure 24 is Capillary Electrophoresis amplification figure of the primer c145994g1 to sample famille rose.
Specific embodiment
Technical solution of the present invention is described further below by way of specific embodiment.
Embodiment 1
The method of the present invention that exploitation bougainvillea SSR primer is sequenced based on transcript profile, includes the following steps:
(1) transcript profile is sequenced: to progress transcript profile sequencing after the blade of bougainvillea, bract, tender tip, flower mixed in equal amounts.
(2) it screens the site SSR: being based on bougainvillea transcript profile sequencing data, find microsatellite with SSR Hunter1.3, search
Rope standard are as follows: repetitive unit length is 2~4bp, and number of repetition is no less than 5 times, mononucleotide number of repetition at least 10 times；Two cores
Thuja acid number of repetition at least 6 times；Three, four, five, Hexanucleotide number of repetition at least 5 times.
(3) design of primers and evaluation, the major parameter that when design primer is arranged design of primers: are carried out using Primer 5
Are as follows: G/C content 40%~70%, 55~60 DEG C of annealing temperature, the long 18~25bp of primer, it is contemplated that amplified production length 120~
250bp, and without secondary structure and dimer.
(4) SSR Establishing: 1. 0.6 μ L, 10 × PCR Buffer 1 of primers (5uM) in 10 μ L PCR reaction systems
μ L, dNTP (10mM) 0.8 μ L, Taq enzyme (5U/ μ L) 0.12 μ L, 1 μ L of DNA profiling add ddH2O to 10 μ L.2. 94 degree of initial denaturations
2 minutes, 94 degree were denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 degree extend 30 seconds, and each circulation successively reduces by 1 degree later, until 55
Degree, totally 5 recycle.94 degree are denaturalized 30 seconds, and 55 degree are annealed 30 seconds, and 72 degree extend 30 seconds, and totally 35 recycle.72 degree extend 5 minutes.
(5) it primer screening and polymorphic detection: primer screening and polymorphic detection: is selected from the batch primer of design
147 pairs synthesize, using the genomic DNA of 24 leaf flower varieties as template, using Capillary Electrophoresis to primer validity into
Row verifying, wherein having the amplifiable specific band out of 50 pairs of primers, wherein screening the primer with polymorphism has 16 pairs.
24 bougainvillea variety names are as follows:
2 24 leaf flower varieties of table
| Serial number | Leaf flower variety material Chinese | Serial number | Leaf flower variety material Chinese |
| 1 | The pale reddish brown precious applique of light tikka leaf | 13 | Bright pink treasured applique |
| 2 | Bright Yellow treasured applique | 14 | The precious applique of leafiness purple (leaflet grey violet) |
| 3 | The dark red precious applique of the leaf that wrinkles | 15 | The bright red precious applique of polyphyll |
| 4 | Golden heart treasured applique | 16 | The precious applique of tower orange |
| 5 | The white precious applique of light leaf leafiness | 17 | Orange red treasured applique |
| 6 | The dark red precious applique of great Hua | 18 | The purple precious applique of variegated leaf tower |
| 7 | Powder make-up treasured applique | 19 | The pale reddish brown precious applique of floral leaf |
| 8 | The dark purple precious applique of great Hua | 20 | Spill the precious applique of gold leaf orange |
| 9 | Eggplant color treasured applique | 21 | The purple precious applique of tower |
| 10 | The orange red precious applique of blackening leaf | 22 | Oriental cherry treasured applique |
| 11 | Lemon yellow treasured applique | 23 | Snow White |
| 12 | The purple precious applique of variegated leaf tower | 24 | It is carmine |
Embodiment 2
(1) transcript profile is sequenced: to progress transcript profile sequencing after the blade of bougainvillea, bract, tender tip, flower mixed in equal amounts.
(2) it screens the site SSR: being based on bougainvillea transcript profile sequencing data, find microsatellite with SSR Hunter1.3, search
Rope standard are as follows: repetitive unit length is 2~4bp, and number of repetition is no less than 5 times, mononucleotide number of repetition at least 10 times；Two cores
Thuja acid number of repetition at least 6 times；Three, four, five, Hexanucleotide number of repetition at least 5 times.
(3) design of primers and evaluation, the major parameter that when design primer is arranged design of primers: are carried out using Primer 5
Are as follows: G/C content 40%~70%, 55~60 DEG C of annealing temperature, the long 18~25bp of primer, it is contemplated that amplified production length 120~
250bp, and without secondary structure and dimer.
(4) SSR Establishing: 1. 0.5 μ L, 10 × PCR Buffer of primers (5uM) in 10 μ L PCR reaction systems
1.1 μ L, dNTP (10mM) 0.9 μ L, Taq enzyme (5U/ μ L) 0.10 μ L, 1.2 μ L of DNA profiling add ddH2O to 10 μ L.2. 94 degree
Initial denaturation 3 minutes, 94 degree were denaturalized 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 degree extend 30 seconds, and each circulation successively reduces by 0.5 degree later,
Until 50 degree, totally 10 are recycled.94 degree are denaturalized 30 seconds, and 54 degree are annealed 30 seconds, and 72 degree extend 30 seconds, and totally 35 recycle.72 degree are prolonged
It stretches 5 minutes.
(5) it primer screening and polymorphic detection: primer screening and polymorphic detection: is selected from the batch primer of design
147 pairs synthesize, using the genomic DNA of 24 leaf flower varieties (with embodiment 1) as template, using Capillary Electrophoresis to drawing
Object validity is verified, wherein having the amplifiable specific band out of 37 pairs of primers, wherein screening the primer with polymorphism
There are 6 pairs.
Embodiment 3
(1) transcript profile is sequenced: to progress transcript profile sequencing after the blade of bougainvillea, bract, tender tip, flower mixed in equal amounts.
(2) it screens the site SSR: being based on bougainvillea transcript profile sequencing data, find microsatellite with SSR Hunter1.3, search
Rope standard are as follows: repetitive unit length is 2~4bp, and number of repetition is no less than 5 times, mononucleotide number of repetition at least 10 times；Two cores
Thuja acid number of repetition at least 6 times；Three, four, five, Hexanucleotide number of repetition at least 5 times.
(3) design of primers and evaluation, the major parameter that when design primer is arranged design of primers: are carried out using Primer 5
Are as follows: G/C content 40%~70%, 55~60 DEG C of annealing temperature, the long 18~25bp of primer, it is contemplated that amplified production length 120~
250bp, and without secondary structure and dimer.
(4) SSR Establishing: 1. 0.8 μ L, 10 × PCR Buffer of primers (5uM) in 10 μ L PCR reaction systems
1.2 μ L, dNTP (10mM) 1.2 μ L, Taq enzyme (5U/ μ L) 0.14 μ L, 0.8 μ L of DNA profiling add ddH2O to 10 μ L.2. 94 degree
Initial denaturation 2 minutes, 94 degree were denaturalized 40 seconds, and 65 DEG C are annealed 30 seconds, and 72 degree extend 30 seconds, and each circulation successively reduces by 1 degree later, directly
To 50 degree, totally 15 are recycled.94 degree are denaturalized 30 seconds, and 52 degree are annealed 30 seconds, and 72 degree extend 30 seconds, and totally 35 recycle.72 degree extend 5
Minute.
(5) primer screening and polymorphic detection: selecting 147 pairs from the batch primer of design and synthesize, with 24 leaves
The genomic DNA of sub- flower variety (with embodiment 1) is template, is verified using Capillary Electrophoresis to primer validity, wherein
There is the amplifiable specific band out of 41 pairs of primers, wherein screening the primer with polymorphism there are 9 pairs.
The above content is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it cannot be said that
Specific implementation of the invention is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, exist
Under the premise of not departing from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to of the invention
Protection scope.
SEQUENCE LISTING
<110>Inst. of Forestry Science, Guangxi Zhuang Autonomous Region
<120>a kind of method that exploitation bougainvillea SSR primer is sequenced based on transcript profile
<130> 2018
<160> 32
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>artificial sequence
<400> 1
atggagtggt tatgctggag at 22
<210> 2
<211> 19
<212> DNA
<213>artificial sequence
<400> 2
aaacccttct cgcatgctc 19
<210> 3
<211> 22
<212> DNA
<213>artificial sequence
<400> 3
tttccttgat tggcttcagt ct 22
<210> 4
<211> 21
<212> DNA
<213>artificial sequence
<400> 4
gcaagacacg aggctgttca c 21
<210> 5
<211> 23
<212> DNA
<213>artificial sequence
<400> 5
ctacattgaa cccatcagtc cat 23
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
cgggtcagaa tcgggttagt 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
ggactgtggc aattagccct 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
acccatctac tgccatccct 20
<210> 9
<211> 18
<212> DNA
<213>artificial sequence
<400> 9
acaacgctgc tcgcaatt 18
<210> 10
<211> 18
<212> DNA
<213>artificial sequence
<400> 10
cggatattgc gtcgctgt 18
<210> 11
<211> 20
<212> DNA
<213>artificial sequence
<400> 11
gcagcgtttc aagttccctc 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence
<400> 12
ttccccaggg tttccaatcg 20
<210> 13
<211> 20
<212> DNA
<213>artificial sequence
<400> 13
ctcctcctag atcgcgcaaa 20
<210> 14
<211> 20
<212> DNA
<213>artificial sequence
<400> 14
gagctgattc ccggttcgat 20
<210> 15
<211> 20
<212> DNA
<213>artificial sequence
<400> 15
tcgaactggg aaaaggctca 20
<210> 16
<211> 20
<212> DNA
<213>artificial sequence
<400> 16
tgaaggtgtt gatggtgggt 20
<210> 17
<211> 20
<212> DNA
<213>artificial sequence
<400> 17
ccgggaattg gtagaggtcg 20
<210> 18
<211> 20
<212> DNA
<213>artificial sequence
<400> 18
tgcatcattc ccctttgcac 20
<210> 19
<211> 18
<212> DNA
<213>artificial sequence
<400> 19
cacgcacatg accccctc 18
<210> 20
<211> 20
<212> DNA
<213>artificial sequence
<400> 20
tcctttcctt gaccggaacg 20
<210> 21
<211> 20
<212> DNA
<213>artificial sequence
<400> 21
ggtggggcct gcatcttaat 20
<210> 22
<211> 20
<212> DNA
<213>artificial sequence
<400> 22
cactcccatc tttcgccact 20
<210> 23
<211> 20
<212> DNA
<213>artificial sequence
<400> 23
ccagaacacg aagtggctct 20
<210> 24
<211> 20
<212> DNA
<213>artificial sequence
<400> 24
aggctaatcc cctgccattt 20
<210> 25
<211> 20
<212> DNA
<213>artificial sequence
<400> 25
attttgcacc ggtttccctc 20
<210> 26
<211> 21
<212> DNA
<213>artificial sequence
<400> 26
agcgagtttc tgcatcttcc a 21
<210> 27
<211> 20
<212> DNA
<213>artificial sequence
<400> 27
atctgaaaag cggccaaagc 20
<210> 28
<211> 20
<212> DNA
<213>artificial sequence
<400> 28
tggttgggtt cacttgagca 20
<210> 29
<211> 20
<212> DNA
<213>artificial sequence
<400> 29
ttcagcacct gctgccataa 20
<210> 30
<211> 22
<212> DNA
<213>artificial sequence
<400> 30
tggggttgct aattttgggt tg 22
<210> 31
<211> 22
<212> DNA
<213>artificial sequence
<400> 31
caccttgtcc gcatctattt ct 22
<210> 32
<211> 21
<212> DNA
<213>artificial sequence
<400> 32
ggttagacgc acttgccaga t 21
Claims (5)
1. a kind of method that exploitation bougainvillea SSR primer is sequenced based on transcript profile, which comprises the steps of:
(1) transcript profile is sequenced: to progress transcript profile sequencing after the blade of bougainvillea, bract, tender tip, flower mixed in equal amounts；
(2) it screens the site SSR: being based on bougainvillea transcript profile sequencing data, find microsatellite with SSR Hunter1.3；
(3) design of primers and evaluation, the major parameter that when design primer is arranged are as follows: GC design of primers: are carried out using Primer 5
Content 40%~70%, 55~60 DEG C of annealing temperature, the long 18~25bp of primer, it is contemplated that amplified production 120~250bp of length, and
Without secondary structure and dimer；
(4) SSR Establishing and detection:
Primer pair is selected from the batch primer of design to be synthesized, and using the genomic DNA of 24 leaf flower varieties as template, is adopted
It is expanded with PCR program, amplified production screens the primer of amplifiable specific band out, sieve through Capillary Electrophoresis
Select the SSR primer of polymorphism.
2. the method according to claim 1 that exploitation bougainvillea SSR primer is sequenced based on transcript profile, which is characterized in that seek
Look for the search criterion of microsatellite are as follows: repetitive unit length is 2~4bp, and number of repetition is more than or equal to 5 times, and mononucleotide repeats secondary
Number is more than or equal to 10 times；Dinucleotides number of repetition is more than or equal to 6 times；Three, four, five, Hexanucleotide number of repetition is more than or equal to 5
It is secondary.
3. the method according to claim 1 that exploitation bougainvillea SSR primer is sequenced based on transcript profile, which is characterized in that SSR
Establishing includes PCR reaction system and PCR response procedures:
PCR reaction system: 0.5~0.8 μ L, 10 × PCR Buffer 1 of primers (5uM) in 10 μ L PCR reaction systems~
1.1 μ L, dNTP (10mM) 0.8~1.2 μ L, Taq enzyme (5U/ μ L) 0.10~0.14 μ L, 0.8~1.2 μ L of DNA profiling, addition
DdH2O to 10 μ L；
PCR response procedures: 94 degree initial denaturation 2~3 minutes, 94 degree be denaturalized 30~40 seconds, 58~60 DEG C anneal 30 seconds, 72 degree extend
30 seconds, each circulation successively reduced by 0.5~1 degree later, and until 50~55 degree, totally 5~10 are recycled；94 degree be denaturalized 30 seconds, 52
~55 degree are annealed 30 seconds, and 72 degree extend 30 seconds, and totally 35 recycle；Last 72 degree extend 5 minutes.
4. the method according to claim 1 that exploitation bougainvillea SSR primer is sequenced based on transcript profile, which is characterized in that SSR
Establishing includes PCR reaction system and PCR response procedures:
PCR reaction system: 1 μ L, dNTP of 0.6 μ L, 10 × PCR Buffer of primers (5uM) in 10 μ L PCR reaction systems
(10mM) 0.8 μ L, Taq enzyme (5U/ μ L) 0.12 μ L, 1 μ L of DNA profiling add ddH2O to 10 μ L；
PCR response procedures: 94 degree initial denaturation 2 minutes, 94 degree be denaturalized 30 seconds, 60 DEG C anneal 30 seconds, 72 degree extend 30 seconds, later often
A circulation successively reduces by 1 degree, and until 50 degree, totally 10 are recycled.94 degree are denaturalized 30 seconds, and 55 degree are annealed 30 seconds, and 72 degree extend 30 seconds,
Totally 35 circulations.72 degree extend 5 minutes.
5. the bougainvillea SSR obtained using the method described in claim 1 that exploitation bougainvillea SSR primer is sequenced based on transcript profile
Primer, which is characterized in that the SSR primer sequence of acquisition is as shown in SEQ ID No.1-32.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811098836.4A CN109207560A (en) | 2018-09-19 | 2018-09-19 | A method of exploitation bougainvillea SSR primer is sequenced based on transcript profile |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811098836.4A CN109207560A (en) | 2018-09-19 | 2018-09-19 | A method of exploitation bougainvillea SSR primer is sequenced based on transcript profile |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109207560A true CN109207560A (en) | 2019-01-15 |
Family
ID=64984190
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811098836.4A Pending CN109207560A (en) | 2018-09-19 | 2018-09-19 | A method of exploitation bougainvillea SSR primer is sequenced based on transcript profile |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207560A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111455088A (en) * | 2020-05-18 | 2020-07-28 | 中国水稻研究所 | SSR molecular marker of Fusarium proliferatum and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105969767A (en) * | 2016-07-18 | 2016-09-28 | 黄冈师范学院 | SSR molecular marker primer based on transcriptome data of azalea as well as screening method and application of SSR molecular marker primer |
| CN106754886A (en) * | 2017-01-19 | 2017-05-31 | 北京林业大学 | Based on the method that transcription sequencing obtains black fruit fructus lycii SSR primers |
| CN107201408A (en) * | 2017-07-15 | 2017-09-26 | 中国热带农业科学院南亚热带作物研究所 | A kind of method that exploitation sisal hemp SSR primers are sequenced based on transcript profile |
| CN107604094A (en) * | 2017-11-10 | 2018-01-19 | 福建省农业科学院作物研究所 | Cauliflower SSR primers based on transcript profile sequencing exploitation |
-
2018
- 2018-09-19 CN CN201811098836.4A patent/CN109207560A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105969767A (en) * | 2016-07-18 | 2016-09-28 | 黄冈师范学院 | SSR molecular marker primer based on transcriptome data of azalea as well as screening method and application of SSR molecular marker primer |
| CN106754886A (en) * | 2017-01-19 | 2017-05-31 | 北京林业大学 | Based on the method that transcription sequencing obtains black fruit fructus lycii SSR primers |
| CN107201408A (en) * | 2017-07-15 | 2017-09-26 | 中国热带农业科学院南亚热带作物研究所 | A kind of method that exploitation sisal hemp SSR primers are sequenced based on transcript profile |
| CN107604094A (en) * | 2017-11-10 | 2018-01-19 | 福建省农业科学院作物研究所 | Cauliflower SSR primers based on transcript profile sequencing exploitation |
Non-Patent Citations (1)
| Title |
|---|
| 鲁亚静等: "叶子花SSR-PCR体系的优化", 《安徽农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111455088A (en) * | 2020-05-18 | 2020-07-28 | 中国水稻研究所 | SSR molecular marker of Fusarium proliferatum and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106676102B (en) | One kind SNP marker relevant to arachidonic acid content in Seed of Camellia oleifera grease and its application | |
| CN107385071A (en) | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN108374054B (en) | Rice SSR molecular markers suitable for capillary electrophoresis detection technology and application thereof | |
| CN109762921A (en) | For detecting the SNP marker and its application of cucumber pulp colour | |
| CN102965443A (en) | Method for identifying purity of tobacco variety Zhongyan 90 by using specific molecular marker method | |
| CN109762920A (en) | The SNP marker and its application of cucumber fruits thorniness gene ns close linkage | |
| CN105506163A (en) | SNP molecular marker for identifying and controlling purple character formation of Chinese cabbages and application thereof | |
| CN106701926A (en) | Mapping of eggplant fruit color epistatic gene D, and InDel molecular marker development and application thereof | |
| CN104099414A (en) | Method for marking and identifying apricot species by adopting SSR molecule | |
| CN113832243A (en) | Core SNP marker for tea tree variety identification based on KASP technology development | |
| CN109652587A (en) | A method of Chinese ilex germplasm is identified using the SSR molecular marker of transcript profile sequencing | |
| CN111808983B (en) | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof | |
| CN109385466A (en) | The KASP Functional marker of resistance gene of rice blast Pi2 a kind of and its application | |
| CN107338318A (en) | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN114381540B (en) | Primer composition, kit and method for compound identification of polymorphic genetic markers of cannabis sativa | |
| CN106520762A (en) | Molecular marks closely linked to glomerella leaf spot resistant genetic loci of apple and application | |
| CN109207560A (en) | A method of exploitation bougainvillea SSR primer is sequenced based on transcript profile | |
| CN105713981A (en) | Method for performing germplasm identification on kernel-using apricots by SSR (simple sequence repeat) molecular markers | |
| CN110004247A (en) | A kind of SSR kit of Rapid identification opium poppy | |
| CN110063253A (en) | A kind of method of breeding high-yield shiny-leaved yellowhorn strain | |
| CN104894276A (en) | Molecular marker method for rapidly identifying suitability of tea germplasms for manufacture of oolong | |
| CN106939351A (en) | Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character | |
| CN104450888A (en) | Marihuana DNA fluorescent multiplex amplification system | |
| CN108411029B (en) | The long green No. 2 hybrid seed purities identification specific marker of balsam pear and method | |
| CN116716426A (en) | SSR molecular marker primer combination based on aquilaria sinensis genome, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190115 |
|
| WD01 | Invention patent application deemed withdrawn after publication |