CN106939351A - Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character - Google Patents
Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character Download PDFInfo
- Publication number
- CN106939351A CN106939351A CN201710303936.5A CN201710303936A CN106939351A CN 106939351 A CN106939351 A CN 106939351A CN 201710303936 A CN201710303936 A CN 201710303936A CN 106939351 A CN106939351 A CN 106939351A
- Authority
- CN
- China
- Prior art keywords
- knurl
- fruit
- cucumber
- character
- molecular labeling
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of dominant molecular labeling of quick screening cucumber with/without fruit knurl character, it is characterised in that:Y177 is named as, is made up of 359 nucleotides in sequence table shown in SEQ ID NO.1, has fruit knurl kind to contain this 359 nucleotides, knurl of having no result kind does not contain this 359 nucleotides.The dominant molecular labeling just can screen quickly in seedling stage, identify knurl/without knurl cucumber fruits type, and then shorten breeding cycle, accelerate breed cucumber process.
Description
Technical field
The present invention relates to the molecular labeling of gene engineering technology field, specifically develop be one just can be fast in seedling stage
Speed screening, identification have knurl/dominant molecular labeling without knurl cucumber fruits type.
Background technology
Cucumber (Cucumissativus L.) is that Curcurbitaceae (Cucurbitaceae) Cucumis (cucumis) is overgrow for 1 year
Herbaceous plant, cucumber is as one of big important vegetable crop in the world ten, and being also that China is main plants one of vegetable crop.
Fruit is the most important part of cucumber economic characters, and cucumber fruits belong to Peponidium, by ovary and holder symbiotic developmental
Form.It is fruit knurl to have an important character in cucumber fruits, and fruit knurl is the strumae on cucumber fruits surface.Fruit knurl character
It is one of very important economical character of cucumber crop, it is thorn above the strumae of fruit surface, knurl to be, this character is
The character that common ground family crop such as model organism arabidopsis, paddy rice and muskmelon, watermelon and wax gourd etc. does not have.Fruit knurl base
The research of cause is started from 1913, there is the wild characters that fruit knurl is cucumber, and fruit knurl character is by Tu (Tuberculate fruit) base
Because of regulation and control, it is dominant to have fruit knurl (Tu), and knurl of having no result (Tu) is recessiveness.On classical genetic map, fruit tumor gene (Tu,
Tuberculate fruit) with matt peel gene (D) and consistent fruit colour gene (u, uniform immature
Fruit color) close linkage is together.Cao Chenxing shows control stem, leaf, fruit by the genetic analysis result of segregating population
There is Recessive epistatic effect (the Cucumis sativus stems such as Cao Chenxing to the fruit tumor gene for controlling fruit knurl character in the hairless gene of epidermal hair character
The hairless character of leaf pierces the genetic affinity gardening journals of character, 2001,28 (6) with fruit knurl:565-566).Therefore, fruit tumor gene
Tu research will be helpful to disclose the molecular mechanism of cucumber fruit thorniness gene formation, be that cucumber heredity and breeding work lay the foundation.
Zhang Weiwei in 2009 etc. show that cucumber fruit knurl character belongs to single gene dominant character, utilizes 247 F2Colony will fruit
Tumor gene Primary Location is between SSR marker 16203 and SCAR mark C_SC933, and genetic distance is respectively 1.3cM and 5.9cM,
Detailed results may refer to:Zhang W W etc. exist《Theoretical and Applied Genetics》(theory application heredity
Learn) the 3rd 645-654 pages of the phase of volume 120 in 2009 deliver it is entitled《Identification and mapping of
molecular markers linked to the tuberculate fruit gene in the cucumber
(Cucumissativus L.)》(cucumber fruit tumor gene compact linkage molecule marks Primary Location) one text, above-mentioned mark is also present
Analyze colony relatively small, linkage distance relatively far away from the problems such as, there is more than 100 candidate gene in candidate interval, also not right
Candidate gene approach.2014, Yang X Q etc. utilized map based cloning skill using using the big colony of 2808 plants of F2 (S06 × S52)
Art is by the Tu assignments of genes gene mapping in the 5th chromosome physical distance 41.6kb is interval, and two candidate genes are contained in the candidate region, leads to
Cross analysis and determine that Csa016861 genes are fruit tumor gene, detailed results may refer to 2014 1034-1046 pages of volume 78 deliver
《Tuberculate fruit gene Tu encodes a C2H2zinc finger proteinthat is required
for the warty fruit phenotype in cucumber(Cucumissativus L.)》One text.
With the improvement of people ' s living standards, quality breeding has mentioned critical positions.Cucumber fruits thorn knurl character belongs to sense
See quality category.The cucumber of American-European greenhouse is have no result knurl, the pericarp that pierces less, is called Fruit Cucumber, its market price is
2-3 times of common cucumber.The pollution of smooth in appearance cucumber is few, and easy to clean, sanitary edible is the preferable kind of pollution-free vegetable.
Fruit is the most important part of cucumber economic characters, and people concern the formalness character of cucumber fruits first, so, sense
It is the direct factor for causing consumer's desire to purchase to see character.The important economical character of cucumber fruits has a lot, such as fruit is big
Small, melon whether there is length, fruit knurl, fruit thorniness is how many, fruit glossiness, fruit colour, etc..Therefore, we in the urgent need to for
The Main Agronomic Characters for meeting China's breed cucumber target conduct a research.With the development of molecular marking technique, using with target
Gene close linkage, the molecular labeling isolated follow the trail of objective trait, and the cucumber material with/without fruit knurl can be correctly screened in seedling stage
Material, shortens breeding cycle, accelerates breed cucumber process.
The content of the invention
It is an object of the invention to overcome the shortcomings of existing traditional breeding technology there is provided a kind of quick screening cucumber with/without
The dominant molecular labeling of fruit knurl character, the mark stability is high, highly reliable, and then can shorten breeding cycle, accelerates cucumber
With/without fruit knurl character breeding process.
To achieve the above object, the technical solution adopted by the present invention is:
Quick screening cucumber is named as Y177, by SEQ ID in sequence table with/without the dominant molecular labeling of fruit knurl character
359 nucleotides composition shown in NO.1, has fruit knurl kind to contain this 359 nucleotides, knurl of having no result kind does not contain this 359
Nucleotides.There is knurl cucumber variety to contain the dominant molecular labeling all over the world, no knurl cucumber variety does not contain the dominant molecule
Mark, the dominant molecular labeling, which can be applied to cucumber all over the world easy, quick, with high throughput, knurl/sieve without knurl type
Choosing.Wherein, the knurl kind of having no result is not hairless without knurl kind gl including mutant.
Under the dominant molecular labeling Y177 is as shown in the sense primer shown in SEQ ID NO.2 and SEQ ID NO.3
Trip primer amplification is obtained.The sense primer comes from cucumber fruit tumor gene Tu promoter region, and anti-sense primer comes from Huang
Melon and fruit tumor gene Tu CDS regions.Primer is synthesized by Shanghai life work.
Cucumber fruit tumor gene Tu cDNA regions come from the genome sequence of cucumber variety 9930 announced
Scaffold000083 and Gy14 Cucumber germplasm sequences Scaffold02633.
The present invention has knurl parent and without knurl parents acquisition F using a variety of1, F1Selfing obtains a variety of F again2Segregating population,
Determine that cucumber fruit knurl character belongs to single gene dominant character.It is present in SSR marker molecular labeling SSR42 using fruit tumor gene and divides
The sequence of 41.6kb between son mark SNP18, carries out predictive genes.This 41.6kb sequence is present in what is announced simultaneously
(http in cucumber variety 9930Scaffold000083 and Gy14 Cucumber germplasm sequence Scaffold02633://
cucumber.vcru.wisc.edu/wenglab/gy14-9930/index.html).CDNA areas wherein containing gene are set
Primer is counted, pleomorphism site is searched.Two candidate genes are contained in the candidate region, are encoding phosphoenol formula pyruvic acid carboxylic respectively
Change enzyme gene Csa016922 and C2H2Zinc finger protein gene Csa016861:Csa016922 sequences are two parent S52 (having fruit knurl)
There is no any difference between S06 (knurl of having no result), show 100% sequence homology;And Csa016861 gene orders are in amphiphilic
Very big difference is presented in this S52 and S06, and S06 lacks 4888bp fragments, i.e. S06 and lacks Csa016861, including its startup completely altogether
Zi He CDS areas.And then determine to control the Tu genes of cucumber fruit knurl character for Csa016861.According to having knurl parent and without knurl parent
Between fruit tumor gene Tu sequence difference, separately design primer development in promoter and CDS regions and go out what fruit tumor gene was isolated
Dominant molecular labeling.There is knurl/verified without knurl kind to the dominant molecular labeling by collecting a variety of world's cucumber fruits again.
The present invention has following beneficial effect:A kind of dominant molecular labeling Y177 of the present invention has fruit knurl character with cucumber
Isolate completely, quickly there can be knurl/without knurl kind (except hairless without knurl cucumber variety, because nothing by all cucumber all over the world
Hair gene plays stealthy upper effect to knurl character) kind can use this dominant molecular marker screening.The present invention gram
The drawbacks of cucumber traditional breeding method is brought is taken, although also thering is similar patent to disclose in the past, primer location one end that the present invention is designed
Positioned at Tu gene promoter regions, one end is located at Tu gene C DS positions, and the molecular labeling stability is high, highly reliable.This is dominant
Molecular labeling just can screen quickly in seedling stage, identify knurl/without knurl cucumber fruits type, and then shorten breeding cycle, accelerate
Breed cucumber process.
The many molecular marker datas being related in the present invention are in undisclosed state.
Brief description of the drawings
Fig. 1 is screening effects of the dominant molecular labeling Y177 to world's different cucumber varieties:M represents Marker DL2000;
S52 is to have knurl kind;S06 is without knurl kind;12 kinds have knurl kind dominant molecular labeling Y177 bands occur;10 kinds without knurl product
Plant and do not occur the dominant molecule Y177 slug bands.
Embodiment
The present invention is further elaborated with reference to specific embodiment.
Embodiment
First, the identification of the structure and cucumber fruit tumor gene of hereditary segregating population
1. many kinds of F2The structure of colony
Cucumber parents:There are fruit knurl self-mating system-S52, S94, knurl of having no result self-mating system-S06, SB.In order to further confirm that fruit
Knurl Heredity feature, constructs 6 cross combinations in this research:Have fruit knurl between the knurl parent that has no result-S52 × S06 and
S94×S06;Knurl of having no result and there are between fruit knurl parent-S06 × S52 and S06 × S94;Have fruit knurl and have between fruit knurl parent-S52 ×
S94;Between knurl of having no result and the knurl parent that has no result-S06 × SB.In 6 cross combination, F1Plant selfing produces F2Colony.It is same with this
When, the F of S06 × S52 and S52 × S06 cross combinations1Respectively with without knurl parent S06 and have knurl parent S52 backcrossing obtain BC1Group
Body.8 colonies include 6 F2Colony and 2 BC1Colony, chi-square analysis method is verified, finally show that cucumber fruit knurl character belongs to
In the dominant character of Dominant gene.Pass through statistical analysis F simultaneously2(S06 × gl) and F2(gl × S06) population characteristics segregation ratio
Draw, verified by chi-square analysis method, hairiness has knurl, hairiness without knurl, hairless without knurl phenotypic segregation ratio meets 9:3:4, say
Bright hairless gene plays a part of recessive epistasis to fruit tumor gene.The present invention utilizes 2808 plants of F2(S06 × S52) is used as fruit knurl base
Because of Tu finely positioning colony.
2. the identification of cucumber fruit tumor gene
2.1 Cucumber germplasm DNA extraction
Parent and F are extracted with CTAB methods2The blade STb gene of segregating population.
2.2 determine fruit tumor gene sequence
It is yellow using the cucumber variety 9930 and Gy14 announced on the basis of Zhang Weiwei etc. is to Tu gene Primary Locations
Melon genome sequence (http://cucumber.vcru.wisc.edu/wenglab/gy14-9930/index.html), can
Sequence between SCAR mark C_SC933 and SSR marker 16203 is annexed into splicing.Spliced sequence total length is 1300kb,
Tu genes are located in the region.First this 2808 plants are screened with the SCAR mark C_SC933 and SSR marker 16203 announced
The colony of finely positioning, finds out exchange strain.Using SSRHunter analysis softwares (http://www.bio-soft.net) find
SSR sites, the exploitation of SNP marker with reference to the 5th chromosome candidate region announced SNP site (http:// cucumber.genomics.org.cn/page/cucumber/mapview.jspDbKey=Cucumber&refId=5),
This research have chosen 328 SSR sites and 20 SNP sites altogether, using the software Design primers of Primer Premier 6.0,
All primers are devised greatly by the PCR amplifications screening polymorphism primer between parent S52 and S06 to 1300kb sequence analyses
Primer is measured, the primer for having polymorphism between parent is found out, the polymorphism positioned at gene both sides scans remaining exchange individual plant again, many
State property is marked to the direction step shifting that strain is gradually decreased is exchanged, and finally determines that nearest both sides mark SSR42 and SNP18 away from Tu/tu
3 and 2 exchange individual plants are there remains between gene loci respectively.The details of above-mentioned cucumber fruit tumor gene Tu chromosome walkings is as schemed
Shown in 1.All SSR marker and SNP marker PCR reaction systems are:Cucumber DNA 20ng, two-way each 0.2 μm of ol/L of primer,
200 μm of ol/L dNTPs, 2mmol/L MgCl2, 1 × Taq buffer solutions, 0.5U Taq DNA polymerases, overall reaction system is 10 μ
L, wherein Taq DNA polymerase are purchased from Promega companies.Amplification program is:94℃3min;35cycles, 94 DEG C of 20s, 55 DEG C
30s, 72 DEG C of 30s;72℃5min.
41.6kb sequences between SSR42 and SNP18 predict website by the chromogene of Cucumber germplasm the 5th, only contain
There are two candidate genes, numbering is respectively Cas016992 encoding phosphoenol formula pyruvate carboxykinase and Cas016861
C2H2Zinc finger protein.It is that Cas016992 gene orders there are not difference that the numbering between S52 and S06 is found after sequencing, numbering
To exist in S52 but being lacked completely in S06 in Cas016861, promoter sequence and cDNA sequence comprising the gene, altogether
Lack 4888bp sequences, it is thus determined that numbering be Cas016861 be control fruit knurl character fruit tumor gene, the present invention in be related to
Molecular labeling SSR marker 16203 and SCAR mark C_SC933 it is disclosed.Exist turning in detail to Zhang WW etc.
《Theoretical and Applied Genetics》(theoretical applied genetics) 2010 year the 3rd phase 645-654 of volume 120
It is entitled that page is delivered《Identification and mapping of molecular markers linked to the
tuberculate fruit gene in the cucumber(Cucumissativus L.)》(cucumber fruit tumor gene closely connects
Lock Molecular mapping) text.The molecular labeling SSR42 and SNP18 being related in the present invention are disclosed.Scheme position turning in detail to utilizing
Clone technology is by the Tu assignments of genes gene mapping in the 5th chromosome physical distance 41.6kb is interval, and two candidate's bases are contained in the candidate region
Cause, determines that Csa016861 genes are fruit tumor gene by analyzing, detailed results may refer to 2014 1034-1046 pages of volume 78
Deliver《Tuberculate fruit gene Tu encodes a C2H2zinc finger proteinthat is
required for the warty fruit phenotype incucumber(Cucumissativus L.)》One text.
According to 4888bp sequence difference difference of the fruit tumor gene Tu between S52 and S06, the present invention is set in promoter site
Count sense primer and CDS regions design anti-sense primer constitutes dominant molecular labeling Y177, as shown in SEQ ID NO.1 in sequence table
359 nucleotides composition.It is characterized in that:As the Tu gene promoter upstreams primer and SEQ ID shown in SEQ ID NO.2
Tu gene C DS region downstreams primer amplification shown in NO.3 is obtained, its amplification program:94℃5min;35cycles, 94 DEG C of 25s;
54℃25s;72℃30s;72℃5min.
Recovery, clone and the sequencing of 2.3 polymorphic bandses
Added in PCR primer at goldview fluorescent dyes 3ul, 4 DEG C and place 10min and allow dyestuff to be combined with DNA, then
Sample-loading buffer 2ul is added, is separated after mixing by 1% agarose gel electrophoresis, cutting target fragment under uviol lamp is put into
In 1.5ml centrifuge tube, reclaimed with DNA QIAquick Gel Extraction Kits, wherein DNA QIAquick Gel Extraction Kits are Shanghai life work UNIQ-10 pillars DNA
Glue reclaim kit, production number is Cat.No.SK1132.Recovery product is connected with carrier using Shanghai Shen Neng betting offices
PUCm-T vector systems.The T-vector for being connected with target fragment is converted with electric shocking method thin into E.coli DH5 α competence
On born of the same parents, the flat board that bacterium solution is spread evenly across to LB solid mediums, the flat board coated is inverted in 37 DEG C of incubator overnight incubations, chooses
Bacterium, shake bacterium and PCR bacterium solutions detection, carry out correlated series measure.
2nd, a variety of cucumber varieties verify dominant molecular labeling Y177
1st, choosing a variety of cucumber has knurl/without knurl kind
Due to speculating C2H2Zinc finger protein gene is the target gene for controlling fruit knurl character, is randomly selected from all over the world
22 cucumber self-mating system kinds pair, dominant molecular labeling Y177 is verified, wherein having without knurl kind:The S06 of Israel parent,
S46-2, S49-1, S49-2 and S51-2 of Holland, S03, S04 and S05 of Israel, Hispanic S75 and S76 are European
H34, totally 11 without knurl cucumber variety;There is knurl kind to have:The S52 of China, S94, S110, Gl, M3, M12,419 and S124-5, Korea Spro
The S53 of state, the 83G in the U.S., Japanese S66, S67 and S74, totally 13 have knurl cucumber variety.
2nd, dominant molecular labeling Y177 verifies that 24 kinds of cucumber have knurl/without knurl kind
And 13 kinds have fruit knurl kind dominant marker Y177 clear specific band occur, 11 kinds of knurl kinds of having no result do not have
There are Y177 marks (referring to Fig. 1).
Dominant molecular labeling Y177 one end primer newly developed is present in fruit tumor gene Tu promoter sequence above, and one
End primer is present in CDS regions, is verified by segregating population checking and kind, is specific PCR amplification, therefore the dominant molecule mark
Note has high stability, reliability.So the dominant molecular labeling Y177 of the present invention can quickly, with high throughput be applied in seedling stage
There is knurl/screening without knurl type (except mutant is hairless without knurl kind gl) in cucumber all over the world, and then accelerate cucumber fruit knurl
Character quality breeding process.
E.coli DH5 α bacterial strains in the present invention used in PCR primer cloning and sequencing are in document《Li Xin etc., electricity turns
Change method prepares the E.coli competent cells research of high transformation efficiency.Food and biotechnology journal, 2007,26 (6) 48~51》
Disclosed in;The E.coli DH5 α bacterial strains being related in the present invention can be obtained by disclosing commercially available commercial channel, be purchased from precious biological work
Journey (Dalian) Co., Ltd, CompanyAddress:Two street of Dalian Economic and Technological Development District northeast 19.
The above is only the preferred embodiment of the present invention, it should be pointed out that:For the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
Sequence table
<110>Jiangsu Normal University
<120>Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character
<160>3
<210> 1
<211>359
<212> DNA
<213>Cucumber(Cucumissativus L.)
<400> 1
acctccccttgcatttcctaccttccttcctttctctctctcactcttaacccttttatt 60
ttattttattttttctctctctctcttatcatcttccatttttccatggcagctctagaa 120
aaccattaccaaaccaaacaaaacaacaataatccggccaccactcgcttaaagcttttt 180
gggtttgacgttcaagaagatcttgatcaagacgattccacccccacctcctccgactca 240
ggcgccgccgttccatcctccggcgaccgcaaatacgagtgtcagtactgctatagagag 300
tttgccaattcccaagctctcggcggccaccaaaatgcccacaagaaagagcgtcaaca 359
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
acctccccttgcatttccta c 21
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
tgttgacgctctttcttgtg g 21
Claims (4)
1. a kind of quick screening cucumber is with/without the dominant molecular labeling of fruit knurl character, it is characterised in that:Y177 is named as, by sequence
359 nucleotides composition in list shown in SEQ ID NO.1, has fruit knurl kind to contain this 359 nucleotides, knurl of having no result kind
This 359 nucleotides are not contained.
2. quick screening cucumber according to claim 1 is with/without the dominant molecular labeling of fruit knurl character, it is characterised in that:
It is hairless without knurl kind gl that the knurl kind of having no result does not include mutant.
3. quick screening cucumber according to claim 1 is with/without the dominant molecular labeling of fruit knurl character, it is characterised in that:
The dominant molecular labeling Y177 is expanded as the anti-sense primer shown in the sense primer shown in SEQ ID NO.2 and SEQ ID NO.3
Increasing is obtained.
4. quick screening cucumber according to claim 3 is with/without the dominant molecular labeling of fruit knurl character, it is characterised in that:
The sense primer comes from cucumber fruit tumor gene Tu promoter region, and anti-sense primer comes from cucumber fruit tumor gene Tu's
CDS regions.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710303936.5A CN106939351A (en) | 2017-05-03 | 2017-05-03 | Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710303936.5A CN106939351A (en) | 2017-05-03 | 2017-05-03 | Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106939351A true CN106939351A (en) | 2017-07-11 |
Family
ID=59463758
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710303936.5A Pending CN106939351A (en) | 2017-05-03 | 2017-05-03 | Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106939351A (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107574258A (en) * | 2017-09-21 | 2018-01-12 | 上海交通大学 | With the soft thorn gene Ts of the cucumber fruits InDel Ts2 molecular labelings isolated and its application |
CN107586870A (en) * | 2017-09-21 | 2018-01-16 | 上海交通大学 | InDel molecular labelings and its application with the soft thorn gene Ts close linkages of cucumber fruits |
CN107586869A (en) * | 2017-09-21 | 2018-01-16 | 上海交通大学 | With the soft thorn gene Ts of the cucumber fruits InDel Ts3 molecular labelings isolated and its application |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1689886A4 (en) * | 2003-10-27 | 2008-03-26 | Fnp Corp Ltd | Molecular marker associated with cmv resistance and use thereof |
CN102925434A (en) * | 2012-10-10 | 2013-02-13 | 上海交通大学 | Dominant molecular marks cosegregation with tuberculate fruit (Tu) gene in cucumber |
CN103074338A (en) * | 2013-01-14 | 2013-05-01 | 上海交通大学 | Dominant molecular marker Y68 for screening tumorous/tumor-free Cucumis sativus fruit type |
CN104805216A (en) * | 2015-05-21 | 2015-07-29 | 山东农业大学 | Molecular marker for rapidly identifying density of spines of cucumber line, identification method and application |
-
2017
- 2017-05-03 CN CN201710303936.5A patent/CN106939351A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1689886A4 (en) * | 2003-10-27 | 2008-03-26 | Fnp Corp Ltd | Molecular marker associated with cmv resistance and use thereof |
CN102925434A (en) * | 2012-10-10 | 2013-02-13 | 上海交通大学 | Dominant molecular marks cosegregation with tuberculate fruit (Tu) gene in cucumber |
CN103074338A (en) * | 2013-01-14 | 2013-05-01 | 上海交通大学 | Dominant molecular marker Y68 for screening tumorous/tumor-free Cucumis sativus fruit type |
CN104805216A (en) * | 2015-05-21 | 2015-07-29 | 山东农业大学 | Molecular marker for rapidly identifying density of spines of cucumber line, identification method and application |
Non-Patent Citations (2)
Title |
---|
WEIWEI ZHANG等人: "Identification and mapping of molecular markers linked to the tuberculate fruit gene in the cucumber (Cucumis sativus L.)", 《THEORETICAL AND APPLIED GENETICS》 * |
XUQING YANG等人: "Tuberculate fruit gene Tu encodes a C2H2 zinc finger protein that is required for the warty fruit phenotype in cucumber (Cucumis sativus L.)", 《THE PLANT JOURNAL》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107574258A (en) * | 2017-09-21 | 2018-01-12 | 上海交通大学 | With the soft thorn gene Ts of the cucumber fruits InDel Ts2 molecular labelings isolated and its application |
CN107586870A (en) * | 2017-09-21 | 2018-01-16 | 上海交通大学 | InDel molecular labelings and its application with the soft thorn gene Ts close linkages of cucumber fruits |
CN107586869A (en) * | 2017-09-21 | 2018-01-16 | 上海交通大学 | With the soft thorn gene Ts of the cucumber fruits InDel Ts3 molecular labelings isolated and its application |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sun et al. | SSR and AFLP markers reveal low genetic diversity in the biofuel plant Jatropha curcas in China | |
CN108004344A (en) | A kind of corn whole genome SNP chip and its application | |
CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
CN106191240B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits epidermal hair character | |
CN109762920B (en) | SNP marker tightly linked with cucumber fruit thorny gene ns and application thereof | |
CN106048042B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits color traits | |
CN109929945B (en) | Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
CN108384875A (en) | A kind of and the relevant insertion/deletion site of capsicum mellow fruit color gene, molecular labeling, molecular labeling primer and application | |
CN109055395A (en) | A kind of photoperiod insensitiveness Hd1 allele and its molecular labeling and application | |
CN106939351A (en) | Dominant molecular labeling of the quick screening cucumber with/without fruit knurl character | |
CN113774161A (en) | KASP molecular marker of peanut pod and kernel size major QTL and application thereof | |
CN113637789A (en) | Wheat stripe rust resistant gene YRTD121 linked KASP molecular marker, primer, kit and application | |
CN112375839A (en) | Molecular marker related to color of melon peel and method and application thereof | |
CN110093346A (en) | With the molecular marker and application thereof of purple tsai-tai a kind of sedge color gene linkage | |
CN101481737A (en) | Molecular marker tightly linked with Cucumis sativus tumor gene Tu | |
CN108866233A (en) | For identifying marker site, primer pair, kit and application of the peach to disease-resistant/susceptible character of Meloidogyne incognita | |
CN117248069A (en) | Haplotype related to upland cotton plant height and application thereof | |
CN110004242B (en) | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
CN110358861A (en) | R13I14 is marked with rice wide spectrum high resistance to hoja blanca gene Xa45 (t) compact linkage molecule | |
CN109988863A (en) | EST-SSR for distinguishing different ecological type cloves is marked and the primer | |
CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
CN107746895A (en) | It is a kind of it is low-phosphorous under the conditions of lifted barley harvest index QTL site molecular labeling and application | |
CN107287210A (en) | A kind of paddy rice exterior quality gene qAQ7 and its molecule labelling method and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170711 |
|
RJ01 | Rejection of invention patent application after publication |