CN109161604A - A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method - Google Patents
A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method Download PDFInfo
- Publication number
- CN109161604A CN109161604A CN201810982747.XA CN201810982747A CN109161604A CN 109161604 A CN109161604 A CN 109161604A CN 201810982747 A CN201810982747 A CN 201810982747A CN 109161604 A CN109161604 A CN 109161604A
- Authority
- CN
- China
- Prior art keywords
- rabbit
- friedlander
- bacillus
- seq
- rpa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of molecular biology, and in particular to a kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method.The specific primer that the present invention is designed according to the PhoE gene order of rabbit Friedlander's bacillus, and advanced optimize the recombinase polymerase isothermal amplification method for establishing and being suitable for quick and precisely carrying out rabbit determination of Klebsiella pneumoniae.This method can specifically detect rabbit Friedlander's bacillus, and minimum detection amount of bacteria is 83CFU/mL, and remolding sensitivity normal PCR is higher by 100 times.Since whole gene amplification only needs a temperature, special instrument and equipment is not needed, is operated more simply, quickly, the field quick detection of rabbit Friedlander's bacillus suitable for producing.
Description
Technical field
The present invention relates to molecular biology field technical fields, and in particular to a kind of rabbit Friedlander's bacillus recombination polymerization
Enzyme isothermal amplification detection method.
Background technique
Rabbit e coil k 1 pneumonia disease is as caused by Friedlander's bacillus
The sporadic disease of feature.Young rabbit, adult rabbits with pneumonia and the suppurative lesion of other organs for main lesion characteristics, young rabbit with
Diarrhea is characterized.The rabbit at various ages, kind and gender has neurological susceptibility to this bacterium, but with the young rabbit in wean front and back and gestation
Female rabbit invasion rate highest, harm are also the most serious.
The common detection method of rabbit Friedlander's bacillus has tradition separation identification, immunological method, molecular biology side
Method etc..Tradition separation identification, immunological method detection process are time-consuming and laborious, and sensitivity is lower.With polymerase chain reaction
(PCR) technology be representative molecular biology method in practical applications there is also some problems, need to be by being denaturalized, annealing, prolonging
It stretches, probably needs 2~4 hours that could go out as a result, and needing accurate expensive instrument and examination in addition DNA extracts whole process
Agent, it is unfavorable to the molecular diagnosis that development at the basic level is fast and convenient.
Recombinase polymeric enzymatic amplification (Recombinase PolymeraseAmplification, RPA), being known as can
To substitute the nucleic acid detection technique of PCR.UK corporation TwistDx Inc is developed based on thisNucleic acid amplification
Product can carry out the monomolecular nucleic acid detection under room temperature in 15 minutes.Requirement of the technology to hardware device is very low, especially
Suitable for fields such as in-vitro diagnosis, animal doctor, food safety, bio-safety, agriculturals.The optimum temperature of RPA reaction is at 37 DEG C -42
Between DEG C, without denaturation, it can carry out at normal temperature.This can undoubtedly greatly speed up the speed of gene magnification.Further, since being not required to
Special temperature control device is wanted, RPA can really realize portable Rapid nucleic acid detection.But at present also not about using RPA
The report of technology detection rabbit Friedlander's bacillus.
Summary of the invention
For the above-mentioned prior art, the object of the present invention is to provide a kind of rabbit Friedlander's bacillus to recombinate polymerase isothermal
Amplification detection method.
To achieve the above object, the present invention adopts the following technical scheme:
The first aspect of the present invention, provides a kind of for detecting the genetic marker of rabbit Friedlander's bacillus, has
Sequence shown in SEQ ID NO.3.
The second aspect of the present invention provides the RPA primer pair for the above-mentioned genetic marker of specific amplification, nucleotide
Sequence is respectively as shown in SEQ ID NO.1 and SEQ ID NO.2.It is specific as follows:
Upstream primer F:5 '-TTCAACAGCGACGCAGGCAGC-3 '；(SEQ ID NO.1)
Downstream primer R:5 '-GCCGTAGTTCTTCAGCTTC-3 '.(SEQ ID NO.2)
The third aspect of the present invention provides above-mentioned RPA primer pair in the kit of preparation detection rabbit Friedlander's bacillus
In application.
The fourth aspect of the present invention provides a kind of kit for detecting rabbit Friedlander's bacillus, contains in the kit
There is above-mentioned RPA primer pair.
Further, also contain in the kit: Rehydration Buffer, template, ddH2O and MgAc.
Further, the working procedure of the kit are as follows: 40 DEG C, 15min；It is cooled to room temperature, is centrifuged after mixing, then
40℃、35min。
The fifth aspect of the present invention provides a kind of method for detecting rabbit Friedlander's bacillus, comprising the following steps:
(1) using the bacterium solution of sample to be tested as template, RPA primer pair shown in SEQ ID NO.1 and SEQ ID NO.2 is utilized
Carry out recombination polymerase isothermal duplication；
(2) product for recombinating polymerase isothermal duplication is subjected to electrophoresis, sees whether 277bp band occur；If occurring
277bp band is then judged as that rabbit Friedlander's bacillus is positive, if not occurring 277bp band, is judged as rabbit kerekou pneumonia primary
Salmonella is negative.
Preferably, in step (1), the reaction system of recombination polymerase isothermal duplication includes: SEQ ID NO.1 and SEQ ID
RPA primer shown in NO.2 each 29.5 μ L of 1.2 μ L, Rehydration Buffer, template 3 μ L, ddH2O 12.6 μ L, MgAc
2.5μL。
Preferably, in step (1), the condition of polymerase isothermal duplication is recombinated are as follows: 40 DEG C, take out after 15min, be cooled to room
Temperature；After mixing, centrifugation, reacts 35min by 40 DEG C.
Preferably, it in step (2), takes the product of 5 μ L recombination polymerase isothermal duplication to be added in 2% Ago-Gel and carries out
Electrophoresis.
The method of above-mentioned detection rabbit Friedlander's bacillus can be not only used for the detection of rabbit Friedlander's bacillus, may be used also
With investigation, the screening of rabbit Friedlander's bacillus therapeutic agent etc. for epidemiology.
Beneficial effects of the present invention:
The present invention provides the genetic markers for detecting rabbit Friedlander's bacillus, and are set according to the genetic marker
RPA primer pair has been counted, there is extraordinary specificity.Using RPA primer pair of the invention, the present invention, which advanced optimizes, to be established
It is suitable for quick and precisely carrying out the isothermal duplication genetic method of rabbit determination of Klebsiella pneumoniae.Minimum detection amount of bacteria is
83CFU/mL, remolding sensitivity normal PCR are higher.This method is easy to operate, quick, produces suitable for clinic quick with laboratory
Diagnosis.
Detailed description of the invention
Fig. 1: rabbit Friedlander's bacillus PCR detection electrophoresis result；Wherein, M- stranded DNA molecule amount 2000；1- rabbit pneumonia
Klebsiella；2- Pasteurella；3- bordetella bacilli；4- Escherichia coli；5- staphylococcus aureus；6- streptococcus；7- health
Rabbit nasal cavity cotton swab.
Fig. 2: rabbit Friedlander's bacillus weight enzymatic polymerization enzyme isothermal detection sensitivity result；Wherein, M: stranded DNA molecule amount
2000；1:8.3 × 108CFU/mL；2:8.3 × 107CFU/mL；3:8.3 × 106CFU/mL；4:8.3 × 105CFU/mL；5:8.3
×104CFU/mL；6:8.3 × 103CFU/mL；7:8.3 × 102CFU/mL；8:8.3 × 101CFU/mL；9:8.3CFU/mL.
Fig. 3: rabbit Friedlander's bacillus PCR detection sensitivity result；Wherein, M: stranded DNA molecule amount 2000；1:8.3
×108CFU/mL；2:8.3 × 107CFU/mL；3:8.3 × 106CFU/mL；4:8.3 × 105CFU/mL；5:8.3 × 104CFU/
mL；6:8.3 × 103CFU/mL；7:8.3 × 102CFU/mL；8:8.3 × 101CFU/mL；9:8.3CFU/mL.
Specific embodiment
It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another
It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field
The identical meanings of understanding.
As background technology part is introduced, the detection for Friedlander's bacillus using tradition separation identification, is exempted from
Epidemiology method detection process is time-consuming and laborious, and sensitivity is lower.It, need to be by becoming using Standard PCR or fluorescence quantitative PCR detection
Property, annealing, extension, probably need 2~4 hours that could go out as a result, and needing accurate valuableness in addition DNA extracts whole process
Instrument and reagent, it is unfavorable to the molecular diagnosis that development at the basic level is fast and convenient.Based on this, the object of the present invention is to provide a kind of rabbits
Friedlander's bacillus recombinates polymerase isothermal amplification detection method, to realize to the quick, sensitive of rabbit Friedlander's bacillus
Detection.
The key of RPA amplification is the design of primer, but RPA is different from conventional PCR reaction, is there is no at present for primer
The software of design or the design principle of maturation, also provide foundation without a large amount of data for its design of primers, therefore, RPA primer
There are larger difficulty for design.
In addition, the selection of targeting regions is also very crucial when carrying out RPA design of primers, without suitable targeting regions,
It cannot achieve the specific detection to Friedlander's bacillus.The present invention passes through to rabbit e coil k 1 pneumonia reported in NCBI
Bacterium PhoE gene order is compared, and has eventually found the conservative target sequence of rabbit Friedlander's bacillus specificity, nucleotide
For sequence as shown in SEQ ID NO.3, which is the heredity marker for detecting rabbit Friedlander's bacillus, specific as follows:
5’-TTCAACAGCGACGCAGGCAGCGGAAGTTTATAATAAGAACGCGAACAAGCTGG ATGTGTACGGC
AAGATCAAAGCCATGCACTATTTCAGCGACTATGACAGCAAGGATGGCGATCAGACCTACGTGCGTTTCGGTATTA
AAGGCGAAACGCAGATTAACGACGACCTGACCGGCTATGGCCGTTGGGAATCTGAATTCTCCGGTAACAAAACCGA
GAGCGACTCCAGCCAGAAAACCCGTCTGGCGTTCGCCGGCGTGAAGCTGAAGAACTACGGC-3’(SEQ ID
NO.3)。
The length of targeting regions directly affects the specificity of rabbit determination of Klebsiella pneumoniae, if targeting regions are too short,
It will lead to specific deficiency, it can not be by rabbit Friedlander's bacillus and other Friedlander's bacillus or other kinds of bacterium area
It separates；If targeting regions are too long, although specificity is good, the difficulty for designing the primer that can expand long segment is larger, moreover, long
Mistake is easy to appear in the amplification procedure of segment.Comprehensively considered and found with test of many times, with sequence shown in SEQ ID NO.3
As targeting regions, specificity is good, and fragment length is moderate, facilitates carry out design of primers.
Preferred targeting regions according to the present invention, the present invention have carried out RPA design of primers, preferred at of the invention one
In embodiment, designed RPA primer pair is as follows:
Upstream primer F:5 '-TTCAACAGCGACGCAGGCAGC-3 '；(SEQ ID NO.1)
Downstream primer R:5 '-GCCGTAGTTCTTCAGCTTC-3 '.(SEQ ID NO.2)
The specificity of above-mentioned RPA primer pair is good, and the segment of institute's specific amplification is located at rabbit Friedlander's bacillus PhoE base
Between the site 45-321 of cause, size 277bp.
Quick, the sensitive inspection to rabbit Friedlander's bacillus may be implemented in RPA system based on the building of above-mentioned RPA primer pair
It surveys.
In order to enable those skilled in the art can clearly understand the technical solution of the application, below with reference to tool
The technical solution of the application is described in detail in the embodiment of body.
Test material used in the embodiment of the present invention is the test material of this field routine, wherein DNAMarker
DL-2000, TRIZOL, DEPC are purchased from TaKaRa company (Dalian)；HiscripIIOne Step RT-PCR Kit is purchased from
Vazyme company；TwistAmp DNAAmplification Kits is purchased from TwistDX company.What other were not specifically described
It can be commercially available by commercial channel.
The experimental method of specific experiment condition is not specified in the embodiment of the present invention, usually according to conventional condition, or according to
Condition proposed by instrument or reagent manufacturer is operated.
Embodiment 1: the design and optimization of primer
1. the design of primer:
The present embodiment is directed to a series of RPA primer of the conserved regions design of rabbit Friedlander's bacillus PhoE gene, tool
Body is shown in Table 1.
Table 1: for the RPA primer of the conserved regions design of rabbit Friedlander's bacillus PhoE gene
The primer in table 1 is screened using RPA amplified reaction, selection criteria rabbit Friedlander's bacillus cotton swab increment
Product are inoculated in 4mL LB culture medium, and 37 DEG C of culture 16h are diluted to 10 to pure bacterium solution with PBS after counting to it5CFU/mL, will
It carries out RPA detection as template, the specific steps are as follows:
It is carried out according to TwistAmp DNAAmplification Kits kit operating instruction, RPA reaction system: upper,
Each 1.2 μ L, Rehydration Buffer of downstream primer (20 μm of ol/ μ L) 29.5 μ L, Template 3 μ L, ddH2O 12.6μ
L.Whirlpool mixes, centrifugation.2.5 μ L 280mM MgAc are added, mix.It is put into water-bath, 40 DEG C, take out after 15min, is cooled to
Room temperature, after mixing, centrifugation is put into water-bath, and 40 DEG C, 35min.After reaction in 2% agarose gel electrophoresis, 120V,
30min observes result.
2. the preferred result of primer:
It after carrying out RPA amplification using RPA primer pair designed in table 1, is detected, is tied by agarose gel electrophoresis
Fruit discovery, the expanding effect of primer pair 1 (F1/R1) is best, and band specificity is good, without non-specific amplification.And others are drawn
Object to occur non-specific amplification, without specific band, primer amplification efficiency it is low the problems such as.Therefore, primer pair 1 is selected
(F1/R1) subsequent RPA reaction condition optimization, specificity and sensitivity tests are carried out.
The optimization of embodiment 2:RPA reaction condition
Primers F 1 in primer pair 1 and the usage amount of R1 are optimized respectively, optimum results show that primers F 1 and R1's is dense
Degree is 20 μm of ol/ μ L, and when usage amount is 1.2 μ L, effect is best.In addition, the usage amount also directed to MgAc is provided with 6
Concentration gradient, in RPA system be added concentration be 280mM MgAc amount be respectively 0.5 μ L, 1 μ L, 1.5 μ L, 2 μ L, 2.5 μ L and
3 μ L, the results show that the very few failure that will lead to amplification of MgAc dosage, 1.5 μ L and the above MgAc, which are added, in reaction system to obtain
To amplified production, when MgAc dosage is 2.5 μ L, expanding effect is best.
RPA reaction system after optimized are as follows: upstream and downstream primer (20 μm of ol/ μ L) each 1.2 μ L, Rehydration
Buffer29.5 μ L, Template 3 μ L, ddH212.6 μ L, 280mM MgAc of O, 2.5 μ L.
In addition, also RPA reaction time and reaction temperature are optimized, as a result, it has been found that, reaction temperature is 40 DEG C, for the first time
When reaction 15min, the second secondary response 35min, RPA amplification efficiency highest.
RPA reaction condition after optimized are as follows: 40 DEG C, take out after 15min, be cooled to room temperature；After mixing, centrifugation, 40 DEG C,
React 35min.
RPA reaction condition after present invention optimization, whole gene amplification procedure only need a temperature, and it is special not need
Instrument and equipment operates simpler, the field quick detection of rabbit Friedlander's bacillus suitable for producing.
Embodiment 3: specificity verification
Respectively with rabbit Friedlander's bacillus, rabbits pasteurellosis, Bordetella Bronchiseptica of Rabbit, Escherichia coli, staphylococcus aureus,
Streptococcus, Healthy Rabbits cotton swab subsample are added 0.5mL PBS (0.01mol/L, pH7.2), fully shake, supernatant is taken to do template,
Reaction condition after optimizing by embodiment 2 carries out RPA, passes through detected through gel electrophoresis.Experimental result is as shown in Figure 1, only rabbit lung
Scorching Klebsiella is the positive, and others are feminine gender, illustrates that RPA detection architecture specificity of the invention is good.
Embodiment 4: sensitivity verifying
Selection criteria rabbit Friedlander's bacillus cotton swab sample inoculation is in 4mL LB culture medium, and 37 DEG C of culture 16h are right
10 times of gradient dilutions are carried out to 10 to pure bacterium solution with PBS after its counting-8, RPA inspection is carried out by the reaction condition after the optimization of embodiment 2
It surveys.Culture bacterium solution is counted as 8.3 × 108CFU/mL is diluted to 10-8That is 8.3CFU/mL；Using conventional PCR method as control.Knot
Fruit are as follows: the bacterium solution sensitivity of RPA method of the present invention is 83CFU/mL (Fig. 2)；The bacterium solution sensitivity of conventional PCR method be 8.3 ×
103CFU/mL (Fig. 3).
Embodiment 5: clinical sample detection
1. sample process:
Rabbit Nasal swabs are collected, is added 0.5mL PBS (0.01mol/L, pH7.2), is fullyd shake, supernatant is taken to do mould
Plate.
2. recombinase polymeric enzymatic amplification:
It is carried out according to TwistAmp DNAAmplification Kits kit operating instruction, RPA reaction system: upper,
(sequence of upstream and downstream primer is respectively such as SEQ ID NO.1 and SEQ ID NO.2 institute by downstream primer (20 μm of ol/ μ L) each 1.2 μ L
Show), Rehydration Buffer 29.5 μ L, Template 3 μ L, ddH2O 12.6μL.Whirlpool mixes, centrifugation.It is added 2.5
μ L 280mM MgAc is mixed.It is put into water-bath, 40 DEG C, take out after 15min, is cooled to room temperature, after mixing, centrifugation is put into water
Bath, 40 DEG C, 35min.After reaction in 2% agarose gel electrophoresis, 120V, 30min observe result.
3. result judges:
If occurring 277bp band in test sample, it is judged as that rabbit Friedlander's bacillus is positive, if not occurring 277bp
Band is then judged as that rabbit Friedlander's bacillus is negative.
It is compared simultaneously with traditional bacterial isolation method；And sample is identified by " goldstandard " PCR sequencing PCR.
Test result is shown in Table 2.
Table 2: the comparison of distinct methods positive sample detection
As can be seen from Table 2, rabbit Friedlander's bacillus is detected using RPA method of the invention, rabbit can be greatly improved
The sensitivity of determination of Klebsiella pneumoniae, specificity, the coincidence rate with the detection of " goldstandard " PCR sequencing PCR is up to 100%；And compared with
Traditional bacterial isolation method shortens detection cycle, improves the sensitivity of detection.
The foregoing is merely preferred embodiment of the present application, are not intended to limit this application, for the skill of this field
For art personnel, various changes and changes are possible in this application.Within the spirit and principles of this application, made any to repair
Change, equivalent replacement, improvement etc., should be included within the scope of protection of this application.
Claims (10)
1. a kind of for detecting the genetic marker of rabbit Friedlander's bacillus, which is characterized in that it is with SEQ ID NO.3 institute
The sequence shown.
2. being used for the RPA primer pair of specific amplification genetic marker described in claim 1, which is characterized in that the RPA draws
The nucleotide sequence of object pair is respectively as shown in SEQ ID NO.1 and SEQ ID NO.2.
3. application of the RPA primer pair as claimed in claim 2 in the kit of preparation detection rabbit Friedlander's bacillus.
4. a kind of kit for detecting rabbit Friedlander's bacillus, which is characterized in that contain claim 2 institute in the kit
The RPA primer pair stated.
5. kit according to claim 4, which is characterized in that also contain in the kit: Rehydration
Buffer, template, ddH2O and MgAc.
6. kit according to claim 4, which is characterized in that the working procedure of the kit are as follows: 40 DEG C, 15min；
It is cooled to room temperature, is centrifuged after mixing, then 40 DEG C, 35min.
7. a kind of method for detecting rabbit Friedlander's bacillus, which comprises the following steps:
(1) it using the bacterium solution of sample to be tested as template, is carried out using RPA primer pair shown in SEQ ID NO.1 and SEQ ID NO.2
Recombinate polymerase isothermal duplication；
(2) product for recombinating polymerase isothermal duplication is subjected to electrophoresis, sees whether 277bp band occur；If there is 277bp item
Band is then judged as that rabbit Friedlander's bacillus is positive, if not occurring 277bp band, is judged as rabbit Friedlander's bacillus yin
Property.
8. the method according to the description of claim 7 is characterized in that recombinating the reactant of polymerase isothermal duplication in step (1)
System includes: each 29.5 μ of 1.2 μ L, Rehydration Buffer of RPA primer shown in SEQ ID NO.1 and SEQ ID NO.2
L, template 3 μ L, ddH212.6 2.5 μ L of μ L, MgAc of O.
9. the method according to the description of claim 7 is characterized in that recombinating the condition of polymerase isothermal duplication in step (1)
Are as follows: it 40 DEG C, take out after 15min, is cooled to room temperature；After mixing, centrifugation, reacts 35min by 40 DEG C.
10. the method according to the description of claim 7 is characterized in that taking 5 μ L recombination polymerase isothermal duplication in step (2)
Product is added in 2% Ago-Gel and carries out electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810982747.XA CN109161604A (en) | 2018-08-27 | 2018-08-27 | A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810982747.XA CN109161604A (en) | 2018-08-27 | 2018-08-27 | A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109161604A true CN109161604A (en) | 2019-01-08 |
Family
ID=64896778
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810982747.XA Pending CN109161604A (en) | 2018-08-27 | 2018-08-27 | A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161604A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593138A (en) * | 2019-09-20 | 2020-08-28 | 山东省农业科学院家禽研究所 | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method |
| CN112266969A (en) * | 2020-11-09 | 2021-01-26 | 浙江省检验检疫科学技术研究院 | Target spot, primer, probe and kit for rapidly detecting klebsiella pneumoniae based on RAA fluorescence method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946762A (en) * | 2015-06-17 | 2015-09-30 | 中生北控生物科技股份有限公司 | Kit for detecting klebsiella pneumoniae |
| CN106702027A (en) * | 2017-01-16 | 2017-05-24 | 山东省农业科学院家禽研究所 | Isothermal amplification detection method for RHDV recombinant polymerase |
-
2018
- 2018-08-27 CN CN201810982747.XA patent/CN109161604A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946762A (en) * | 2015-06-17 | 2015-09-30 | 中生北控生物科技股份有限公司 | Kit for detecting klebsiella pneumoniae |
| CN106702027A (en) * | 2017-01-16 | 2017-05-24 | 山东省农业科学院家禽研究所 | Isothermal amplification detection method for RHDV recombinant polymerase |
Non-Patent Citations (2)
| Title |
|---|
| 佚名: "Klebsiella pneumoniae strain LS356 chromosome GenBank: CP025636.1", 《GENBANK》 * |
| 吴耀东等: "重组酶聚合酶扩增技术及其在动物病原快速检测中的应用", 《中国兽医学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593138A (en) * | 2019-09-20 | 2020-08-28 | 山东省农业科学院家禽研究所 | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method |
| CN112266969A (en) * | 2020-11-09 | 2021-01-26 | 浙江省检验检疫科学技术研究院 | Target spot, primer, probe and kit for rapidly detecting klebsiella pneumoniae based on RAA fluorescence method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Clancy et al. | Development of a rapid recombinase polymerase amplification assay for the detection of Streptococcus pneumoniae in whole blood | |
| CN109182567A (en) | A kind of method of real-time fluorescence quantitative PCR that is while detecting 12 kinds of pathogenic bacterias | |
| CN110423827B (en) | Streptococcus agalactiae loop-mediated isothermal amplification field rapid detection technology based on pcsB gene | |
| CN112930407A (en) | Methods of diagnosing and treating cancer using non-human nucleic acids | |
| CN108048588A (en) | The detection primer and detection kit of a kind of Arcanobacterium pyogenes | |
| CN105525023A (en) | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method | |
| CN109161604A (en) | A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method | |
| Xin et al. | Rapid detection and differentiating of the predominant Salmonella serovars in chicken farm by TaqMan multiplex real-time PCR assay | |
| CN114891902A (en) | Primer-probe combination for rapidly detecting five virulent pathogenic bacteria based on liquid drop digital PCR and application method thereof | |
| Książczyk et al. | Application of routine diagnostic procedure, VITEK 2 compact, MALDI-TOF MS, and PCR assays in identification procedure of bacterial strain with ambiguous phenotype | |
| CN110016512A (en) | The multiple fluorescence quantitative PCR detection kit and method of three kinds of bovine respiratory pathogen are detected simultaneously | |
| Cao et al. | Cas12a/Guide RNA-based platforms for rapidly and accurately identifying Staphylococcus aureus and methicillin-resistant S. aureus | |
| Wang et al. | Rapid identification of capsular serotype K1/K2 Klebsiella pneumoniae in pus samples from liver abscess patients and positive blood culture samples from bacteremia cases via an immunochromatographic strip assay | |
| Zhang et al. | Development of hydrolysis probe-based real-time PCR for Identification of virulent gene targets of Burkholderia pseudomallei and B. mallei—a retrospective study on archival cases of service members with melioidosis and glanders | |
| Zhang et al. | Evaluation of the metagenomic next-generation sequencing performance in pathogenic detection in patients with spinal infection | |
| CN110438205A (en) | Joint multiplex PCR nest-type PRC and touchdown PCR are used for the kit of pathogenic mycobacterium tuberculosis detection | |
| Li et al. | Preliminary evaluation of rapid visual identification of Burkholderia pseudomallei using a newly developed lateral flow strip-based recombinase polymerase amplification (LF-RPA) system | |
| US20180330044A1 (en) | Methods Associated With A Database That Stores A Plurality Of Reference Genomes | |
| CN108070638B (en) | Recombinase polymerase isothermal amplification method for detecting orientia tsutsutsugamushi, special primer and probe thereof and application | |
| Zhang et al. | Rapid and simple detection of Glaesserella parasuis in synovial fluid by recombinase polymerase amplification and lateral flow strip | |
| Tabibnejad et al. | The optimization of molecular detection of clinical isolates of Brucella in blood cultures by eryD transcriptase gene for confirmation of culture-negative samples | |
| CN109402274A (en) | A kind of fluorescent quantitative RT-PCR method identifying A type and Type B ox source pasteurella multocida | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| CN110857450B (en) | Colorectal cancer marker and application thereof | |
| CN111254187A (en) | Multiple PCR detection method for Klebsiella pneumoniae, salmonella and bordetella pneumoniae of rabbit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |