CN108048588A - The detection primer and detection kit of a kind of Arcanobacterium pyogenes - Google Patents
The detection primer and detection kit of a kind of Arcanobacterium pyogenes Download PDFInfo
- Publication number
- CN108048588A CN108048588A CN201810043015.4A CN201810043015A CN108048588A CN 108048588 A CN108048588 A CN 108048588A CN 201810043015 A CN201810043015 A CN 201810043015A CN 108048588 A CN108048588 A CN 108048588A
- Authority
- CN
- China
- Prior art keywords
- pyogenes
- pcr
- arcanobacterium pyogenes
- dna
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biology fields, and in particular to the detection primer and detection kit of a kind of Arcanobacterium pyogenes.The present invention establishes special, sensitive PCR method for the hemolysin PLO gene orders of Arcanobacterium pyogenes, can accurately detect Arcanobacterium pyogenes, distinguishes the other pathogens of goat pyogenic infection.The present invention provides the accuracy that Positive contrast bacteria and negative control bacterium determine kit quality and appraisal procedure for user.Kit and method provided by the invention can use in base's conventional animal disease diagnosis laboratory, target stripe is clearly easily distinguished, 1 can be completed PCR reactions when small, for monitoring the breeding of the bacterium, disease occurs and popular and disease timely prevention is respectively provided with significance.
Description
Technical field
The invention belongs to biology fields, and in particular to the detection primer and detection reagent of a kind of Arcanobacterium pyogenes
Box.
Background technology
Arcanobacterium pyogenes (Trueperella pyogenes) are Gram-positive short corynebacterias, are ox, sheep and pig
The conditionity pathogenic bacteria of Important Economics animal are waited, often parasitizes at the upper respiratory tract and gastral mucous membrane, a variety of organs can be caused
With the pyogenic infection of mucous membrane, larger economic loss is caused to aquaculture.In most cases, Arcanobacterium pyogenes infection causes
Chronic wasting disease；When infecting serious, often because pyaemia septica causes death.In addition Arcanobacterium pyogenes can cause antelope
Sheep, camel, dog, cat, as the infection of many animals such as, gazelle, Wildebeest, parrot, horse, deer, reinder, turkey.
Arcanobacterium pyogenes often with other pathogen mixed infections.This laboratory to from Rongchang County of Chongqing City, Yongchuan, Jiangjin,
The suppurative sample such as the goat lymphnoditis of districts farm such as stone column, Dianjiang, WuLong, tenth of the twelve Earthly Branches sun, Fengdu carries out bacteria distribution mirror
Fixed, highest recall rate is coccus, mainly staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes etc., followed by bar
Bacterium mainly has Mannheimia haemolytica, proteus mirabilis, Arcanobacterium pyogenes, Corynebacterium pseudotuberculisis etc. in bacillus.These
Bacterium often has wider Antibiotic Resistance, how Rapid identification is carried out to the pathogen of goat pyogenic infection, targetedly to use
Medicine provides technical support, is urgent problem.
Existing document discloses the PCR detection method of Arcanobacterium pyogenes, and common target gene mainly has 16S rRNA bases
Cause and hemolysin PLO genes.Though 16S rRNA genes are used as the molecular target of bacterium Species estimation, in affiliation
Often understand cross reaction between near bacterium, be often present with false positive results as diagnosis, detection target gene, it is also necessary to which gained is produced
Object carries out sequencing and sequence alignment, further to identify pathogen.Hemolysin PLO is the main virulence of Arcanobacterium pyogenes
One of factor, all Arcanobacterium pyogenes separation strains are common detection target genes there are PLO genes.It is carried out on NCBI
Blast search finds that PLO genes are relatively conservative in Arcanobacterium pyogenes difference separation strains, and homology is higher than 96%, and other
Bacterium is without homology；Homology of the PLO protein in Arcanobacterium pyogenes difference separation strains is higher than 98%, with other bacteriums
Homology is less than 67%.
This experiment is found in the suppurative sample processes of goat are detected, based on Arcanobacterium pyogenes hemolysin PLO genes
Most easily with Corynebacterium pseudotuberculisis cross reaction, the piece expanded from two kinds of DNA of bacteria occur for the PCR detection method of foundation
Duan great little is often also close, is not easily distinguishable.
CN 103937889B are invented according to the higher loop-mediated isothermal amplification method of sensitivity that PLO genes are established
(LAMP) Arcanobacterium pyogenes are detected.For PCR method, advantage is detected with LAMP method it is obvious that need not costliness
PCR instrument, detection sensitivity height, high specificity, result visualization etc.；Shortcoming is detected it is also obvious that nucleic acid carries with LAMP method
It takes, reagent adds to take needs cleanliness factor, the space of closing to prevent pollution, and reagent cost is high, and operating procedure is more etc..Veterinary station of base etc.
Mechanism has been provided with the equipment such as PCR instrument, electrophoresis apparatus at this stage, but be not equipped with substantially high-cleanness, high laboratory or reduce gas it is molten
The separate space that glue generates.
For this purpose, we establish Standard PCR detection method and composition kit, the PCR method established based on PLO genes
There is specific height, high sensitivity, time-consuming short.
The content of the invention
In view of this, it is an object of the invention to provide a kind of Arcanobacterium pyogenes PCR detection primer pairs, specificity
By force, the cross reaction with the common bacterias such as Corynebacterium pseudotuberculisis can be avoided.
To achieve the above object, the technical scheme is that：
The above-mentioned primer pair for Arcanobacterium pyogenes PCR detections is the sequence of sense primer F1 and anti-sense primer R1, F1
For SEQ ID NO:Shown in 1, the sequence of R1 is SEQ ID NO:Shown in 2.
The strong specific primer that the present invention designs is the key factor for realizing the purpose, in order to overcome Arcanobacterium pyogenes
The false positive of PCR detections, the present invention search for primer sequence from PLO genes, therefrom selected 4 couples of preferable primer pair F1/R1,
F2/R2、F3/R3、F4/R4(SEQ ID NO:1-8), Arcanobacterium pyogenes, Corynebacterium pseudotuberculisis are expanded respectively, make purulence grape
It is coccus, staphylococcus aureus, streptococcus pyogenes, Mannheimia haemolytica, proteus mirabilis, bright string coccus, enterococcus, big
12 kinds of bacteriums such as enterobacteria, salmonella, class Bacillus, only F1/R1 can specific detection Arcanobacterium pyogenes.And to culture
Totally 300 F1/R1PCR amplified productions of object and clinical sample are sequenced, and BLAST analysis results are Arcanobacterium pyogenes
PLO genes ensure that the reliability of method and kit testing result.
For designing the reference sequences of primer as goat Arcanobacterium pyogenes Chongqing separation strains 2012CQ-ZSH genomes
PLO gene orders in (GenBank accession number CP012649) sequence, sequence is shown in SEQ ID NO 9.
The second object of the present invention is to provide Arcanobacterium pyogenes PCR made of a kind of primer pair based on purpose one and examines
Test agent box, high specificity, sensibility are high, detection is accurate, it is short, effective to take.
To achieve the above object, the technical scheme is that：
Above-mentioned PCR detection kit includes：Each 100 μ L of F1 and R1,2 × PCR Mix 1.25mL, positive control one, the moon
Property control one and ultra-pure water 2.5mL.
As preferred scheme, above-mentioned 2xPCR Mix are by 2 × PCR Mix by 3mmol/LMgCl2, 100mmol/LKCl,
Each 500 μm of ol/LdNTP, 20mmol/LTris-HCl (pH 8.3) and 0.2U/ μ LTaq polymerases composition.
Negative control (negative control) and positive control (positive control) are for " it is expected that knot
Fruit " and say.Every group for occurring expected results certainly is positive controls.Every is not in the group of expected results certainly,
For negative control group.
As preferred scheme, above-mentioned positive control is that Arcanobacterium pyogenes inactivate freeze-dried powder or Arcanobacterium pyogenes
PCR product.
As preferred scheme, above-mentioned negative control is ultra-pure water or bacteria inactivation freeze-dried powder, and the bacterium is pseudo- tuberculosis
Corynebacteria, staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes, Mannheimia haemolytica, proteus mirabilis,
Bright string coccus, enterococcus, Escherichia coli, salmonella, the one or more of class Bacillus.
Further, it is preferable that negative control is Corynebacterium pseudotuberculisis, staphylococcus pyogenes, staphylococcus aureus, wine
Streptococcus pyrogenes, Mannheimia haemolytica, proteus mirabilis, bright string coccus, enterococcus, Escherichia coli, salmonella and class bud
The mixture inactivation freeze-dried powder of spore bacterium.Primer can be intuitively observed using bacteria inactivation freeze-dried powder as the negative control in kit
Effect distinguishes 11 kinds of bacteriums of Arcanobacterium pyogenes and other.
The third object of the present invention is to provide a kind of detection based on two Arcanobacterium pyogenes PCR detection kit of purpose
Method, easy to operate, it is high that PCR takes shorter and accuracy.
To achieve the above object, the technical scheme is that：
Above-mentioned Arcanobacterium pyogenes PCR detection method comprises the following steps：
1) DNA is extracted：It extracts measuring samples and/or feminine gender, the DNA of positive control is spare；
2) gene magnification：The DNA of step 1) extraction is added in the detection kit of any one of 2-6, PCR expansions are carried out to it
Increase；
3) detect：DNA cloning product is detected into row agarose gel electrophoresis.
As preferred scheme, measuring samples described in step 1) are pure cultures of bacteria, animal tissue or fester.
DNA of bacteria extracts kit extraction DNA can be used to be detected for PCR for bacterial cultures, also can be directly using boiling
Boiling method prepares DNA of bacteria and is detected for PCR.Boiling method prepares DNA of bacteria method：Take 1mL bacterium solutions centrifuge 12000 × g from
Heart 1min abandons supernatant, adds in 100 μ L deionized waters with suspension thalline, and boiling water bath 10min, 12000 × g centrifuges 10min after cooling,
Supernatant is taken to be detected for PCR.Tissue DNA extracts kit can be used to extract for tissue or fester DNA, and can also grind tissue or fester
Grinding fluid is inoculated with, and prepare DNA of bacteria by boiling method after bacterium solution muddiness detects for PCR.At tissue or fester lapping liquid inoculation
Reason method is：0.1~1g of tissue or fester of suppuration lesion is taken under aseptic condition, puts in sterile even dress device and is homogenized, take 50 μ L
Homogenate is added in the TSB culture mediums containing 10% hyclone, and 37 DEG C of cultures go bacterium solution to be prepared by above-mentioned boiling method to muddiness
DNA of bacteria detects for PCR.
As preferred scheme, step 2) the PCR amplification process includes：
94℃2min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 15s, 30 Xun Huans；72℃3min.
The beneficial effects of the present invention are：Provided by the present invention for detecting the primer pair or kit of Arcanobacterium pyogenes
It has the following advantages：(1) instrument in base's conventional animal disease diagnosis laboratory, condition can meet detection demand；(2) it is specific
Height is avoided that the cross reaction with common bacteria in the purulent samples such as Corynebacterium pseudotuberculisis, provides by Corynebacterium pseudotuberculisis
Common reactants is waited to intersect bacterial mixture as negative control；(3) high sensitivity, most low energy detection 1 × 10-3Ng/ μ L suppurate hidden
Secret vaccae genomic dna；(4) PCR product size is 264bp, and band is easy to distinguish with primer dimer, target stripe is clear,
Without miscellaneous band；(5) it is time-consuming short, when PCR reaction time consumptions 1 are small.
Description of the drawings
Fig. 1 is the PCR testing results of F1/R1 primer pairs.(M：Marker DL2000；1：Arcanobacterium pyogenes solid culture
Object；2：Arcanobacterium pyogenes liquid culture；3：Lung tissue；4：Lymph node tissue；5：Fester；6：Positive control；7-13：It is pseudo-
Corynebacterium pseudotuberculosis, staphylococcus, proteus mirabilis, series bacillus, streptococcus pyogenes, bright string coccus, Escherichia coli, intestines
Coccus；14：Negative control)
Fig. 2 is the PCR testing results of F2/R2 primer pairs.(M：Marker DL2000；1：Arcanobacterium pyogenes solid culture
Object；2：Arcanobacterium pyogenes liquid culture；3：Lung tissue；4：Lymph node tissue；5：Fester；6：Positive control；7-13：It is pseudo-
Corynebacterium pseudotuberculosis, staphylococcus, proteus mirabilis, series bacillus, streptococcus pyogenes, bright string coccus, Escherichia coli, intestines
Coccus；14：Negative control)
Fig. 3 is the PCR testing results of F3/R3 primer pairs.(M：Marker DL2000；1：Arcanobacterium pyogenes solid culture
Object；2：Arcanobacterium pyogenes liquid culture；3：Lung tissue；4：Lymph node tissue；5：Fester；6：Positive control；7-13：It is pseudo-
Corynebacterium pseudotuberculosis, staphylococcus, proteus mirabilis, series bacillus, streptococcus pyogenes, bright string coccus, Escherichia coli, intestines
Coccus；14：Negative control)
Fig. 4 is the PCR testing results of F4/R4 primer pairs.(M：Marker DL2000；1：Arcanobacterium pyogenes solid culture
Object；2：Arcanobacterium pyogenes liquid culture；3：Lung tissue；4：Lymph node tissue；5：Fester；6：Positive control；7-13：It is pseudo-
Corynebacterium pseudotuberculosis, staphylococcus, proteus mirabilis, series bacillus, streptococcus pyogenes, bright string coccus, Escherichia coli, intestines
Coccus；14：Negative control)
Fig. 5 is F1/R1 primer pair PCR sensitivity tests results.(M：Marker DL2000；1：1000ng/μL；2：1000
×10-1ng/μL；3：1000×10-2ng/μL；4：1000×10-3ng/μL；5：1000×10-4ng/μL；6：1000×10- 5ng/μL；7：1000×10-6ng/μL；8：1000×10-7ng/μL；9：1000×10-8ng/μL；10：1000×10-9ng/μL；
11：Negative control)
Fig. 6 is the PCR results that clinical sample is detected using F1/R1 primer pairs.(M：Marker DL2000；1：It is positive right
According to；2：Negative control；3-7：Clinical sample)
Specific embodiment
The preferred embodiment of the present invention will be described in detail (referring to the drawings) below.Tool is not specified in preferred embodiment
The experimental method of concrete conditions in the establishment of a specific crime, usually according to normal condition, illustrated embodiment is to preferably be said to present disclosure
It is bright, but be not that present disclosure is only limitted to illustrated embodiment.So those skilled in the art are according to foregoing invention
Content carries out nonessential modifications and adaptations to embodiment, still falls within protection scope of the present invention.
1. bacterial strain and sample
Arcanobacterium pyogenes, Corynebacterium pseudotuberculisis, staphylococcus, proteus mirabilis, series bacillus, wine purulence hammer
Bacterium, bright string coccus, enterococcus, Escherichia coli, enterococcus etc. are by the separation of this laboratory, identification and preserve.It is hidden to be diagnosed as suppuration
Mouse lung tissue, lymph node tissue, the fester of secret bacillus infection are attacked poison, identification by this laboratory and are preserved.
2. reagent
Liquid TSB culture mediums:40g TSA powder is weighed, adds in 950mL deionized waters, is sterilized 15 minutes through 121 DEG C, it is cold
But to 50 DEG C or so, 50mL newborn bovine serum is added in, is formulated after fully shaking up.
Solid TSB culture mediums:40g TSA powder, 17g agar powders are weighed, adds in 950mL deionized waters, through 121 DEG C of sterilizings
15 minutes, 50 DEG C or so are cooled to, 50mL newborn bovine serum is added in, is formulated after fully shaking up.
PCR Mix, DNA of bacteria extracts kit, lysate, Proteinase K, Tris saturated phenols, chloroform etc..
Embodiment 1
The preparation of 1.DNA templates
1. liquid culture:1mL bacterium solutions is taken to centrifuge 12000 × g centrifugations 1min and abandon supernatant, add in 100 μ L deionized waters with
Suspension thalline, boiling water bath 10min, 12000 × g centrifuges 10min after cooling, takes supernatant as template.
2. solid culture:Arcanobacterium pyogenes pure culture is scraped, is suspended in and adds in 100 μ L deionized waters, boiling water
10min is bathed, 12000 × g centrifuges 10min after cooling, takes supernatant as template.
3. lung tissue, lymph node tissue, fester:Sample is taken to add in PBS grindings, is incubated at room temperature 10min, 5000r/min,
500 μ L supernatants are taken, add in 50 μ L10%SDS solution and the Proteinase K of 10 μ L20 μ g/mL, 56 DEG C of water-bath 2h add in 500 μ
LTris saturated phenols, after abundant mixing, 12000 × g/min centrifugation 10min take supernatant, add in the chloroform of equivalent：Isoamyl alcohol (24：
1), 12000 × g/min centrifuges 10min after abundant mixing, and supernatant is taken to add in the absolute ethyl alcohol of 2 times of volumes, -20 DEG C of standings
20min, 12000 × g/min centrifuge 10min, abandon supernatant, add in 70% alcohol flushing precipitation, abandon ethyl alcohol, add in 20 μ L sterilizings and go
Ion water dissolution precipitates, and -20 DEG C preserve as template.
2. design of primers
According in Arcanobacterium pyogenes Chongqing separation strains 2012CQ-ZSH genomes (GenBank accession number CP012649)
PLO gene orders search for primer using Primer-BLAST methods, 4 pairs of primers are screened from candidate drugs.Primer is given birth to by Shanghai
Work bioengineering Co., Ltd synthesizes, and primer sequence is shown in Table 1 and SEQ ID NO:1-8.
Table 1PCR primer pair sequences
3.PCR is expanded
The DNA profiling of said extracted is subjected to PCR amplification with above-mentioned primer, negative control is ultra-pure water, PCR reaction systems
For 20 μ L, reaction system is shown in Table 2.
Table 2PCR reaction systems
PCR response parameters are：
94℃2min；94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 15sec, 30 Xun Huans；72℃3min；Room temperature preservation.
4.PCR product detections and interpretation of result
5 μ LPCR amplified productions is taken to add in well, by the use of 1 × TAE buffer solutions as electrophoresis liquid, are carried out under constant pressure 120V
Gel is placed in gel imager after electrophoresis 20min and takes pictures to observe PCR results by 1.2% agarose gel electrophoresis.Recycling sun
Property band, be cloned into pMD18-T, conversion such as DH5 α select positive colony and sequencing are carried out to Insert Fragment therein,
BLST search is carried out on NCBI to carry out sequence analysis.
Result of the test as shown in Figs 1-4,4 pairs of primers can from Arcanobacterium pyogenes culture, make a definite diagnosis it is concealed containing suppurating
Specific amplification goes out the purpose band being consistent with expected size in the lung tissue of bacillus, lymph node tissue, fester.Sequencing
It is shown with the sequencing results, gained sequence and the homology of Arcanobacterium pyogenes PLO genes are higher than>92%, with other bacteriums
Without homology, it is Arcanobacterium pyogenes PLO genes to show sequence.
The specific test of 5.PCR
Cultivate Corynebacterium pseudotuberculisis, staphylococcus, proteus mirabilis, series bacillus, streptococcus pyogenes, bright string ball
The bacteriums such as bacterium, enterococcus, Escherichia coli, enterococcus, Mannheimia haemolytica, salmonella take 1mL bacterium solutions to centrifuge 12000 × g
Centrifugation 1min abandons supernatant, adds in 100 μ L deionized waters with suspension thalline, boiling water bath 10min, 12000 × g is centrifuged after cooling
10min takes supernatant as template.
The DNA profiling of said extracted is subjected to PCR amplification with above-mentioned primer, PCR reaction systems are 20 μ L, and reaction system is shown in
Table 2.Circulating system is：94℃2min；94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 15sec, 30 Xun Huans；72℃3min；Room temperature is protected
It deposits.5 μ LPCR amplified productions is taken to add in well, by the use of 1 × TAE buffer solutions as electrophoresis liquid, 1.2% is carried out under constant pressure 120V
Gel is placed in gel imager after electrophoresis 20min and takes pictures to observe PCR results by agarose gel electrophoresis.
As shown in Figs 1-4, only F1/R1 primer pairs can amplify spy to result of the test from Arcanobacterium pyogenes DNA profiling
Different band, and not from Corynebacterium pseudotuberculisis, staphylococcus, proteus mirabilis, series bacillus, streptococcus pyogenes, bright string
Amplified band in the DNA of bacteria such as coccus, enterococcus, Escherichia coli, enterococcus, Mannheimia haemolytica, salmonella, shows
F1/R1 primer pairs can accurately detect Arcanobacterium pyogenes, and distinguish other bacteriums.
6.PCR sensitivity tests
Fresh Arcanobacterium pyogenes single bacterium colony is inoculated in liquid TSB culture mediums, 37 DEG C of culture 48h collect thalline, use
PBS washing thallines 3 times, DNA of bacteria extracts kit extraction DNA measure Nucleic acid quality, and adjustment concentration is 1000ng/ μ L, successively
It is diluted to 1000 × 10-1ng/μL、1000×10-2ng/μL、1000×10-3ng/μL、1000×10-4ng/μL、1000×10- 5ng/μL、1000×10-6ng/μL、1000×10-7ng/μL、1000×10-8ng/μL、1000×10-9ng/μL.With above-mentioned 10
The DNA solution of a dilution factors is template, and adding in each component by table 2 carries out PCR amplification, and circulating system is：94℃2min；94℃
30sec, 60 DEG C of 30sec, 72 DEG C of 15sec, 30 Xun Huans；72℃3min；Room temperature preservation, to detect the sensibility of the PCR method.
Result of the test is as shown in figure 5, template concentrations are 1000 × 10-6High-visible purpose band can occur during ng/ μ L,
Template concentrations are less than 1000 × 10-6Occur during ng/ μ L without apparent band, therefore the minimum template of accurate detection Arcanobacterium pyogenes
Concentration is 1000 × 10-6Ng/ μ L, i.e., 1 × 10-3Ng/ μ L detect measuring samples using kit provided by the invention, can be accurate
It detects Arcanobacterium pyogenes DNA and is not less than 1 × 10-3ng/μL。
Detection template DNA concentration lower limit of the present invention is 1 × 10-3Ng/ μ L, it was demonstrated that Arcanobacterium pyogenes detection method of the present invention
Sensibility it is high.
Embodiment 2
Using the good F1/R1 primer pairs of 1 specificity of embodiment, clinical sample is detected, sample includes tissue, fester etc..
It is prepared by 1.DNA
Sample is taken to add in PBS grindings, is incubated at room temperature 10min, 5000r/min, takes 500 μ L supernatants, adds in 50 μ L10%SDS
The Proteinase K of solution and 10 μ L20 μ g/mL, 56 DEG C of water-bath 2h add in 500 μ LTris saturated phenols, after abundant mixing, 12000 ×
G/min centrifuges 10min, takes supernatant, adds in the chloroform of equivalent：Isoamyl alcohol (24：1), 12000 × g/min is centrifuged after abundant mixing
10min, takes supernatant to add in the absolute ethyl alcohol of 2 times of volumes, and -20 DEG C of standing 20min, 12000 × g/min centrifugation 10min are abandoned
Clearly, 70% alcohol flushing precipitation is added in, abandons ethyl alcohol, adds in 20 μ L sterile deionized waters dissolving precipitation, -20 DEG C preserve in case PCR
Detection.
The heliotropism control Arcanobacterium pyogenes inactivation bacterial mixtures such as freeze-dried powder and negative control Corynebacterium pseudotuberculisis
500 μ L deionized waters are added in inactivation freeze-dried powder, comparison DNA is equally prepared with sample DNAs preparation methods such as tissues.
2.PCR is detected
The DNA profiling of said extracted is subjected to PCR amplification with above-mentioned F1/R1 primer pairs, negative control is that pseudo- tuberculosis is rodlike
Bacillus DNA, PCR reaction systems are 20 μ L, and reaction system is shown in Table 3.
3 Arcanobacterium pyogenes PCR of table detects reaction system
Circulating system is：94℃2min；94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 15sec, 30 Xun Huans；72℃3min；Room
Temperature preserves.
3.PCR interpretations of result
5 μ LPCR amplified productions is taken to add in well, by the use of 1 × TAE buffer solutions as electrophoresis liquid, are carried out under constant pressure 120V
Gel is placed in gel imager after electrophoresis 20min and takes pictures to observe PCR results by 1.2% agarose gel electrophoresis.To the positive
Purpose band carries out sequencing and sequence analysis.
Result of the test with the PCR method established based on F1/R1 primer pairs from clinical sample as shown in fig. 6, can expand
Go out the purpose band being consistent with expected size.300 (wherein 280 are that gained is expanded from clinical sample) positive detection bands
Sequencing and the sequencing results show that gained sequence is Arcanobacterium pyogenes PLO genes.The result shows that the present invention is built
Vertical kit and PCR method effectively can detect Arcanobacterium pyogenes from clinical sample to be checked.
Finally illustrate, the above embodiments are merely illustrative of the technical solutions of the present invention and it is unrestricted, although with reference to compared with
The present invention is described in detail in good embodiment, it will be understood by those of ordinary skill in the art that, it can be to the skill of the present invention
Art scheme is modified or replaced equivalently, and without departing from the objective and scope of technical solution of the present invention, should all be covered at this
Among the right of invention.
<110>Chongqing Academy of Animal Sciences
<120>The detection primer and detection kit of a kind of Arcanobacterium pyogenes
<160> 9
<170> PatentIn Version 2.1
<210> 1
<211> 20
<212> DNA
<213>Engineer's primers F 1
<400> 1
TTGATAACGGTCCACCACGG 20
<210> 2
<211> 20
<212> DNA
<213>Engineer's primer R1
<400> 2
CACTGCCACGACCTACAAGT 20
<210> 3
<211> 20
<212> DNA
<213>Engineer's primers F 2
<400> 3
TAGCTCTGGCTGGGATGTCT 20
<210> 4
<211> 20
<212> DNA
<213>Engineer's primer R2
<400> 4
GTGGGACGAGATCAGCTACG 20
<210> 5
<211> 20
<212> DNA
<213>Engineer's primers F 3
<400> 5
GATCCTTGGTAACCGGCACA 20
<210> 6
<211> 20
<212> DNA
<213>Engineer's primer R3
<400> 6
GGGAAACAGCTCGGGATTGA 20
<210> 7
<211> 20
<212> DNA
<213>Engineer's primers F 4
<400> 7
GATCCTTGGTAACCGGCACA 20
<210> 8
<211> 20
<212> DNA
<213>Engineer's primer R4
<400> 8
GGGAAACAGCTCGGGATTGA 20
<210> 9
<211> 1605
<212> DNA
<213>Arcanobacterium pyogenes（Trueperella pyogenes）PLO gene orders
<400> 9
atgaaacgaa aggcttttgc atcgctagtg gcgagtgtag ttgcagcagc aactgtcacg 60
atgcccacag catcttttgc tgccggattg ggaaacagct cgggattgac ggacggcttg 120
tcagcgccgc gagcctccat ctccccgatg gataaagttg accttaagtc ggcgcaagag 180
actaacgaga cgagcgtcga taagtacatt cgtggtctga aatacgatcc ctctggtgta 240
cttgcagtca agggtgagtc tattgaaaat gtgccggtta ccaaggatca gctcaaggac 300
ggcacctaca cggtatttaa gcacgaacgc aagagtttta acaatttgcg ttcggacatc 360
tctgcgttcg atgcgaacaa cgcccacgtc tatcctgggg cgctcgtgtt agcaaataaa 420
gatcttgcaa aaggtagtcc gacttcgatc ggaattgcac gtgctccgca aactgtcagc 480
gttgatttgc caggattagt tgacggtaag aataaggtcg tcatcaacaa tcccacgaag 540
agttccgtga ctcaaggaat gaacggcctt ctcgacggtt ggattcagcg caacagcaag 600
tatcctgacc atgctgcaaa gatttcttac gatgagacta tggtgacgtc aaagcgtcaa 660
ctggaggcaa agcttggcct cggatttgaa aaggtctcag caaagctcaa cgtggacttc 720
gatgcaattc ataagcgtga acggcaggtg gctatcgctt ccttcaaaca gatttactac 780
acggctagcg tagatacacc gacatctcca catagcgttt tcggcccgaa tgtcaccgca 840
caggatttga aagatcgggg agtcaataac aagaatcctc taggatacat ttcgtcggtc 900
agctatggac gccagatttt tgtcaagctg gaaacgacct cgacttccaa tgatgtacaa 960
gcggctttta gcggcctgtt caaagctaag ttcggcaatc tttccacaga attcaagact 1020
aagtatgccg atatcctgaa caagacccga gctactgtgt acgtcgttgg tggcagcgcc 1080
aggggcggag ttgaagttgc aactggcaac atcgatgcgc tcaagaagat tatcaaggag 1140
gagagtacct tctccacgaa ggttcctgcc gtgcccgttt cctatgccgt caatttcttg 1200
aaggataacc agctggcagc tgttaggagc agcggtgatt acattgaaac cactgccacg 1260
acctacaagt ctggtgagat tacgttccgc catggcggtg gctacgtcgc gaagttcagg 1320
ctgaagtggg acgagatcag ctacgacccg cagggtaagg agatccgcac ccccaagacg 1380
tggagtggga attgggtcgg ccgtacagcc ggcttccgcg agactattca acttccggca 1440
aacgcccgca acatccatgt ggaagcaggt gaggcgacag gtctagcgtg ggatccgtgg 1500
tggaccgtta tcaacaagaa gaatctcccc ttggtgccac atcgagagat cgtccttaag 1560
ggtacgacgc tcaatccctg ggtcgaggaa aatgttaaac cctag 1605
Claims (10)
1. a kind of Arcanobacterium pyogenes PCR detection primer pairs, which is characterized in that the primer pair is sense primer F1 and downstream
Primer R1, the sequence of the primers F 1 is SEQ ID NO:Shown in 1, the sequence of R1 is SEQ ID NO:Shown in 2.
2. primer pair according to claim 1, which is characterized in that the primer pair accurately can be not less than 1 by detectable concentration
×10-3The Arcanobacterium pyogenes DNA of ng/ μ L.
3. based on Arcanobacterium pyogenes PCR detection kit made of primer described in claim 1, which is characterized in that including：F1
100 μ L each with R1,2 × PCR Mix 1.25mL, positive control one, negative control one and ultra-pure water 2.5mL.
4. detection kit according to claim 3, which is characterized in that described：2 × PCR Mix are by 3mmol/LMgCl2,
100mmol/L KCl, each 500 μm of ol/L dNTP, 20mmol/LTris-HCl (pH 8.3) and 0.2U/ μ L Taq polymerase groups
Into.
5. detection kit according to claim 3, which is characterized in that the positive control inactivates for Arcanobacterium pyogenes
The PCR product of freeze-dried powder or Arcanobacterium pyogenes.
6. detection kit according to claim 3, which is characterized in that the negative control is ultra-pure water or bacteria inactivation
Freeze-dried powder, the bacterium are Corynebacterium pseudotuberculisis, staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes, hemolytic
Mannheimia, proteus mirabilis, bright string coccus, enterococcus, Escherichia coli, salmonella, the one or more of class Bacillus.
7. detection kit according to claim 6, which is characterized in that the negative control for Corynebacterium pseudotuberculisis,
Staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes, Mannheimia haemolytica, proteus mirabilis, it is bright string coccus,
Enterococcus, Escherichia coli, the mixture inactivation freeze-dried powder of salmonella and class Bacillus.
8. a kind of detection method based on any one of claim 3-7 Arcanobacterium pyogenes PCR detection kits, feature exist
In comprising the following steps：
1) DNA is extracted：It extracts measuring samples and/or feminine gender, the DNA of positive control is spare；
2) gene magnification：The DNA of step 1) extraction is added in claim 3-7 any one of them detection kits, to it
Carry out PCR amplification；
3) detect：DNA cloning product is detected into row agarose gel electrophoresis.
9. according to the method described in claim 8, it is characterized in that, measuring samples described in step 1) for pure cultures of bacteria,
Animal tissue or fester.
10. according to the method described in claim 8, it is characterized in that, the PCR amplification process includes：94℃2min；94℃
30s, 60 DEG C of 30s, 72 DEG C of 15s, 30 Xun Huans；72℃3min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810043015.4A CN108048588B (en) | 2018-01-17 | 2018-01-17 | Detection primer and detection kit for cryptococcus pyogenes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810043015.4A CN108048588B (en) | 2018-01-17 | 2018-01-17 | Detection primer and detection kit for cryptococcus pyogenes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108048588A true CN108048588A (en) | 2018-05-18 |
| CN108048588B CN108048588B (en) | 2021-04-06 |
Family
ID=62127729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810043015.4A Active CN108048588B (en) | 2018-01-17 | 2018-01-17 | Detection primer and detection kit for cryptococcus pyogenes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108048588B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109337996A (en) * | 2018-12-24 | 2019-02-15 | 福建省农业科学院畜牧兽医研究所 | It is a kind of for detecting the primer and probe of goat Arcanobacterium pyogenes |
| CN109439779A (en) * | 2018-12-24 | 2019-03-08 | 林裕胜 | One kind is for detecting goat Arcanobacterium pyogenes real-time fluorescence quantitative PCR primer |
| CN110642927A (en) * | 2019-10-16 | 2020-01-03 | 重庆市畜牧科学院 | Application of protein in preparation of medicine for preventing cryptococcus pyogenes infection |
| CN110967482A (en) * | 2018-09-30 | 2020-04-07 | 重庆市畜牧科学院 | Kit for detecting infection of cryptobacter pyogenes of goats and detection method thereof |
| CN113354719A (en) * | 2021-05-11 | 2021-09-07 | 重庆市畜牧科学院 | Proteus mirabilis antigen identification and application thereof in detection of proteus infection |
| CN114959083A (en) * | 2022-06-29 | 2022-08-30 | 西北农林科技大学 | Triple PCR detection primer group and kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140023674A1 (en) * | 2011-03-28 | 2014-01-23 | St. Jude Children's Research Hospital | Methods and compositions employing immunogenic fusion proteins |
| CN103937889A (en) * | 2014-04-14 | 2014-07-23 | 陕西省动物研究所 | Primers and detection method for LAMP detection of arcanobacterium pyogenes |
| CN104073450A (en) * | 2014-02-28 | 2014-10-01 | 重庆市畜牧科学院 | Goat source arcanobacterium pyogenes and application thereof |
-
2018
- 2018-01-17 CN CN201810043015.4A patent/CN108048588B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140023674A1 (en) * | 2011-03-28 | 2014-01-23 | St. Jude Children's Research Hospital | Methods and compositions employing immunogenic fusion proteins |
| CN104073450A (en) * | 2014-02-28 | 2014-10-01 | 重庆市畜牧科学院 | Goat source arcanobacterium pyogenes and application thereof |
| CN103937889A (en) * | 2014-04-14 | 2014-07-23 | 陕西省动物研究所 | Primers and detection method for LAMP detection of arcanobacterium pyogenes |
Non-Patent Citations (2)
| Title |
|---|
| HASAN BASRI ERTAÞ ET AL.: "Isolation of Arcanobacterium (Actinomyces) pyogenes from Abscessed Cattle Kidney and Identification by PCR", 《TURK J VET ANIM SCI》 * |
| 于建华: "《实用临床基础检验》", 31 August 2014 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110967482A (en) * | 2018-09-30 | 2020-04-07 | 重庆市畜牧科学院 | Kit for detecting infection of cryptobacter pyogenes of goats and detection method thereof |
| CN109337996A (en) * | 2018-12-24 | 2019-02-15 | 福建省农业科学院畜牧兽医研究所 | It is a kind of for detecting the primer and probe of goat Arcanobacterium pyogenes |
| CN109439779A (en) * | 2018-12-24 | 2019-03-08 | 林裕胜 | One kind is for detecting goat Arcanobacterium pyogenes real-time fluorescence quantitative PCR primer |
| CN110642927A (en) * | 2019-10-16 | 2020-01-03 | 重庆市畜牧科学院 | Application of protein in preparation of medicine for preventing cryptococcus pyogenes infection |
| CN110642927B (en) * | 2019-10-16 | 2023-04-14 | 重庆市畜牧科学院 | Application of protein in preparation of medicine for preventing cryptococcus pyogenes infection |
| CN113354719A (en) * | 2021-05-11 | 2021-09-07 | 重庆市畜牧科学院 | Proteus mirabilis antigen identification and application thereof in detection of proteus infection |
| CN114959083A (en) * | 2022-06-29 | 2022-08-30 | 西北农林科技大学 | Triple PCR detection primer group and kit |
| CN114959083B (en) * | 2022-06-29 | 2023-08-22 | 西北农林科技大学 | Triple PCR detection primer set and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108048588B (en) | 2021-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108048588A (en) | The detection primer and detection kit of a kind of Arcanobacterium pyogenes | |
| Bolaños et al. | Diagnosis of mycobacteria in bovine milk: an overview | |
| Antila et al. | Bordetella holmesii DNA is not detected in nasopharyngeal swabs from Finnish and Dutch patients with suspected pertussis | |
| Orynbayev et al. | Biological characterization of Pasteurella multocida present in the Saiga population | |
| Kropac et al. | New insights on the role of the pLMST6 plasmid in Listeria monocytogenes biocide tolerance and virulence | |
| Gómez‐Doñate et al. | Development of new host‐specific Bacteroides qPCR s for the identification of fecal contamination sources in water | |
| Braun et al. | Microevolution of anthrax from a young ancestor (MAYA) suggests a soil-borne life cycle of Bacillus anthracis | |
| Mosleh et al. | Antimicrobial susceptibility and analysis of macrolide resistance genes in Streptococcus pneumoniae isolated in Hamadan | |
| Lupo et al. | Phenotypic and molecular characterization of hyperpigmented group B Streptococci | |
| CN109439781A (en) | For detecting the application of the Primer composition, kit and kit of clostridium difficile gene | |
| Li et al. | Mining of novel target genes through pan-genome analysis for multiplex PCR differentiation of the major Listeria monocytogenes serotypes | |
| Zhang et al. | Detection of Salmonella spp. using a generic and differential FRET-PCR | |
| Zhang et al. | Development of hydrolysis probe-based real-time PCR for Identification of virulent gene targets of Burkholderia pseudomallei and B. mallei—a retrospective study on archival cases of service members with melioidosis and glanders | |
| CN104328174B (en) | A kind of detect the LAMP primer of Mus Klebsiella pneumonia, test kit and method | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| Espinosa et al. | Evaluation of simplified DNA extraction methods for Streptococcus suis typing. | |
| Amini et al. | Isolation and identification of methicillin-resistant Staphylococcus aureus from keys of college students using different detection methods | |
| Lim et al. | Detection of Helicobacter pylori in gastric mucosa of patients with gastroduodenal diseases by PCR-restriction analysis using the RNA polymerase gene (rpoB) | |
| CN111118182B (en) | Specific novel molecular target of serotype listeria monocytogenes and rapid detection method thereof | |
| Jamshidi et al. | Isolation and identification of Campylobacter spp. and Campylobacter coli from poultry carcasses by conventional culture method and multiplex PCR in Mashhad, Iran | |
| Shaebth | Molecular identification and sequencing of Pseudomonas aeruginosa virulence genes among different isolates in Al-Diwaneyah hospital. | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| Chang et al. | Identification, clinical aspects, susceptibility pattern, and molecular epidemiology of beta-haemolytic group G Streptococcus anginosus group isolates from central Taiwan | |
| Oladunni et al. | Phylogenetic analysis of Dermatophilus congolensis isolated from naturally infected cattle in Abeokuta and Ilorin, Nigeria | |
| RU2542395C1 (en) | Set of reagents and method for detecting dna of causative agents of plague, anthrax and tularemia by pcr method with hybridisation-fluorescent recording of results |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |