CN108048588B - Detection primer and detection kit for cryptococcus pyogenes - Google Patents
Detection primer and detection kit for cryptococcus pyogenes Download PDFInfo
- Publication number
- CN108048588B CN108048588B CN201810043015.4A CN201810043015A CN108048588B CN 108048588 B CN108048588 B CN 108048588B CN 201810043015 A CN201810043015 A CN 201810043015A CN 108048588 B CN108048588 B CN 108048588B
- Authority
- CN
- China
- Prior art keywords
- pyogenes
- primer
- cryptococcus
- pcr
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of molecular biology, and particularly relates to a detection primer and a detection kit for cryptobacter pyogenes. The invention establishes a specific and sensitive PCR method aiming at the hemolysin PLO gene sequence of the cryptococcus pyogenes, can accurately detect the cryptococcus pyogenes and distinguish other pathogens of goat pyogenic infection. The invention provides positive control bacteria and negative control bacteria for a user to determine the quality of the kit and the accuracy of the evaluation method. The kit and the method provided by the invention can be used in basic level conventional animal epidemic disease diagnosis laboratories, the target strip is clear and easy to distinguish, the PCR reaction can be completed within 1 hour, and the kit and the method have important significance for monitoring the reproduction of the bacteria, the occurrence and prevalence of diseases and the timely prevention and treatment of the diseases.
Description
Technical Field
The invention belongs to the field of molecular biology, and particularly relates to a detection primer and a detection kit for cryptobacter pyogenes.
Background
The cryptococcus pyogenes (Trueperella pyogenes) is a gram-positive corynebacterium parvum, is a conditioned pathogen of important economic animals such as cattle, sheep, pigs and the like, often parasitizes on mucous membranes of upper respiratory tracts and digestive tracts, can cause pyogenic infection of various organs and mucous membranes, and causes great economic loss to the breeding industry. In most cases, cryptobacter pyogenes infection causes chronic wasting disease; when the infection is serious, the death is often caused by sepsis septicemia. In addition, cryptobacter pyogenes can cause infection of various animals such as antelope, camel, dog, cat, elephant, gazelle, african gazelle, parrot, horse, deer, reindeer, turkey, etc.
Cryptobacterium pyogenes is often infected with a mixture of other pathogenic bacteria. The laboratory carries out bacteria separation and identification on purulent samples such as goat lymphadenitis and the like in district farms in Changchang, Yongchuan, Jiangjin, shizhu, Matjiang, Wulong, Suyang, Fengdu and the like in Chongqing city, the highest detectable rate is cocci, mainly staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes and the like, and the second highest detectable rate is bacilli, and the bacilli mainly comprise haemolytic mannheimia, proteus mirabilis, cryptobacter pyogenes, corynebacterium pseudotuberculosis and the like. The bacteria have a wider drug resistance spectrum, and the problem that how to quickly identify pathogens of goat pyogenic infection is urgently needed to be solved is to provide technical support for targeted medication.
The literature discloses a PCR detection method of cryptococcus pyogenes, and the commonly used target genes mainly comprise 16S rRNA genes and hemolysin PLO genes. Although the 16S rRNA gene is used as a molecular target for bacterial species identification, cross reaction often occurs among closely related bacteria, false positive results often occur when the gene is used as a target gene for diagnosis and detection, and sequence determination and sequence comparison are needed to be carried out on the obtained product so as to further identify pathogens. The hemolysin PLO is one of the main virulence factors of the cryptococcus pyogenes, and all cryptococcus pyogenes isolates have PLO genes, which are commonly used target genes for detection. BLAST search on NCBI found that PLO gene is relatively conserved in different isolates of Cryptococcus pyogenes, the homology is higher than 96%, and the PLO gene has no homology with other bacteria; the homology of the PLO protein is higher than 98% in different isolates of Cryptococcus pyogenes and lower than 67% with other bacteria.
In the process of detecting goat suppurative samples, the experiment discovers that the PCR detection method established based on the PLO gene of the purulent occult bacillus hemolysin is most easily subjected to cross reaction with the pseudotuberculosis corynebacterium, and fragments amplified from DNA of two bacteria are often similar in size and are not easy to distinguish.
The CN 103937889B provided by the invention detects the cryptococcus pyogenes according to a loop-mediated isothermal amplification (LAMP) method with higher sensitivity established by PLO genes. Compared with the PCR method, the LAMP method has obvious detection advantages, does not need an expensive PCR instrument, and has high detection sensitivity, strong specificity, visual result and the like; the LAMP method has obvious detection defects, and has the advantages of high reagent cost, multiple operation steps and the like, and nucleic acid extraction and reagent addition require clean and closed spaces to prevent pollution. Facilities such as the grass-roots veterinary station are currently equipped with PCR instruments, electrophoresis instruments and the like, but are not equipped with a laboratory with high cleanliness or a separate space for reducing aerosol generation.
Therefore, a conventional PCR detection method is established based on the PLO gene and constitutes a kit, and the established PCR method has the advantages of high specificity, high sensitivity and short time consumption.
Disclosure of Invention
In view of the above, an object of the present invention is to provide a primer set for PCR detection of cryptobacter pyogenes, which has high specificity and can avoid cross reaction with common bacteria such as corynebacterium pseudotuberculosis.
In order to achieve the purpose, the technical scheme of the invention is as follows:
the primer pair for PCR detection of the cryptococcus pyogenes is an upstream primer F1 and a downstream primer R1, wherein the sequence of F1 is shown as SEQ ID NO. 1, and the sequence of R1 is shown as SEQ ID NO. 2.
The invention designs a strong specificity primer which is a key factor for realizing the purpose, in order to overcome the false positive of PCR detection of the cryptococcus pyogenes, the invention searches a primer sequence from a PLO gene, selects 4 pairs of ideal primer pairs F1/R1, F2/R2, F3/R3 and F4/R4(SEQ ID NO:1-8), and respectively amplifies 12 bacteria such as the cryptococcus pyogenes, corynebacterium pseudotuberculosis, staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes, mannheimia haemolytica, proteus mirabilis, staphylococcus aureus, enterococcus, escherichia coli, salmonella, paenibacillus and the like, and only F1/R1 can specifically detect the cryptococcus pyogenes. And sequencing 300F 1/R1PCR amplification products of the culture and clinical samples, wherein BLAST analysis results are all cryptobacter pyogenes PLO genes, and the reliability of the detection results of the method and the kit is ensured.
The reference sequence for designing the primers is a PLO gene sequence in a goat-purulent cryptic bacillus Chongqing isolate 2012CQ-ZSH genome (GenBank accession number CP012649), and the sequence is shown as SEQ ID NO 9.
The second purpose of the invention is to provide a PCR detection kit for Cryptococcus pyogenes, which is prepared based on the first purpose primer pair, and has the advantages of strong specificity, high sensitivity, accurate detection, short time consumption and effectiveness.
In order to achieve the purpose, the technical scheme of the invention is as follows:
the PCR detection kit comprises: f1 and R1 each 100. mu.L, 2XPCR Mix 1.25mL, positive control, negative control and ultrapure water 2.5 mL.
Preferably, the 2xPCR Mix is prepared from 2 XPPCR Mix and 3mmol/LMgCl2100mmol/LKCl, 500. mu. mol/LdNTP each, 20mmol/LTris-HCl (pH 8.3) and 0.2U/. mu. LTaq polymerase.
Negative controls (negative controls) and positive controls (positive controls) are directed to "expected results". All groups with positive expected results were positive control groups. All groups that did not show the expected result were negative control groups.
Preferably, the positive control is inactivated lyophilized powder of cryptococcus pyogenes or a PCR product of cryptococcus pyogenes.
Preferably, the negative control is ultrapure water or inactivated bacteria lyophilized powder, and the bacteria are one or more of corynebacterium pseudotuberculosis, staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes, mannheimia haemolytica, proteus mirabilis, staphylococcus aureus, enterococcus, escherichia coli, salmonella and paenibacillus.
Further, preferably, the negative control is a mixture inactivated lyophilized powder of corynebacterium pseudotuberculosis, staphylococcus pyogenes, staphylococcus aureus, streptococcus pyogenes, mannheimia haemolytica, proteus mirabilis, leuconostoc, enterococcus, escherichia coli, salmonella, and paenibacillus. The effect of the primers can be visually observed by taking the bacteria inactivated freeze-dried powder as a negative control in the kit, and the cryptobacter pyogenes is distinguished from other 11 bacteria.
The invention also aims to provide a detection method based on the objective cryptococcus pyogenes PCR detection kit, which is simple to operate, short in PCR time consumption and high in accuracy.
In order to achieve the purpose, the technical scheme of the invention is as follows:
the PCR detection method for the cryptobacter pyogenes comprises the following steps:
1) and (3) extracting DNA: extracting DNA of a sample to be detected and/or negative and positive controls for later use;
2) gene amplification: adding the DNA extracted in the step 1) into the detection kit of any one of 2-6, and carrying out PCR amplification on the DNA;
3) and (3) detection: and carrying out agarose gel electrophoresis detection on the DNA amplification product.
Preferably, the sample to be detected in step 1) is a pure culture of bacteria, animal tissue or pus.
The bacterial culture can use a bacterial DNA extraction kit to extract DNA for PCR detection, and can also directly use a boiling method to prepare bacterial DNA for PCR detection. The method for preparing the bacterial DNA by the boiling method comprises the following steps: centrifuging 1mL of bacterial solution at 12000 Xg for 1min, discarding the supernatant, adding 100 μ L of deionized water to suspend the bacteria, boiling in a water bath for 10min, cooling, centrifuging at 12000 Xg for 10min, and collecting the supernatant for PCR detection. The tissue or pus DNA can be extracted by using a tissue DNA extraction kit, or the tissue or pus grinding fluid can be inoculated, and after the bacterial fluid is turbid, the bacterial DNA is prepared by a boiling method for PCR detection. The inoculation treatment method of the tissue or pus grinding fluid comprises the following steps: taking 0.1-1 g of tissue or pus with suppurative focus under aseptic condition, placing the tissue or pus in an aseptic homogenizer for homogenization, taking 50 mu L of homogenate, adding the homogenate into a TSB culture medium containing 10% fetal calf serum, culturing at 37 ℃ until the tissue or pus is turbid, removing bacterial liquid, and preparing bacterial DNA for PCR detection according to the boiling method.
Preferably, the PCR amplification process in step 2) comprises:
94 ℃ for 2 min; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 15 s; 3min at 72 ℃.
The invention has the beneficial effects that: the primer pair or the kit for detecting the cryptobacter pyogenes provided by the invention has the following advantages: (1) the base layer is alwaysInstruments and conditions of a laboratory for diagnosing the epidemic diseases of the regular animals can meet the detection requirement; (2) the specificity is high, the cross reaction with common bacteria in purulent samples such as pseudotuberculosis corynebacterium can be avoided, and a mixture of the common cross-reacting bacteria such as the pseudotuberculosis corynebacterium is used as a negative control; (3) high sensitivity, can detect 1X 10 at the lowest-3ng/mu L of cryptococcus pyogenes genome DNA; (4) the size of the PCR product is 264bp, the band is easy to distinguish from a primer dimer, and the target band is clear and has no impurity band; (5) the time is short, and the PCR reaction takes 1 hour.
Drawings
FIG. 1 shows the result of PCR detection of the F1/R1 primer pair. (M: Marker DL 2000; 1: Cryptococcus pyogenes solid culture; 2: Cryptococcus pyogenes liquid culture; 3: lung tissue; 4: lymph node tissue; 5: pus; 6: positive control; 7-13: Corynebacterium pseudotuberculosis, Staphylococcus, Proteus mirabilis, Paenibacillus, Streptococcus pyogenes, deinococcus minuensis, Escherichia coli, enterococcus; 14: negative control)
FIG. 2 shows the result of PCR detection of the F2/R2 primer pair. (M: Marker DL 2000; 1: Cryptococcus pyogenes solid culture; 2: Cryptococcus pyogenes liquid culture; 3: lung tissue; 4: lymph node tissue; 5: pus; 6: positive control; 7-13: Corynebacterium pseudotuberculosis, Staphylococcus, Proteus mirabilis, Paenibacillus, Streptococcus pyogenes, deinococcus minuensis, Escherichia coli, enterococcus; 14: negative control)
FIG. 3 shows the result of PCR detection of the F3/R3 primer pair. (M: Marker DL 2000; 1: Cryptococcus pyogenes solid culture; 2: Cryptococcus pyogenes liquid culture; 3: lung tissue; 4: lymph node tissue; 5: pus; 6: positive control; 7-13: Corynebacterium pseudotuberculosis, Staphylococcus, Proteus mirabilis, Paenibacillus, Streptococcus pyogenes, deinococcus minuensis, Escherichia coli, enterococcus; 14: negative control)
FIG. 4 shows the result of PCR detection of the F4/R4 primer pair. (M: Marker DL 2000; 1: Cryptococcus pyogenes solid culture; 2: Cryptococcus pyogenes liquid culture; 3: lung tissue; 4: lymph node tissue; 5: pus; 6: positive control; 7-13: Corynebacterium pseudotuberculosis, Staphylococcus, Proteus mirabilis, Paenibacillus, Streptococcus pyogenes, deinococcus minuensis, Escherichia coli, enterococcus; 14: negative control)
FIG. 5 shows the results of PCR sensitivity test using the F1/R1 primer set. (M: Marker DL 2000; 1: 1000 ng/. mu.L; 2: 1000X 10)-1ng/μL；3：1000×10-2ng/μL；4：1000×10-3ng/μL；5：1000×10-4ng/μL；6：1000×10- 5ng/μL；7：1000×10-6ng/μL；8：1000×10-7ng/μL；9：1000×10-8ng/μL；10：1000×10-9ng/mu L; 11: negative control)
FIG. 6 shows the PCR results of clinical samples tested using the F1/R1 primer set. (M: Marker DL 2000; 1: positive control; 2: negative control; 3-7: clinical sample)
Detailed Description
Hereinafter, preferred embodiments of the present invention will be described in detail (with reference to the accompanying drawings). The experimental methods of the preferred embodiments, which do not indicate specific conditions, are generally performed according to conventional conditions, and the examples are given for better illustration of the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art should make insubstantial modifications and adaptations to the embodiments of the present invention in light of the above teachings and remain within the scope of the invention.
1. Strains and samples
The cryptobacter pyogenes, the corynebacterium pseudotuberculosis, the staphylococcus, the proteus mirabilis, the paenibacillus, the streptococcus pyogenes, the leuconostoc, the enterococcus, the escherichia coli, the enterococcus and the like are separated, identified and stored in the laboratory. The lung tissue, lymph node tissue and pus of the mouse which is confirmed to be infected by the cryptococcus pyogenes are attacked, identified and stored in the laboratory.
2. Reagent
The liquid TSB culture medium is prepared by weighing 40g of TSA powder, adding 950mL of deionized water, sterilizing at 121 ℃ for 15 minutes, cooling to about 50 ℃, adding 50mL of newborn bovine serum, and fully shaking up.
The solid TSB culture medium is prepared by weighing 40g of TSA powder and 17g of agar powder, adding 950mL of deionized water, sterilizing at 121 ℃ for 15 minutes, cooling to about 50 ℃, adding 50mL of newborn bovine serum, and fully shaking up.
PCR Mix, bacterial DNA extraction kit, lysate, protease K, Tris saturated phenol, chloroform and the like.
Example 1
Preparation of DNA template
Firstly, liquid culture, namely centrifuging 1mL of bacterial solution at 12000 Xg for 1min, discarding the supernatant, adding 100 mu L of deionized water to suspend the thalli, carrying out boiling water bath for 10min, cooling, centrifuging at 12000 Xg for 10min, and taking the supernatant as a template.
② solid culture, scraping pure culture of the purulent cryptococcus pyogenes, suspending in 100 mu L deionized water, boiling in water bath for 10min, cooling, centrifuging at 12000 Xg for 10min, and taking supernatant as a template.
③ adding PBS into a sample of lung tissue, lymph node tissue and pus, grinding, incubating for 10min at room temperature and 5000r/min, taking 500 mu L of supernatant, adding 50 mu L of 10% SDS solution and 10 mu L of 20 mu g/mL proteinase K, bathing for 2h at 56 ℃, adding 500 mu L of saturated phenol, fully mixing uniformly, centrifuging for 10min at 12000 Xg/min, taking supernatant, adding chloroform with equal amount: isoamyl alcohol (24: 1), fully mixing, centrifuging at 12000 Xg/min for 10min, taking the supernatant, adding absolute ethyl alcohol with the volume of 2 times of the volume of the supernatant, standing at-20 ℃ for 20min, centrifuging at 12000 Xg/min for 10min, removing the supernatant, adding 70 percent of ethyl alcohol to wash the precipitate, removing the ethyl alcohol, adding 20 mu L of sterilized deionized water to dissolve the precipitate, and storing at-20 ℃ as a template.
2. Primer design
According to the PLO gene sequence in the genome (GenBank accession number CP012649) of the Synechococcus pyogenes Chongqing isolate 2012CQ-ZSH, primers are searched by a Primer-BLAST method, and 4 pairs of primers are screened from candidate primers. The primer is synthesized by Shanghai biological engineering Co., Ltd, and the sequence of the primer is shown in Table 1 and SEQ ID NO: 1-8.
TABLE 1PCR primer pair sequences
PCR amplification
The extracted DNA template was subjected to PCR amplification using the primers, the negative control was ultrapure water, the PCR reaction system was 20. mu.L, and the reaction system is shown in Table 2.
TABLE 2PCR reaction System
The PCR reaction parameters are as follows:
94 ℃ for 2 min; 30 cycles at 94 ℃ for 30sec, 60 ℃ for 30sec, 72 ℃ for 15 sec; 3min at 72 ℃; storing at room temperature.
PCR product detection and result analysis
5 mu of the PCR amplification product was added to the well, and 1.2% agarose gel electrophoresis was carried out at a constant pressure of 120V using 1 XTAE buffer as the electrophoresis solution, after which the gel was photographed in a gel imager to observe the PCR result. Positive bands were recovered, cloned into pMD18-T, transformed e.g.DH 5 α, positive clones were selected for sequencing of the insert and BLST searches were performed at NCBI for homology alignment.
The test results are shown in FIGS. 1-4, and the target bands with the expected sizes can be specifically amplified by 4 pairs of primers from the culture of the Cryptococcus pyogenes, the lung tissue, the lymph node tissue and the pus which are diagnosed to contain the Cryptococcus pyogenes. The sequence determination and sequence analysis results show that the obtained sequence has more than 92 percent of homology with the PLO gene of the cryptococcus pyogenes, has no homology with other bacteria, and shows that the sequence is the PLO gene of the cryptococcus pyogenes.
Specificity test of PCR
Culturing bacteria such as corynebacterium pseudotuberculosis, staphylococcus, proteus mirabilis, paenibacillus, streptococcus pyogenes, leuconostoc, enterococcus, escherichia coli, enterococcus, mannheimia haemolytica, salmonella, etc., centrifuging 1mL of the bacterial liquid at 12000 Xg for 1min, discarding the supernatant, adding 100 mu L of deionized water to suspend the bacteria, carrying out boiling water bath for 10min, cooling, centrifuging at 12000 Xg for 10min, and taking the supernatant as a template.
The extracted DNA template was subjected to PCR amplification using the primers, and the PCR reaction system was 20. mu.L, which is shown in Table 2. The circulation system is as follows: 94 ℃ for 2 min; 30 cycles at 94 ℃ for 30sec, 60 ℃ for 30sec, 72 ℃ for 15 sec; 3min at 72 ℃; storing at room temperature. 5 mu of the PCR amplification product was added to the well, and 1.2% agarose gel electrophoresis was carried out at a constant pressure of 120V using 1 XTAE buffer as the electrophoresis solution, after which the gel was photographed in a gel imager to observe the PCR result.
As shown in FIGS. 1 to 4, only the F1/R1 primer pair can amplify specific bands from the DNA template of the Cryptococcus pyogenes, but not from the DNAs of bacteria such as Corynebacterium pseudotuberculosis, Staphylococcus, Proteus mirabilis, Paenibacillus, Streptococcus pyogenes, Plenococcus minuensis, enterococcus, Escherichia coli, enterococcus, Mannheimia haemolytica, Salmonella and the like, which indicates that the F1/R1 primer pair can accurately detect the Cryptococcus pyogenes and distinguish other bacteria.
PCR sensitivity test
Inoculating fresh Cryptococcus pyogenes single colony in liquid TSB culture medium, culturing at 37 deg.C for 48 hr, collecting thallus, washing thallus with PBS for 3 times, extracting DNA with bacterial DNA extraction kit, determining nucleic acid quality, adjusting concentration to 1000ng/μ L, sequentially diluting to 1000 × 10-1ng/μL、1000×10-2ng/μL、1000×10-3ng/μL、1000×10-4ng/μL、1000×10- 5ng/μL、1000×10-6ng/μL、1000×10-7ng/μL、1000×10-8ng/μL、1000×10-9ng/. mu.L. Using the 10 diluted DNA solutions as templates, adding the components according to the table 2 for PCR amplification, wherein the cycle system is as follows: 94 ℃ for 2 min; 30 cycles at 94 ℃ for 30sec, 60 ℃ for 30sec, 72 ℃ for 15 sec; 3min at 72 ℃; stored at room temperature to test the sensitivity of the PCR method.
The results of the test are shown in FIG. 5, where the template concentration is 1000X 10-6Clear and visible target bands can appear at ng/mu L, and the template is thickDegree less than 1000 x 10-6no obvious band appears at ng/mu L, so the minimum template concentration for accurately detecting the cryptobacter pyogenes is 1000 multiplied by 10-6ng/. mu.L, i.e. 1X 10-3ng/mu L, the kit provided by the invention can be used for detecting a sample to be detected, and can accurately detect that the DNA of the cryptobacter pyogenes is not less than 1 multiplied by 10-3ng/μL。
The lower limit of the concentration of the DNA of the detection template is 1 multiplied by 10-3ng/mu L proves that the sensitivity of the method for detecting the cryptobacter pyogenes is high.
Example 2
Clinical samples including tissues, pus, etc. were examined using the F1/R1 primer set of example 1, which is highly specific.
DNA preparation
Adding PBS into a sample, grinding, incubating at room temperature for 10min, 5000r/min, taking 500 mu L of supernatant, adding 50 mu L of 10% SDS solution and 10 mu L of 20 mu g/mL proteinase K, carrying out water bath at 56 ℃ for 2h, adding 500 mu L of LTris saturated phenol, fully mixing uniformly, centrifuging at 12000 Xg/min for 10min, taking supernatant, adding equal amount of chloroform: isoamyl alcohol (24: 1), fully and uniformly mixed, then centrifuged at 12000 Xg/min for 10min, the supernatant is taken and added with 2 times of volume of absolute ethyl alcohol, the mixture is kept stand at the temperature of minus 20 ℃ for 20min, centrifuged at 12000 Xg/min for 10min, the supernatant is discarded, 70 percent of ethyl alcohol is added to wash the sediment, the ethyl alcohol is discarded, 20 mu L of sterilized deionized water is added to dissolve the sediment, and the mixture is stored at the temperature of minus 20 ℃ for PCR detection.
500. mu.L of deionized water was added to the inactivated lyophilized powder of the positive control Cryptobacterium pyogenes and the inactivated lyophilized powder of the negative control Corynebacterium pseudotuberculosis, and control DNA was prepared in the same manner as the preparation of DNA of samples such as tissues.
PCR detection
The extracted DNA template was subjected to PCR amplification using the F1/R1 primer set, the negative control was a pseudotuberculosis Corynebacterium DNA, the PCR reaction system was 20. mu.L, and the reaction system is shown in Table 3.
TABLE 3 PCR detection reaction System for Cryptobacterium pyogenes
The circulation system is as follows: 94 ℃ for 2 min; 30 cycles at 94 ℃ for 30sec, 60 ℃ for 30sec, 72 ℃ for 15 sec; 3min at 72 ℃; storing at room temperature.
Analysis of PCR results
5 mu of the PCR amplification product was added to the well, and 1.2% agarose gel electrophoresis was carried out at a constant pressure of 120V using 1 XTAE buffer as the electrophoresis solution, after which the gel was photographed in a gel imager to observe the PCR result. And (4) carrying out sequence determination and sequence analysis on the positive target band.
As shown in FIG. 6, the PCR method based on the F1/R1 primer pair can amplify a target band with a size corresponding to the expected size from a clinical sample. Sequencing and sequencing analysis of 300 positive test strips (280 of which were amplified from clinical specimens) showed that the sequence was the P.pyogenes PLO gene. The result shows that the kit and the PCR method established by the invention can effectively detect the cryptobacter pyogenes from the clinical sample to be detected.
Finally, the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all of them should be covered in the claims of the present invention.
<110> institute of zootechnics in Chongqing City
<120> detection primer and detection kit for cryptococcus pyogenes
<160> 9
<170> PatentIn Version 2.1
<210> 1
<211> 20
<212> DNA
<213> Artificial design of primer F1
<400> 1
TTGATAACGGTCCACCACGG 20
<210> 2
<211> 20
<212> DNA
<213> Artificial design of primer R1
<400> 2
CACTGCCACGACCTACAAGT 20
<210> 3
<211> 20
<212> DNA
<213> Artificial design of primer F2
<400> 3
TAGCTCTGGCTGGGATGTCT 20
<210> 4
<211> 20
<212> DNA
<213> Artificial design of primer R2
<400> 4
GTGGGACGAGATCAGCTACG 20
<210> 5
<211> 20
<212> DNA
<213> Artificial design of primer F3
<400> 5
GATCCTTGGTAACCGGCACA 20
<210> 6
<211> 20
<212> DNA
<213> Artificial design of primer R3
<400> 6
GGGAAACAGCTCGGGATTGA 20
<210> 7
<211> 20
<212> DNA
<213> Artificial design of primer F4
<400> 7
GATCCTTGGTAACCGGCACA 20
<210> 8
<211> 20
<212> DNA
<213> Artificial design of primer R4
<400> 8
GGGAAACAGCTCGGGATTGA 20
<210> 9
<211> 1605
<212> DNA
<213> PLO Gene sequence of Cryptococcus pyogenes (Trueperella pyogenes)
<400> 9
atgaaacgaa aggcttttgc atcgctagtg gcgagtgtag ttgcagcagc aactgtcacg 60
atgcccacag catcttttgc tgccggattg ggaaacagct cgggattgac ggacggcttg 120
tcagcgccgc gagcctccat ctccccgatg gataaagttg accttaagtc ggcgcaagag 180
actaacgaga cgagcgtcga taagtacatt cgtggtctga aatacgatcc ctctggtgta 240
cttgcagtca agggtgagtc tattgaaaat gtgccggtta ccaaggatca gctcaaggac 300
ggcacctaca cggtatttaa gcacgaacgc aagagtttta acaatttgcg ttcggacatc 360
tctgcgttcg atgcgaacaa cgcccacgtc tatcctgggg cgctcgtgtt agcaaataaa 420
gatcttgcaa aaggtagtcc gacttcgatc ggaattgcac gtgctccgca aactgtcagc 480
gttgatttgc caggattagt tgacggtaag aataaggtcg tcatcaacaa tcccacgaag 540
agttccgtga ctcaaggaat gaacggcctt ctcgacggtt ggattcagcg caacagcaag 600
tatcctgacc atgctgcaaa gatttcttac gatgagacta tggtgacgtc aaagcgtcaa 660
ctggaggcaa agcttggcct cggatttgaa aaggtctcag caaagctcaa cgtggacttc 720
gatgcaattc ataagcgtga acggcaggtg gctatcgctt ccttcaaaca gatttactac 780
acggctagcg tagatacacc gacatctcca catagcgttt tcggcccgaa tgtcaccgca 840
caggatttga aagatcgggg agtcaataac aagaatcctc taggatacat ttcgtcggtc 900
agctatggac gccagatttt tgtcaagctg gaaacgacct cgacttccaa tgatgtacaa 960
gcggctttta gcggcctgtt caaagctaag ttcggcaatc tttccacaga attcaagact 1020
aagtatgccg atatcctgaa caagacccga gctactgtgt acgtcgttgg tggcagcgcc 1080
aggggcggag ttgaagttgc aactggcaac atcgatgcgc tcaagaagat tatcaaggag 1140
gagagtacct tctccacgaa ggttcctgcc gtgcccgttt cctatgccgt caatttcttg 1200
aaggataacc agctggcagc tgttaggagc agcggtgatt acattgaaac cactgccacg 1260
acctacaagt ctggtgagat tacgttccgc catggcggtg gctacgtcgc gaagttcagg 1320
ctgaagtggg acgagatcag ctacgacccg cagggtaagg agatccgcac ccccaagacg 1380
tggagtggga attgggtcgg ccgtacagcc ggcttccgcg agactattca acttccggca 1440
aacgcccgca acatccatgt ggaagcaggt gaggcgacag gtctagcgtg ggatccgtgg 1500
tggaccgtta tcaacaagaa gaatctcccc ttggtgccac atcgagagat cgtccttaag 1560
ggtacgacgc tcaatccctg ggtcgaggaa aatgttaaac cctag 1605
Claims (5)
1. The primer pair for PCR detection of the cryptococcus pyogenes is characterized by comprising an upstream primer F1 and a downstream primer R1, wherein the sequence of the primer F1 is shown as SEQ ID NO. 1, the sequence of the primer R1 is shown as SEQ ID NO. 2, and the primer pair can accurately detect the concentration of the primers which is not lower than 1 x 10-3ng/. mu.L of Cryptococcus pyogenes DNA.
2. The PCR detection kit for Cryptococcus pyogenes, which is prepared based on the primer pair of claim 1, is characterized by comprising: f1 and R1 each 100. mu.L, 2XPCR Mix 1.25mL, positive control, negative control and ultrapure water 2.5 mL.
3. The test kit according to claim 2, wherein the 2XPCR Mix consists of 3mmol/LMgCl2100mmol/L KCl, 500. mu. mol/L dNTP each, 20mmol/L Tris-HCl and 0.2U/. mu.L Taq polymerase, the Tris-HCl having a pH of 8.3.
4. The detection kit according to claim 2, wherein the positive control is inactivated powder of Cryptococcus pyogenes or PCR product of Cryptococcus pyogenes.
5. The detection kit according to claim 2, wherein the negative control is ultrapure water or inactivated lyophilized bacteria powder, and the bacteria are one or more of corynebacterium pseudotuberculosis, staphylococcus, streptococcus pyogenes, mannheimia haemolytica, proteus mirabilis, leuconostoc, enterococcus, escherichia coli, salmonella and paenibacillus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810043015.4A CN108048588B (en) | 2018-01-17 | 2018-01-17 | Detection primer and detection kit for cryptococcus pyogenes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810043015.4A CN108048588B (en) | 2018-01-17 | 2018-01-17 | Detection primer and detection kit for cryptococcus pyogenes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108048588A CN108048588A (en) | 2018-05-18 |
| CN108048588B true CN108048588B (en) | 2021-04-06 |
Family
ID=62127729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810043015.4A Active CN108048588B (en) | 2018-01-17 | 2018-01-17 | Detection primer and detection kit for cryptococcus pyogenes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108048588B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110967482B (en) * | 2018-09-30 | 2023-04-07 | 重庆市畜牧科学院 | Kit for detecting infection of cryptobacter pyogenes of goats and detection method thereof |
| CN109337996A (en) * | 2018-12-24 | 2019-02-15 | 福建省农业科学院畜牧兽医研究所 | It is a kind of for detecting the primer and probe of goat Arcanobacterium pyogenes |
| CN109439779A (en) * | 2018-12-24 | 2019-03-08 | 林裕胜 | One kind is for detecting goat Arcanobacterium pyogenes real-time fluorescence quantitative PCR primer |
| CN110642927B (en) * | 2019-10-16 | 2023-04-14 | 重庆市畜牧科学院 | Application of protein in preparation of medicine for preventing cryptococcus pyogenes infection |
| CN113354719B (en) * | 2021-05-11 | 2023-05-30 | 重庆市畜牧科学院 | Proteus mirabilis antigen identification and application thereof in detection of Proteus infection |
| CN114959083B (en) * | 2022-06-29 | 2023-08-22 | 西北农林科技大学 | Triple PCR detection primer set and kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937889A (en) * | 2014-04-14 | 2014-07-23 | 陕西省动物研究所 | Primers and detection method for LAMP detection of arcanobacterium pyogenes |
| CN104073450A (en) * | 2014-02-28 | 2014-10-01 | 重庆市畜牧科学院 | Goat source arcanobacterium pyogenes and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012134975A1 (en) * | 2011-03-28 | 2012-10-04 | St. Jude Children's Research Hospital | Methods and compositions employing immunogenic fusion proteins |
-
2018
- 2018-01-17 CN CN201810043015.4A patent/CN108048588B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104073450A (en) * | 2014-02-28 | 2014-10-01 | 重庆市畜牧科学院 | Goat source arcanobacterium pyogenes and application thereof |
| CN103937889A (en) * | 2014-04-14 | 2014-07-23 | 陕西省动物研究所 | Primers and detection method for LAMP detection of arcanobacterium pyogenes |
Non-Patent Citations (1)
| Title |
|---|
| Isolation of Arcanobacterium (Actinomyces) pyogenes from Abscessed Cattle Kidney and Identification by PCR;Hasan Basri ERTAÞ et al.;《Turk J Vet Anim Sci》;20050510;第29卷(第2期);第456页右栏 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108048588A (en) | 2018-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108048588B (en) | Detection primer and detection kit for cryptococcus pyogenes | |
| Rodrigues et al. | The Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) identification versus biochemical tests: a study with enterobacteria from a dairy cattle environment | |
| Gómez‐Doñate et al. | Development of new host‐specific Bacteroides qPCR s for the identification of fecal contamination sources in water | |
| AU2011313763A1 (en) | Detection of Fusobacterium in a gastrointestinal sample to diagnose gastrointestinal cancer | |
| Bai et al. | Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Mycoplasma bovis | |
| CN104450940B (en) | A kind of nucleotide sequence and detection method and detection kit for detecting Listeria Monocytogenes | |
| Zhang et al. | Development of a multiplex PCR for simultaneous detection of Pasteurella multocida, Mannheimia haemolytica and Trueperella pyogenes | |
| Jamshidi et al. | Isolation and identification of Campylobacter spp. and Campylobacter coli from poultry carcasses by conventional culture method and multiplex PCR in Mashhad, Iran | |
| CN111020039B (en) | Campylobacter jejuni species specific molecular target and rapid detection method thereof | |
| CN111118182B (en) | Specific novel molecular target of serotype listeria monocytogenes and rapid detection method thereof | |
| Khanamir et al. | First study on molecular epidemiology of caseous lymphadenitis in slaughtered sheep and goats in Duhok Province, Iraq | |
| CN109628621B (en) | Real-time quantitative LAMP primer group and kit for detecting Klebsiella pneumoniae | |
| WOO et al. | Thermo-tolerant Campylobacter fetus bacteraemia identified by 16S ribosomal RNA gene sequencing: an emerging pathogen in immunocompromised patients | |
| Sedeek et al. | Molecular epidemiology and sequencing of avian pathogenic Escherichia coli APEC in Egypt | |
| CN108504756B (en) | Aeromonas veronii detection primer, kit, detection method and development method thereof based on specific sequence | |
| Abd-Elsadek et al. | Molecular studies on Pasteurella multocida in ducks | |
| CN112538543B (en) | Specific primer for detecting salmonella and kit thereof | |
| CN111206110B (en) | Specific primers, kit and method for synchronously detecting klebsiella pneumoniae and golden yellow bacillus of large yellow croaker source | |
| Qiu et al. | Identification and genomic analysis of a pathogenic strain of Mycoplasma hyopneumoniae (TB1) isolated from Tibetan pigs | |
| Padungtod et al. | Identification of Campylobacter jejuni isolates from cloacal and carcass swabs of chickens in Thailand by a 5′ nuclease fluorogenic polymerase chain reaction assay | |
| JP2007244348A (en) | Primer set for detecting lactococcus lactis subsp. cremoris fc strain, and method for molecularly identifying lactococcus lactis subsp. cremoris fc strain by using the primer set | |
| Ahmed et al. | Isolation and molecular diagnosis of the main bacterial species causing Pneumonia in small ruminants in the Duhok Abattoir-Kurdistan region of Iraq | |
| Shivachandra et al. | Molecular diagnostic approaches for haemorrhagic septicaemia [HS]: A Review | |
| Othman et al. | Conventional and molecular detection of Pasteurella multocida in outbreak of respiratory tract infection of sheep and goats in Basrah Province | |
| Christensen et al. | PCR-detection of Hemophilus paragallinarum, Hemophilus somnus, Mannheimia (Pasteurella) hemolytica, Mannheimia spp., Pasteurella trehalosi, and Pasteurella multocida |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |