CN111593138A - Duck hepatitis B virus recombinant polymerase isothermal amplification detection method - Google Patents
Duck hepatitis B virus recombinant polymerase isothermal amplification detection method Download PDFInfo
- Publication number
- CN111593138A CN111593138A CN201910894805.8A CN201910894805A CN111593138A CN 111593138 A CN111593138 A CN 111593138A CN 201910894805 A CN201910894805 A CN 201910894805A CN 111593138 A CN111593138 A CN 111593138A
- Authority
- CN
- China
- Prior art keywords
- virus
- duck hepatitis
- isothermal amplification
- seq
- rpa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a duck hepatitis B virus recombinant polymerase isothermal amplification detection method, a special RPA primer pair (shown as SEQ ID NO.1 and SEQ ID NO.2) and a kit. The invention designs specific primers according to the gene sequence of the duck hepatitis B virus, and further optimizes and establishes a recombinase polymerase isothermal amplification method for quickly and accurately detecting the duck hepatitis B virus. The method can specifically detect the duck hepatitis B virus, the minimum detection template amount is 146pg, and the sensitivity is equivalent to that of the traditional PCR. As the whole gene amplification only needs one temperature, no special instrument and equipment are needed, the operation is simpler and quicker, and the method is suitable for the field quick detection of the duck hepatitis B virus in production.
Description
Technical Field
The invention relates to an isothermal amplification detection method for duck hepatitis B virus recombinant polymerase, belonging to the technical field of molecular biology.
Background
Hepatitis B Virus (HBV) infection is a major public health problem worldwide. Because of the narrow host range of HBV, obvious hepatotropic and species specificity, the artificial culture of HBV has not been successful, and the establishment of ideal HBV infected cells and animal models is also difficult, which has become a major obstacle to the development and evaluation of anti-HBV drugs. The Duck Hepatitis B Virus (DHBV) and HBV belong to the hepadnaviridae, the two have a plurality of similarities in morphological structure, nucleic acid composition, biological characteristics, pathogenesis, relative hepadnaviridae and the like, and meanwhile, the duck is susceptible to the DHBV, rich in source, low in price, easy to feed and often used as an ideal animal model for screening anti-HBV drugs and researching HBV pathogenesis. Therefore, it is necessary to know the current situation of the duck group hepatitis B and the infection situation in time.
At present, a plurality of methods for detecting DHBV DNA exist, wherein the methods such as Southern blot hybridization, dot hybridization and the like have low sensitivity, poor stability and complex operation and are not commonly used. The technologies such as Polymerase Chain Reaction (PCR), real-time fluorescence quantitative PCR, etc. are widely applied, but the technologies rely on a thermal cycler with accurate temperature control, which limits the application of the technologies in clinical field detection. The nucleic acid isothermal amplification technology does not need repeated thermal denaturation, does not need special instruments, has higher reaction speed, is suitable for on-site rapid detection, and is widely applied in the field of life science research.
The recombinase polymerase amplification technology (RPA) is a novel isothermal amplification technology, has the advantages of simple operation, strong specificity, high sensitivity, short detection time and the like, and can complete nucleic acid amplification under the condition of no laboratory. The RPA technology can be used for absolutely quantifying the copy number of nucleic acid and simultaneously detecting a plurality of target nucleic acid sequences, and is particularly widely applied to the field of pathogenic detection at present.But do notSo far, reports of adopting an RPA technology to detect duck hepatitis B virus are not found.
Disclosure of Invention
Aiming at the prior art, the invention provides an isothermal amplification detection method of duck hepatitis B virus recombinant polymerase, and a specific primer and a detection kit used by the method.
The invention is realized by the following technical scheme:
an RPA primer pair for detecting duck hepatitis B virus comprises an upstream primer and a downstream primer, wherein the nucleotide sequences of the upstream primer and the downstream primer are shown as SEQ ID NO.1 and SEQ ID NO. 2; the nucleotide sequence of the genetic marker specifically amplified is shown as SEQ ID NO. 3;
an upstream primer F: 5'-GCCTTAGCCAATGTGTATGA-3' (SEQ ID NO. 1);
a downstream primer R: 5'-GGTGGAACAGGAGTAGTAGT-3' (SEQ ID NO. 2).
The RPA primer pair is applied to the preparation of a kit for detecting duck hepatitis B virus.
The application of the genetic marker in the preparation of the kit for detecting the duck hepatitis B virus is disclosed, wherein the nucleotide sequence of the genetic marker is shown as SEQ ID NO. 3.
A kit for detecting duck hepatitis B virus comprises the RPA primer pair and reagents necessary for detection, such as Rehydration Buffer and ddH2O and MgAc.
A duck hepatitis B virus recombinant polymerase isothermal amplification detection method comprises the following steps:
(1) extracting genome DNA of a substance to be detected (refer to EasyPure @ ViralDNA/RNA Kit instruction), and carrying out recombinant polymerase isothermal amplification by utilizing an RPA primer pair, wherein the RPA primer pair comprises an upstream primer and a downstream primer, the nucleotide sequences of the upstream primer and the downstream primer are shown as SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of a genetic marker specifically amplified is shown as SEQ ID No. 3;
(2) carrying out electrophoresis on the amplification product, and observing whether a band of 239bp appears; if the band of 239bp appears, the duck hepatitis B virus is judged to be positive, and if the band of 239bp does not appear, the duck hepatitis B virus is judged to be negative.
Further, in the step (1), the reaction system for isothermal amplification by the recombinant polymerase comprises: 1.2. mu.L of each of the RPA primers shown in SEQ ID NO.1 and SEQ ID NO.2, 29.5. mu.L of regeneration Buffer, 3. mu.L of template, ddH2O 12.6μL，MgAc 2.5μL。
Further, in the step (1), the conditions for isothermal amplification by the recombinant polymerase are as follows: the reaction was carried out at 40 ℃ for 25 min.
Further, in the step (2), the specific manner of performing electrophoresis is as follows: 5 μ L of the product of the isothermal amplification with recombinant polymerase was added to 2% agarose gel for electrophoresis.
The method for detecting the duck hepatitis B virus can be used for detecting the duck hepatitis B virus, and can also be used for epidemiological investigation, screening of drugs for treating the duck hepatitis B virus and the like.
The invention provides a genetic marker for detecting duck hepatitis B virus, and an RPA primer pair is designed according to the genetic marker, so that the specificity is very good. By utilizing the RPA primer pair, the isothermal amplification detection method suitable for rapidly and accurately detecting the duck hepatitis B virus is further optimized and established, the minimum detection template amount is 146pg, and the sensitivity is equivalent to that of the traditional PCR. The method is simple and rapid to operate, and is suitable for clinical production and rapid diagnosis in laboratories.
The various terms and phrases used herein have the ordinary meaning as is well known to those skilled in the art. To the extent that the terms and phrases are not inconsistent with known meanings, the meaning of the present invention will prevail.
Drawings
FIG. 1: specific test electrophoresis results (primer pair 1) of the duck hepatitis B virus heavy enzyme polymerase isothermal amplification detection method; wherein, M-standard DNA molecular weight is 2000; 1. duck hepatitis b virus; 2. duck hepatitis A virus type 1 (DHAV-1); 3. duck hepatitis A virus type 3 (DHAV-3); 4 Duck Plague Virus (DPV); 5. duck-origin escherichia coli (e.coli); 6. duck-derived Newcastle Disease Virus (NDV); 7. duck source avian influenza virus subtype H9 (AIV-H9); 8. riemerella Anatipestifer (RA).
FIG. 2: the duck hepatitis B virus heavy enzyme polymerase isothermal amplification detection method has a sensitivity test electrophoresis result; wherein, M: standard DNA molecular weight 2000; 1: 14.6 ng; 2: 1.46 ng; 3: 146 pg; 4: 14.6 pg; 5: 1.46 pg.
FIG. 3: specific test electrophoresis results (primer pair 2) of the duck hepatitis B virus heavy enzyme polymerase isothermal amplification detection method; wherein, M-standard DNA molecular weight is 2000; 1. duck hepatitis b virus; 2. duck hepatitis A virus type 1 (DHAV-1); 3. type 3 duck hepatitis A virus (DHAV-3).
FIG. 4: specific test electrophoresis results (primer pair 3) of the duck hepatitis B virus heavy enzyme polymerase isothermal amplification detection method; wherein, M-standard DNA molecular weight is 2000; 1. duck hepatitis b virus; 2. duck hepatitis A virus type 1 (DHAV-1); 3. type 3 duck hepatitis A virus (DHAV-3).
Detailed Description
The present invention will be further described with reference to the following examples. However, the scope of the present invention is not limited to the following examples. It will be understood by those skilled in the art that various changes and modifications may be made to the invention without departing from the spirit and scope of the invention.
The present invention has been described generally and/or specifically with respect to materials used in testing and testing methods. Although many materials and methods of operation are known in the art for the purpose of carrying out the invention, the invention is nevertheless described herein in as detail as possible.
As introduced in the background art, for the detection of duck hepatitis B virus, the traditional method has poor stability, low sensitivity, time and labor consumption, the whole process of the conventional PCR or fluorescent quantitative PCR method requires 2-4 hours to obtain results, and precise and expensive instruments and reagents are required,unfavorable conditions are relatively laggedSimple and convenient base layer developmentFast and quicklyThe molecular diagnosis of (1). Based on the method, the invention provides an isothermal amplification detection method of duck hepatitis B virus recombinant polymerase, so as to realize rapid and sensitive detection of duck hepatitis B virus at the basic level.
The key point of RPA amplification lies in the design of primers, but RPA is different from conventional PCR reaction, software or mature design principle for primer design is not available at present, and a large amount of data provides basis for the primer design, so that 3 pairs of primers are designed, and a pair of optimal primers is screened out through optimization.
In addition, when the RPA primer is designed, the selection of a target region is very critical, the length of the target region directly influences the specificity of duck hepatitis B virus detection, if the target region is too short, the specificity is insufficient, and the duck hepatitis B virus cannot be distinguished from other pathogens of ducks; if the target region is too long, although the specificity is good, it is difficult to design a primer capable of amplifying a long fragment, and errors are likely to occur in the amplification process of the long fragment. According to the invention, C, S gene sequences of 40 strains of duck hepatitis B viruses reported in NCBI are compared, a core antigen gene C and a surface antigen gene S are respectively selected as target gene design primers, multiple tests prove that the sequence shown in SEQ ID NO.3 is used as a target region, the specificity is good, the fragment length is moderate, the primer design is convenient, and the primer specificity designed by other target genes is poor (fig. 3 and fig. 4). Finally, a specific conserved target sequence of the duck hepatitis B virus is determined, the nucleotide sequence of the specific conserved target sequence is shown as SEQ ID NO.3, and the target sequence is a genetic marker for detecting the duck hepatitis B virus and specifically comprises the following steps:
5’-gccttagccaatgtgtatgatctaccagatgatttctttccaaaaatagatgatcttgttagagatgctaaa gacgctttagagccttattggaaatcagattcaataaagaaacatgttttgattgcaactcactttgtggatcttattga agacttttggcagactacacagggcatgcatgaaatagccgaatcattaagagctgttatacc tcccactactactcctg ttccacc-3’(SEQ ID NO.3)。
according to the preferred target region of the present invention, the present invention performs RPA primer design, and in a preferred embodiment of the present invention, the designed RPA primer pair is as follows:
an upstream primer F: 5'-GCCTTAGCCAATGTGTATGA-3' (SEQ ID NO. 1);
a downstream primer R: 5'-GGTGGAACAGGAGTAGTAGT-3' (SEQ ID NO. 2).
The RPA primer pair has good specificity, and the amplified fragment is positioned between 22 th and 260 th sites of duck hepatitis B virus C gene and has the size of 239 bp.
The RPA system constructed based on the RPA primer pair can realize the rapid and sensitive detection of the duck hepatitis B virus.
In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.
The test materials used in the examples of the present invention are all conventional in the art, wherein the DNA MarkerDL2000, TRIZOL and DEPC are all purchased from TaKaRa company (Dalian connection); the HiscripIOne Step RT-PCR Kit was purchased from Vazyme; twist Amp DNA Amplification Kits were purchased from twist DX. Others not specifically described are commercially available.
The experimental procedures of the examples of the present invention, in which the specific experimental conditions are not specified, are generally conducted under the conventional conditions or under the conditions recommended by the manufacturers of the apparatus or reagents.
Example 1: design and optimization of primers
1. Designing a primer:
in this example, a series of RPA primers were designed from a conserved region of the C, S gene of duck hepatitis b virus by comparing C, S gene sequences of 40 duck hepatitis b viruses reported in NCBI, which is shown in table 1.
Table 1: RPA primer designed aiming at conserved region of duck hepatitis B virus C, S gene
Screening the primers in the table 1 by using RPA amplification reaction, selecting a standard duck hepatitis B virus serum sample, extracting virus DNA as a template, and carrying out RPA detection, wherein the method comprises the following specific steps:
extracting a DNA template of a duck hepatitis B virus sample according to the EasyPure @ ViralDNA/RNA Kit instruction, and performing an RPA reaction system according to the twist Amp DNA Amplification Kit instruction: mu.L of upstream and downstream primers (20. mu. mol/. mu.L), 1.2. mu.L of reduction Buffer 29.5. mu.L, 3. mu.L of Template, ddH2O12.6. mu.L. Mixing with vortex, and centrifuging. Add 2.5. mu.L of 280mM MgAc and mix well. Placing into water bath, and acting at 40 deg.C for 25 min. After the reaction, the reaction was subjected to 2% agarose gel electrophoresis at 120V for 30min, and the results were observed.
2. Preferred results for the primers:
after RPA amplification was performed using the RPA primer set designed in Table 1, detection was performed by agarose gel electrophoresis, and it was found that the amplification effect of primer set 1(F1/R1) was the best, the band specificity was good, and there was no non-specific amplification. However, the other primer pairs had problems such as non-specific amplification and low amplification efficiency of the primers (FIGS. 3 and 4). Thus, primer pair 1(F1/R1) was selected for subsequent optimization of RPA reaction conditions, specificity and sensitivity testing.
Example 2: optimization of RPA reaction conditions
The optimization of the usage amounts of the primers F1 and R1 in the primer pair 1 respectively shows that the optimal effect is best when the concentrations of the primers F1 and R1 are both 20 mu mol/mu L and the usage amounts are both 1.2 mu L. In addition, 6 concentration gradients were set for the amount of MgAc used, and the amounts of MgAc added to the RPA system at a concentration of 280mM were 0.5. mu.L, 1. mu.L, 1.5. mu.L, 2. mu.L, 2.5. mu.L and 3. mu.L, respectively, and the results showed that too little MgAc used resulted in failure of amplification, and that 1.5. mu.L, 2. mu.L, 2.5. mu.L and 3. mu.L of MgAc added to the reaction system resulted in amplification products, and that the best amplification effect was achieved when the amount of MgAc used was 2.5. mu.L.
The optimized RPA reaction system is as follows: mu.L of upstream and downstream primers (20. mu. mol/. mu.L), 1.2. mu.L of RehydrationBuffer29.5. mu.L, 3. mu.L of Template, ddH2O 12.6μL，280mM MgAc 2.5μL。
In addition, the RPA reaction time and the reaction temperature are optimized, and the result shows that the RPA amplification efficiency is highest when the reaction temperature is 40 ℃ and the action is carried out for 25 min.
The optimized RPA reaction condition only needs one temperature in the whole gene amplification process, does not need special instruments and equipment, has simpler operation and is suitable for the field rapid detection of the duck hepatitis B virus in production.
Example 3: specificity test
The DNA/cDNA templates of duck hepatitis B virus, duck hepatitis A virus type 1 (DHAV-1), duck hepatitis A virus type 3 (DHAV-3), Duck Plague Virus (DPV), duck Escherichia coli (E.coli), duck Newcastle Disease Virus (NDV), duck H9 subtype avian influenza virus (AIV-H9) and Riemerella Anatipestifer (RA) are respectively used, and RPA is carried out according to the optimized reaction conditions of the embodiment 2 and detected by gel electrophoresis. The experimental results are shown in fig. 1, only duck hepatitis b virus is positive, and the others are negative, which indicates that the RPA detection system of the invention has good specificity.
Example 4: sensitivity test
Selecting a standard duck hepatitis B virus serum sample, extracting a DNA template of a sample to be detected according to EasyPure @ ViralDNA/RNA Kit specification, and carrying out 10-1～10-5The dilution was performed in a double gradient and the RPA detection was performed according to the optimized reaction conditions of example 2. The results were: the lowest detection template amount of the RPA method is 146pg (figure 2); the sensitivity of the PCR method is consistent with that of the conventional PCR method, but obviously, the detection method is simpler, simpler and faster, is particularly suitable for field detection, and has looser requirements on experimental conditions.
Example 5: clinical sample testing
1. Sample treatment:
collecting clinical duck serum samples, and extracting a DNA template of a sample to be detected according to EasyPure @ ViralDNA/RNA Kit instructions.
2. Recombinase polymerase amplification:
according to the operation instructions of the TwistAmp DNA Amplification Kits, an RPA reaction system: mu.L each of the upstream and downstream primers (20. mu. mol/. mu.L) (the sequences of the upstream and downstream primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively), 29.5. mu.L of regeneration Buffer, 3. mu.L of Template, ddH2O12.6. mu.L. Mixing with vortex, and centrifuging. Add 2.5. mu.L of 280mM MgAc and mix well. Placing into water bath, and acting at 40 deg.C for 25 min. After the reaction, the reaction was subjected to 2% agarose gel electrophoresis at 120V for 30min, and the results were observed.
3. And (5) judging a result:
if the 239bp band appears in the detection sample, the duck hepatitis B virus is judged to be positive, and if the 239bp band does not appear in the detection sample, the duck hepatitis B virus is judged to be negative.
75 clinical samples of different years in different places are collected, and the RPA method and the conventional RT-PCR method are used for detection and comparison, so that 19 common positive numbers and 56 common negative numbers are detected by the two methods, and the coincidence rate of the two methods is 100%. The test results are shown in Table 2.
TABLE 2 comparison of compliance rates for clinical sample testing by different methods
As can be seen from Table 2, the duck hepatitis B virus detected by the RPA method of the invention has high sensitivity and specificity, and the coincidence rate with the conventional RT-PCR method reaches 100%; the method does not need special instruments, has higher reaction speed and is more suitable for field rapid detection.
The above examples are provided to those of ordinary skill in the art to fully disclose and describe how to make and use the claimed embodiments, and are not intended to limit the scope of the disclosure herein. Modifications apparent to those skilled in the art are intended to be within the scope of the appended claims.
Sequence listing
<110> poultry institute of academy of agricultural sciences of Shandong province
<120> duck hepatitis B virus recombinant polymerase isothermal amplification detection method
<140>2019108948058
<141>2019-09-20
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213>Artificial Sequence
<400>1
gccttagcca atgtgtatga 20
<210>2
<211>20
<212>DNA
<213>Artificial Sequence
<400>2
ggtggaacag gagtagtagt 20
<210>3
<211>239
<212>DNA
<213>Hepatitis B virus
<400>3
gccttagcca atgtgtatga tctaccagat gatttctttc caaaaataga tgatcttgtt 60
agagatgcta aagacgcttt agagccttat tggaaatcag attcaataaa gaaacatgtt 120
ttgattgcaa ctcactttgt ggatcttatt gaagactttt ggcagactac acagggcatg 180
catgaaatag ccgaatcatt aagagctgtt atacctccca ctactactcc tgttccacc 239
Claims (10)
1. An RPA primer pair for detecting duck hepatitis B virus comprises an upstream primer and a downstream primer, wherein the nucleotide sequences of the upstream primer and the downstream primer are shown as SEQ ID NO.1 and SEQ ID NO. 2;
an upstream primer F: 5'-GCCTTAGCCAATGTGTATGA-3', respectively;
a downstream primer R: 5'-GGTGGAACAGGAGTAGTAGT-3' are provided.
2. The use of the RPA primer pair of claim 1 in the preparation of a kit for detecting duck hepatitis b virus.
3. The application of the genetic marker in the preparation of the kit for detecting the duck hepatitis B virus is disclosed, wherein the nucleotide sequence of the genetic marker is shown as SEQ ID NO. 3.
4. A kit for detecting duck hepatitis B virus, which comprises the RPA primer pair of claim 1 and reagents necessary for detection.
5. The kit for detecting duck hepatitis B virus according to claim 4, characterized in that: the reagents necessary for the detection include: rehydration Buffer, template, ddH2O and MgAc.
6. The use of the kit of claim 5 for detecting duck hepatitis B virus.
7. A duck hepatitis B virus recombinant polymerase isothermal amplification detection method comprises the following steps:
(1) extracting genome DNA of an object to be detected, and performing recombinant polymerase isothermal amplification by using an RPA primer pair, wherein the RPA primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequences of the RPA primer pair are shown as SEQ ID NO.1 and SEQ ID NO. 2;
(2) carrying out electrophoresis on the amplification product, and observing whether a band of 239bp appears; if the band of 239bp appears, the duck hepatitis B virus is judged to be positive, and if the band of 239bp does not appear, the duck hepatitis B virus is judged to be negative.
8. The isothermal amplification detection method for duck hepatitis B virus recombinant polymerase according to claim 7, characterized in that: in the step (1), the reaction system for the isothermal amplification of the recombinant polymerase comprises: 1.2. mu.L of each of the RPA primers shown in SEQ ID NO.1 and SEQ ID NO.2, 29.5. mu.L of regeneration Buffer, 3. mu.L of template, ddH2O 12.6μL，MgAc 2.5μL。
9. The isothermal amplification detection method for duck hepatitis B virus recombinant polymerase according to claim 7, characterized in that: in the step (1), the conditions for the isothermal amplification of the recombinant polymerase are as follows: the reaction was carried out at 40 ℃ for 25 min.
10. The isothermal amplification detection method for duck hepatitis B virus recombinant polymerase according to claim 7, characterized in that: in the step (2), the specific manner of performing electrophoresis is as follows: 5 μ L of the product of the isothermal amplification with recombinant polymerase was added to 2% agarose gel for electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910894805.8A CN111593138A (en) | 2019-09-20 | 2019-09-20 | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910894805.8A CN111593138A (en) | 2019-09-20 | 2019-09-20 | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111593138A true CN111593138A (en) | 2020-08-28 |
Family
ID=72181447
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910894805.8A Pending CN111593138A (en) | 2019-09-20 | 2019-09-20 | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111593138A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112359146A (en) * | 2020-11-30 | 2021-02-12 | 浙江大学 | Kit for rapidly detecting hepatitis B virus gene and detection method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000046365A1 (en) * | 1999-02-02 | 2000-08-10 | Biocache Pharmaceuticals, Inc. | Advanced antigen presentation platform |
| TW201018480A (en) * | 2008-11-12 | 2010-05-16 | Nat Univ Chiayi | Duck hepatitis vaccine and the manufacture method thereof |
| CN103114153A (en) * | 2013-02-05 | 2013-05-22 | 西安交通大学医学院第一附属医院 | Fluorescence quantitative PCR (polymerase chain reaction) detection method of duck hepatitis B virus, and reagent |
| CN108754021A (en) * | 2018-06-12 | 2018-11-06 | 南阳师范学院 | A kind of ring mediated isothermal amplification detection reagent of duck hepatitis B virus |
| CN109161604A (en) * | 2018-08-27 | 2019-01-08 | 山东省农业科学院家禽研究所（山东省无特定病原鸡研究中心） | A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method |
-
2019
- 2019-09-20 CN CN201910894805.8A patent/CN111593138A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000046365A1 (en) * | 1999-02-02 | 2000-08-10 | Biocache Pharmaceuticals, Inc. | Advanced antigen presentation platform |
| TW201018480A (en) * | 2008-11-12 | 2010-05-16 | Nat Univ Chiayi | Duck hepatitis vaccine and the manufacture method thereof |
| CN103114153A (en) * | 2013-02-05 | 2013-05-22 | 西安交通大学医学院第一附属医院 | Fluorescence quantitative PCR (polymerase chain reaction) detection method of duck hepatitis B virus, and reagent |
| CN108754021A (en) * | 2018-06-12 | 2018-11-06 | 南阳师范学院 | A kind of ring mediated isothermal amplification detection reagent of duck hepatitis B virus |
| CN109161604A (en) * | 2018-08-27 | 2019-01-08 | 山东省农业科学院家禽研究所（山东省无特定病原鸡研究中心） | A kind of rabbit Friedlander's bacillus recombination polymerase isothermal amplification detection method |
Non-Patent Citations (2)
| Title |
|---|
| 吴耀东等: "重组酶聚合酶扩增技术及其在动物病原快速检测中的应用", 《中国兽医学报》 * |
| 高骏等: "鸭乙型肝炎病毒诊断方法的建立及应用", 《上海农业学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112359146A (en) * | 2020-11-30 | 2021-02-12 | 浙江大学 | Kit for rapidly detecting hepatitis B virus gene and detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111394520B (en) | Primer group for detecting new coronavirus based on RT-LAMP technology and detection kit | |
| CN108676920B (en) | Primer and kit for rapidly detecting mouse norovirus and RT-RPA method thereof | |
| CN112048570A (en) | PCR primer for detecting duck adenovirus type 4 and detection method and application thereof | |
| CN116676429B (en) | LAMP primer group for detecting pangolin respiratory syncytial virus type B and application thereof | |
| CN113528708A (en) | Triple PCR detection method for simultaneously detecting three feline diarrhea viruses and application thereof | |
| CN110684866A (en) | Primer pair, kit and method for detecting chicken infectious anemia virus | |
| CN110241259B (en) | HRM detection method for rapidly distinguishing goose type 1 astrovirus from goose type 2 astrovirus and primers thereof | |
| CN106947834B (en) | Multiplex PCR method for detecting six duck susceptibility viruses | |
| CN111088402A (en) | Novel goose astrovirus detection primer group and kit | |
| CN113846185A (en) | Primer composition and kit for rapid detection of new coronavirus E484K/Q, K417N/T variation | |
| CN111593138A (en) | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method | |
| CN114214466B (en) | Novel goose astrovirus and duck tembusu virus multiplex fluorescence quantitative PCR detection primer probe set, kit and application | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN113046482B (en) | Pigeon adenovirus B-type loop-mediated isothermal amplification detection primer set and kit | |
| KR101236197B1 (en) | Differential detection of West nile virus and Japanese encephalitis virus | |
| CN115725788A (en) | Primer and TaqMan probe for detecting feline parvovirus and application thereof | |
| CN110592269A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type 2 virus (GCRV-2) | |
| CN111850099A (en) | RPA kit, primers, probe and method for detecting varicella virus | |
| CN110684862B (en) | Microdroplet digital PCR kit for quantitatively detecting hepatitis B virus and detection method | |
| CN112063757A (en) | Primer and kit for detecting African swine fever virus and application of primer and kit | |
| CN111004868A (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting goat intranasal tumor virus | |
| CN112176100A (en) | General method for detecting copy number of target gene and virus titer and application | |
| CN116287471B (en) | ARMS-PCR detection primer group and kit for identifying standard virulent P strain of Muscovy duck parvovirus and vaccine virulent P1 strain | |
| CN110592267A (en) | RAA constant-temperature fluorescence detection method and reagent for Spring Viremia of Carp Virus (SVCV) | |
| CN111187859B (en) | Dual TaqMan qPCR detection method for detecting influenza C and influenza D |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |