CN109161546A - A kind of aptamer and its application in the detection pathogenic vibrio alginolyticus in egg-shaped pompano source - Google Patents
A kind of aptamer and its application in the detection pathogenic vibrio alginolyticus in egg-shaped pompano source Download PDFInfo
- Publication number
- CN109161546A CN109161546A CN201811099367.8A CN201811099367A CN109161546A CN 109161546 A CN109161546 A CN 109161546A CN 201811099367 A CN201811099367 A CN 201811099367A CN 109161546 A CN109161546 A CN 109161546A
- Authority
- CN
- China
- Prior art keywords
- vibrio alginolyticus
- ssdna aptamer
- supernatant
- aptamer
- library
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Virology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of ssDNA aptamer and its application in the pathogenic vibrio alginolyticus in egg-shaped pompano source, the nucleotides sequence of the ssDNA aptamer is classified as 5 '-GACGCTTACTCAGGTGTGACTCGTCGGTCGGGTGGTTGGGGTGGGTGGTCGGTTTT TAAGCTGTGTCATTGTCCGAAGGACGCAGATGAAGTCTC-3 ' (SEQ ID NO:1).SsDNA aptamer of the invention has specificity and high sensitivity, and non-immunogenicity to the pathogenic vibrio alginolyticus in egg-shaped pompano source.The ssDNA aptamer stable structure, easily modification convenient for synthesis and save, and can carry out fast and accurately detection and diagnosis to the pathogenic vibrio alginolyticus in egg-shaped pompano source.
Description
Technical field
The present invention relates to a kind of ssDNA aptamer and its screening techniques, detection method and application, more particularly to one
Kind ssDNA aptamer and its application in the detection pathogenic vibrio alginolyticus in egg-shaped pompano source.
Background technique
China is as aquaculture big country, and the 70% of the world aquaculture Liang Zhan aquaculture total amount.However, in recent years
Bacterial pathogen breaks out and popular causes huge economic losses to the aquaculture industry in China.In the South China coastals such as Guangxi
Area, vibrio alginolyticus are one of the main pathogenic bacterias for causing marine fish that the bacterial diseases of fishes occur, caused fish disease morbidity
Rapidly, the death rate is high, popular wide, has against the development of South China's culture fishery and seriously threatens.At present in the world to fish
The diagnosis of class bacteriosis mainly uses conventional view method, immunological detection method, Protocols in Molecular Biology etc..But these sides
It method the problems such as there are cumbersome, time-consuming, instrument reagent is expensive, accuracy is not high, cannot be at the scene quickly to vibrio alginolyticus
Carry out accurate detection and diagnosis.Therefore should put forth effort the aquatile that development operation is convenient, at low cost, time-consuming is short, accuracy is high to cause
Germ Fast Detection Technique, this formulates therapeutic scheme with a definite target in view for finding early, determining cause of disease to control cause of disease
Diffusion, reduction loss are most important.
Aglucon phyletic evolution technology (the Systematic Evolution ofLigands by of index concentration
Exponential Enrichment technology, SELEX) it is a kind of biological libraries screening technique, which uses capacity
Up to 1014-1015Random oligonucleotide library, by multi-turns screen, finally obtain being capable of specific recognition target substance in vitro
Single-stranded oligonucleotide, i.e. aptamer.There is aptamer easily screening to obtain, is at low cost, easy modification, stability are strong,
Many advantages, such as high specific identifies and combines target substance has evolved into a kind of novel detection and treatment being widely noticed at present
Tool also shows that wide application prospect in the biomedical basic research of major disease, medical diagnosis on disease field.
Summary of the invention
The invention reside in provide a kind of high specific, high sensitivity, non-immunogenicity and stablize easily modification, convenient for synthesis
With preservation for detecting the ssDNA aptamer of the pathogenic vibrio alginolyticus in egg-shaped pompano source, at least to solve existing life
The problem of object detection technique quickly cannot carry out accurate detection and diagnosis to the pathogenic vibrio alginolyticus in egg-shaped pompano source at the scene.
Be to mesh of the invention to provide it is a kind of can specific recognition vibrio alginolyticus ssDNA aptamer, it is described
The nucleotides sequence of ssDNA aptamer is classified as 5 '-GACGCTTACTCAGGTGTGACTCGTCGGTCGGGTGGTTGGGGTGG
GTGGTCGGTTTTTAAGCTGTGTCATTGTCCGAAGGACGCAGATGAAGTCTC-3’(SEQ ID NO:1)。
Further, the nucleotides sequence of the ssDNA aptamer is classified as SEQ ID NO:1.
Further, any position can be carried out phosphorylation, sulfydryl on the nucleotide sequence of the ssDNA aptamer
Change, methylate, amination or isotopologue are reacted.
Further, marker is combined on the nucleotide sequence of the ssDNA aptamer.
Further, the marker is selected from one of biotin, enzyme, luminophore or a variety of.
Further, the luminophore is selected from fluorescein isothiocynate, carboxyl tetramethylrhodamine, hydroxyl fluorescein
One of or it is a variety of.
Another mesh of the invention it is to provide a kind of screening technique of above-mentioned ssDNA aptamer, including following step
It is rapid:
Step 1: synthesize single-stranded DNA banks shown in following sequence and primer:
Random library Library50:
5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC；
5 ' primers: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3 '；
3 ' primers: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3 '；
Step 2: take the above-mentioned random library of 10nmol to be dissolved in 500 μ l PBS, the water bath with thermostatic control 5min at 92 DEG C, then
Carry out ice bath rapidly, ice bath 10min, the random library that takes that treated and vibrio alginolyticus viable bacteria are incubated for 1h on ice；Wait be incubated for knot
After the completion of conjunction, it is centrifuged and is removed supernatant, the PBS of 10mL is taken to wash vibrio alginolyticus viable bacteria, and the water bath with thermostatic control 10min at 92 DEG C,
It is centrifuged 1-20min under conditions of 12000g, and collects supernatant, the supernatant is specific recognition vibrio alginolyticus
SsDNA aptamer library；
Step 3: the ssDNA aptamer library for the identification vibrio alginolyticus for taking 100ul to screen carries out PCR amplification, tool
The amplification program of body are as follows: 94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min are recycled, 72 DEG C of 5min by 20 wheels；
Step 4: the magnetic bead for taking 100 μ l streptavidins to mark is incubated at normal temperature with resulting double-stranded DNA is expanded in step 3
20min is educated, draw magnetic bead using magnetic separator and removes supernatant, after washing magnetic bead with 2mLPBS, the 200mM of 200 μ l is added
NaOH solution, normal-temperature reaction 10min, and magnetic bead is recycled using magnetic separation rack, leave and take supernatant；
Step 5: except salt plug carries out salinity separation after taking step 4 gained supernatant that sterile water washing is added, in gravity
It is lower to drip off naturally, 500 μ l PBS are added into the liquid being collected into, obtain the solution containing the single-stranded library DNA；
Step 6: taking the single-stranded library DNA obtained in step 5 to replace the random library in step 2, and step 2-5 is repeated
8 times；
Step 7: taking the DNA library of step 6 to heat 5min in 92 DEG C of waters bath with thermostatic control, then carry out ice bath, ice bath rapidly
10min, the solution in the single-stranded library DNA that takes that treated and Aeromonas hydrophila are incubated for 1h on ice；After the completion of hatching combination,
It is centrifuged and is collected supernatant, supernatant solution and vibrio alginolyticus viable bacteria are incubated for 0.5-2h on ice；After the completion of hatching combination, from
The heart removes supernatant, takes the PBS of 10mL to wash vibrio alginolyticus viable bacteria, and the water bath with thermostatic control 10min at 92 DEG C, in the condition of 12000g
Lower centrifugation 1-20min, and supernatant is collected, the supernatant is the high specific identification vibrio alginolyticus by negative screening
SsDNA aptamer library；
Step 8: gained supernatant solution in step 7 is taken, successively according to step 3, step 4, step 5, step 7, step 2, step
Rapid 3, the experimental implementation of step 4 and step 5 sequence is repeated 8 times, and final acquired solution is ssDNA aptamer.
Another mesh of the invention it is to provide a kind of egg-shaped pompano source using above-mentioned ssDNA aptamer pathogenic
The rapid detection method (AFMP) of vibrio alginolyticus, comprising the following steps:
Step 1: biotin labeling is carried out to ssDNA aptamer；
Step 2: taking sample to be tested 1-100mg and step 1 gained concentration mixed for the ssDNA aptamer of 100-200nM
It closes, and supernatant is removed in hatching combination 40min on ice, 1000g centrifugation；After hatching combination, sample to be tested is cleaned, is mixed in 200 μ
It in l PBS solution, is detected using flow cytometer, detects in sample to be tested whether have oval silvery pomfret according to the variation of fluorescent value
The pathogenic vibrio alginolyticus in the source Scad.
The present invention is to provide a kind of above-mentioned ssDNA aptamer of application there are also a mesh and causes in detection egg-shaped pompano source
Purposes in characteristic of disease vibrio alginolyticus.
The aptamer that the present invention is obtained by SELEX technology screening has higher compared with existing protein antibodies
Affinity and specificity, but also have the characteristics that not available for protein antibodies, including non-immunogenicity；Short preparation period,
Favorable reproducibility；Molecular weight is small, synthesizes convenient for iii vitro chemical；Convenient for label；It is easy to repair the different parts of aptamer
Decorations and substitution；Sequence is stable and easy to transport and save etc..It is caused a disease using the egg-shaped pompano source of the invention based on aptamer
Property vibrio alginolyticus rapid detection method when being detected to vibrio alginolyticus, it is easy to operate rapidly, can be used for developing relevant fast
Fast detection kit.This is of great significance for the quick detection of vibrio alginolyticus, in the detection of aquatic pathogenic bacteria vibrio alginolyticus
There is good application prospect in field.
Detailed description of the invention
Fig. 1 be the embodiment of the present invention 1, in reference examples 1 ssDNA aptamer flow cytomery fluorescence intensity pair
Than figure；
Fig. 2 be the embodiment of the present invention 1, in reference examples 2 ssDNA aptamer respectively with Vibrio harveyi, Vibrio vulnificus,
Comma bacillus, Aeromonas hydrophila, Aeromonas veronii and vibrio alginolyticus combination situation comparison diagram；
Fig. 3 is the embodiment of the present invention 2, middle ssDNA aptamer difference four plants of different vibrio alginolyticus of specific recognition
The testing result figure of (TOQZ01, TOQZ02, TOQZ03, TOQZ04) and Vibrio harveyi；
Fig. 4 is the secondary structure prediction figure of 3SEQ of embodiment of the present invention ID NO:1 aptamer.
Specific embodiment
It in order to enable those skilled in the art to better understand the solution of the present invention, below will be to the skill in the embodiment of the present invention
Art scheme is clearly and completely described, it is clear that and the described embodiment is only a part of the embodiment of the present invention, without
It is whole embodiments.
Embodiment 1
1 ssDNA aptamer of embodiment the preparation method is as follows:
Step 1: synthesizing random single-stranded DNA banks shown in following sequence and primer
Random library Library50:
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC
5 ' primers: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3 '；
3 ' primers: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3 '；
Step 2: the above-mentioned random library of 10nmol being dissolved in 500 μ l PBS, 92 DEG C of water bath with thermostatic control 5min, then rapidly
It is inserted into ice, ice bath 10min, treated random library and vibrio alginolyticus viable bacteria is incubated for 1h on ice；Hatching combination is completed
Afterwards, centrifugation removes supernatant, washs vibrio alginolyticus viable bacteria with the PBS of 10mL, and 92 DEG C of water bath with thermostatic control 10min, 12000g are collected by centrifugation
Supernatant, as the aptamer library of specific recognition vibrio alginolyticus；
Step 3: the aptamer library for the identification vibrio alginolyticus for taking 100ul to screen carries out PCR amplification, specific to expand
Increasing a program is: 94 DEG C of 5min, 94 DEG C of 1min, and 56 DEG C of 30sec, 72 DEG C of 1min are recycled, 72 DEG C of 5min by 20 wheels.The first round
The supernatant obtained after screening will be completely used for carrying out PCR amplification, obtain amplified production；
Step 4: by the resulting double-stranded DNA of PCR amplification in the magnetic bead of 100 μ l streptavidins label and step 3 in room temperature
Double-stranded DNA is integrated to by lower incubation 20min using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA
Magnetic bead surfaces wash magnetic bead with 2mL PBS, 200ulNaOH then are added in EP pipe using supernatant is removed on magnetic separator
Solution (200mM), normal-temperature reaction 10min recycle to obtain supernatant using magnetic separation rack；Except the salt plug sterile water washing of 10mL
Afterwards, supernatant is added and removes salt plug, dripped off naturally by gravity.500 μ l PBS are added, are collected into containing the single-stranded library DNA
Solution；
Step 5: the single-stranded library DNA obtained in step 4 being replaced into the random library in step (2), repeats step 2-4 institute
The producing process of positive-selecting process, PCR amplification and the single-stranded DNA banks shown 8 times；
Step 6: in being screened after the second wheel and the second wheel, being control with Aeromonas hydrophila, will be screened after step 5
To the single-stranded library DNA carry out negative screening to improve screening efficiency.Specific feminine gender screening process are as follows: obtain screening
After DNA library dissolution, 92 DEG C of waters bath with thermostatic control, ice baths, it is incubated for 1h on ice with Aeromonas hydrophila viable bacteria, is centrifuged after the completion of being incubated for
Collect supernatant solution；Then in conjunction with this supernatant solution being carried out ice bath with vibrio alginolyticus viable bacteria；After the completion of hatching combination, centrifugation is moved
Except supernatant, vibrio alginolyticus viable bacteria is washed with the PBS of 10mL, supernatant is collected by centrifugation in 92 DEG C of waters bath with thermostatic control 10min, 12000g, collects
The supernatant arrived is the aptamer library of the high specific identification vibrio alginolyticus by negative screening；
Step 7: the supernatant solution that will be collected into step 6, the single stranded DNA text of PCR amplification and step 4 by step 3
It after the preparation of library, is repeated in and carries out step 6, step 2, the process of step 3 and step 4, utilize text obtained by flow cytomery
Library is to the enhancing situation of vibrio alginolyticus recognition capability, and after 8 wheel screenings, library reaches most strong to vibrio alginolyticus recognition capability.
By gained amplified production after cloning and sequencing is analyzed, the ssDNA core that can be used for detecting vibrio alginolyticus in the present embodiment is finally obtained
Sour aptamers, sequence 5 '-
GACGCTTACTCAGGTGTGACTCGTCGGTCGGGTGGTTGGGGTGGGTGGTCGGTTTTTAAGCTGTGTCA
TTGTCCGAAGGACGCAGATGAAGTCTC-3’(SEQ ID NO:1)。
The AFMP detection method of 1 ssDNA aptamer of embodiment is as follows:
Step 1: biotin labeling is carried out to embodiment 1ssDNA aptamer；
Step 2: by the 1st wheel of 200nM hydroxyl fluorescein (FAM) label, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th
Wheel, the 9th wheel screening library are dissolved in 500 μ l PBS, then with vibrio alginolyticus viable bacteria hatching combination 40min on ice, 1000g from
The heart removes supernatant, three times with 10mLPBS centrifuge washing, finally mixes in 200 μ l PBS vibrio alginolyticus, is used for flow cytometer
Detect 50000 cells.The pathogenic vibrio alginolyticus in egg-shaped pompano source is detected according to the variation of fluorescent value.As shown in Figure 1,1st,
3rd, 5th, 6th, 7th, 8th, 9th are respectively flow cytomery hydroxyl fluorescein (FAM) marks in embodiment 1 the 1st
Wheel, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th wheel, the 9th wheel screening library and the pathogenic vibrio alginolyticus in egg-shaped pompano source knot
Close situation.
Reference examples 1
1 ssDNA aptamer of reference examples the preparation method is as follows:
Synthesize random single-stranded DNA banks shown in following sequence and primer
Random library Library50:
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC
5 ' primers: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3 '；
3 ' primers: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3 '；
Above-mentioned random single-stranded DNA banks are reference examples ssDNA aptamer.
The AFMP detection method of 1 ssDNA aptamer of reference examples is as follows:
Step 1: biotin labeling is carried out to reference examples 1ssDNA aptamer；
Step 2: the random single-stranded DNA banks that 200nM hydroxyl fluorescein (FAM) marks being dissolved in 500 μ l PBS, then
Supernatant is removed in hatching combination 40min, 1000g centrifugation on ice with vibrio alginolyticus viable bacteria, three times with 10mLPBS centrifuge washing, finally
Vibrio alginolyticus is mixed in 200 μ l PBS, 50000 cells of flow cytomery are used for.It is examined according to the variation of fluorescent value
Survey the pathogenic vibrio alginolyticus in egg-shaped pompano source.As shown in Figure 1, Library is flow cytomery hydroxyl fluorescence in reference examples
1st wheel, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th wheel, the 9th wheel screening library and egg-shaped pompano source of plain (FAM) label cause
The combination situation of characteristic of disease vibrio alginolyticus.
By the screening of 9 wheels, it was demonstrated that the 8th wheel screening library reaches highest to the specific recognition capability of vibrio alginolyticus.
Reference examples 2
The AFMP detection method of 1 ssDNA aptamer of reference examples is as follows:
Step 1: biotin labeling is carried out to embodiment 1ssDNA aptamer；
Step 2: the random single-stranded DNA banks that 200nM hydroxyl fluorescein (FAM) marks being dissolved in 500 μ l PBS, then
Respectively with Vibrio harveyi, Vibrio vulnificus, comma bacillus, Aeromonas hydrophila, Aeromonas veronii hatching combination on ice
Supernatant is removed in 40min, 1000g centrifugation, three times with 10mLPBS centrifuge washing, finally mixes vibrio alginolyticus in 200 μ l PBS,
For 50000 cells of flow cytomery.Binding ability is detected according to the variation of fluorescent value.It is glimmering to be illustrated in figure 2 hydroxyl
The SEQ ID NO:1 aptamer of light element (FAM) label distinguishes Vibrio harveyi, Vibrio vulnificus, comma bacillus, thermophilic aqueous vapor list
Born of the same parents bacterium, Aeromonas veronii combination situation.
Compared with other bacteriums of control group, shown in the above-mentioned SEQ ID NO:1 of hydroxyl fluorescein (FAM) label
SsDNA aptamer has high specific recognition capability to vibrio alginolyticus.
Embodiment 2
By egg-shaped pompano source pathogenic molten algae arc of the building based on SEQ ID NO:1 aptamer the step of embodiment 1
The rapid detection method (AFMP) of bacterium simultaneously detects 4 plants of different vibrio alginolyticus.
As shown in figure 3, above-mentioned rapid detection method (AFMP) being capable of four plants of different vibrio alginolyticus of specific recognition
(TOQZ01, TOQZ02, TOQZ03, TOQZ04), and there is no significantly identifying to the Vibrio harveyi of control group.
Embodiment 3
Utilize the secondary structure of MFOLD software on-line prediction aptamer.
The secondary structure prediction result of SEQ ID NO:1 aptamer as shown in figure 4, aptamer formed it is special
Loop-stem structure and hairpin structure.
Embodiment 4
1 gained ssDNA aptamer of embodiment is taken, the assembling of AFMP kit is carried out, is formed a kind of for diagnosing fish
The AFMP detection kit whether class is infected by vibrio alginolyticus.
Based on Fig. 1 and 2,3 as a result, can prove ssDNA aptamer shown in the embodiment of the present invention 1 by biology
It, still can be with vibrio alginolyticus after the fluorescent materials such as element, enzyme, fluorescein isothiocynate, hydroxyl fluorescein or luminescent material label modification
It is specifically bound, can be used in the detection of the pathogenic vibrio alginolyticus in egg-shaped pompano source.
The ssDNA aptamer that the embodiment of the present invention 1 is obtained by SELEX technology screening have preferable affinity and
Specificity, and the ssDNA aptamer stable structure of the embodiment of the present invention still have after carrying out group label and modification
Preferable affinity and specificity, can be applied in AFMP detection kit, and the ssDNA nucleic acid adaptation of the embodiment of the present invention 1
Body has the characteristics that short preparation period, favorable reproducibility, molecular weight are small compared to protein antibodies, convenient for external synthesis, in oval silvery pomfret
The detection field of the pathogenic vibrio alginolyticus in the source Scad has good application prospect.
Finally it should be noted that the above embodiments are merely illustrative of the technical scheme of the present invention and are not intended to be limiting thereof, to the greatest extent
Invention is explained in detail referring to above-described embodiment for pipe, it should be understood by a person of ordinary skill in the art that technology
Personnel read present specification after still can with modifications or equivalent substitutions are made to specific embodiments of the invention, but this
A little modifications are changed within all without departing from the present patent application accompanying claims protection scope.
SEQUENCE LISTING
<110>Guangxi Academy Of Sciences
<120>a kind of aptamer and its application in the pathogenic vibrio alginolyticus in egg-shaped pompano source
<130> 2018
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 95
<212> DNA
<213>artificial synthesized
<400> 1
gacgcttact caggtgtgac tcgtcggtcg ggtggttggg gtgggtggtc ggtttttaag 60
ctgtgtcatt gtccgaagga cgcagatgaa gtctc 95
Claims (8)
1. a kind of ssDNA aptamer, which is characterized in that the nucleotides sequence of the ssDNA aptamer is classified as 5 '-GAC
GCTTACTCAGGTGTGACTCGTCGGTCGGGTGGTTGGGGTGGGTGGTCGGTTTTTAAGCTGTGTCATTGTCCGAAGG
ACGCAGATGAAGTCTC-3’(SEQ ID NO:1)。
2. ssDNA aptamer according to claim 1, which is characterized in that the nucleosides of the ssDNA aptamer
Any position can be carried out phosphorylation, sulfhydrylation, methylation, amination or isotopologue reaction on acid sequence.
3. ssDNA aptamer according to claim 1, which is characterized in that the nucleosides of the ssDNA aptamer
Marker is combined on acid sequence.
4. ssDNA aptamer according to claim 2, which is characterized in that the marker be selected from biotin, enzyme,
One of luminophore is a variety of.
5. ssDNA aptamer according to claim 3, which is characterized in that the luminophore is selected from isothiocyanic acid
One of fluorescein, carboxyl tetramethylrhodamine, hydroxyl fluorescein are a variety of.
6. a kind of screening technique of ssDNA aptamer as described in claim 1, which comprises the following steps:
Step 1: synthesize single-stranded DNA banks shown in following sequence and primer:
Random library Library50:
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC
5 ' primers: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3 '；
3 ' primers: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3 '；
Step 2: take the above-mentioned random library of 10nmol to be dissolved in 500 μ l PBS, the water bath with thermostatic control 5min at 92 DEG C, then rapidly
Carry out ice bath, ice bath 10min, the random library that takes that treated and vibrio alginolyticus viable bacteria are incubated for 1h on ice；It is complete to hatching combination
Cheng Hou is centrifuged and removes supernatant, and the PBS of 10mL is taken to wash vibrio alginolyticus viable bacteria, and the water bath with thermostatic control 10min at 92 DEG C,
It is centrifuged 1-20min under conditions of 12000g, and collects supernatant, the supernatant is specific recognition vibrio alginolyticus
SsDNA aptamer library；
Step 3: the ssDNA aptamer library for the identification vibrio alginolyticus for taking 100ul to screen carries out PCR amplification, specifically
Expand a program are as follows: 94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min are recycled, 72 DEG C of 5min by 20 wheels；
Step 4: the magnetic bead for taking 100 μ l streptavidins to mark is incubated at normal temperature with resulting double-stranded DNA is expanded in step 3
20min draws magnetic bead using magnetic separator and removes supernatant, and after washing magnetic bead with 2mL PBS, the 200mM of 200 μ l is added
NaOH solution, normal-temperature reaction 10min, and magnetic bead is recycled using magnetic separation rack, leave and take supernatant；
Step 5: except salt plug carries out salinity separation after taking step 4 gained supernatant that sterile water washing is added, under the effect of gravity certainly
It so drips off, 500 μ lPBS is added into the liquid being collected into, obtain the solution containing the single-stranded library DNA；
Step 6: taking the single-stranded library DNA obtained in step 5 to replace the random library in step 2, and step 2-5 is repeated 8 times；
Step 7: taking the DNA library of step 6 to heat 5min in 92 DEG C of waters bath with thermostatic control, then carry out ice bath, ice bath rapidly
10min, the solution in the single-stranded library DNA that takes that treated and Aeromonas hydrophila are incubated for 1h on ice；After the completion of hatching combination,
It is centrifuged and is collected supernatant, supernatant solution and vibrio alginolyticus viable bacteria are incubated for 0.5-2h on ice；After the completion of hatching combination, from
The heart removes supernatant, takes the PBS of 10mL to wash vibrio alginolyticus viable bacteria, and the water bath with thermostatic control 10min at 92 DEG C, in the condition of 12000g
Lower centrifugation 1-20min, and supernatant is collected, the supernatant is the high specific identification vibrio alginolyticus by negative screening
SsDNA aptamer library；
Step 8: take in step 7 gained supernatant solution, successively according to step 3, step 4, step 5, step 7, step 2, step 3,
The experimental implementation of step 4 and step 5 sequence is repeated 8 times, and final acquired solution is ssDNA aptamer.
7. a kind of pathogenic vibrio alginolyticus in egg-shaped pompano source for applying ssDNA aptamer as described in claim 1 is quick
Detection method, which comprises the following steps:
Step 1: biotin labeling is carried out to ssDNA aptamer；
Step 2: take sample to be tested 1-100mg to mix with the ssDNA aptamer that step 1 gained concentration is 100-200nM, and
Supernatant is removed in hatching combination 40min on ice, 1000g centrifugation；After hatching combination, sample to be tested is cleaned, is mixed in 200 μ l PBS
It in solution, is detected using flow cytometer, detects in sample to be tested whether have egg-shaped pompano source according to the variation of fluorescent value
Pathogenic vibrio alginolyticus.
8. purposes of the ssDNA aptamer as described in claim 1 in the detection pathogenic vibrio alginolyticus in egg-shaped pompano source.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811099367.8A CN109161546B (en) | 2018-09-20 | 2018-09-20 | Aptamer and application thereof in detection of trachinotus ovatus source pathogenic vibrio alginolyticus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811099367.8A CN109161546B (en) | 2018-09-20 | 2018-09-20 | Aptamer and application thereof in detection of trachinotus ovatus source pathogenic vibrio alginolyticus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109161546A true CN109161546A (en) | 2019-01-08 |
| CN109161546B CN109161546B (en) | 2021-11-09 |
Family
ID=64879918
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811099367.8A Active CN109161546B (en) | 2018-09-20 | 2018-09-20 | Aptamer and application thereof in detection of trachinotus ovatus source pathogenic vibrio alginolyticus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161546B (en) |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1338005A (en) * | 1998-10-09 | 2002-02-27 | 希龙公司 | Neisseria genomic sequences and methods of their use |
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| CN102329862B (en) * | 2011-09-02 | 2013-06-05 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
| WO2014059428A2 (en) * | 2012-10-12 | 2014-04-17 | The Schepens Eye Research Institute, Inc. | Compositions and methods for the diagnosis of retinal neovascularization |
| CN104789696A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| CN105785023A (en) * | 2016-04-22 | 2016-07-20 | 中国科学院南海海洋研究所 | Aptamer-based Sandwich ELASA method for detecting nervous necrosis virus infection of groupers |
| CN106916821A (en) * | 2017-04-11 | 2017-07-04 | 中国科学院南海海洋研究所 | A kind of ssDNA aptamers and its application |
| CN107619850A (en) * | 2017-09-08 | 2018-01-23 | 集美大学 | A kind of method of the quantitative detection vibrio alginolyticus based on aptamer |
| CN108034659A (en) * | 2017-12-01 | 2018-05-15 | 广西科学院 | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application |
| CN109161548A (en) * | 2018-09-26 | 2019-01-08 | 广西科学院 | Aptamer and its application in detection egg-shaped pompano source nervous necrosis virus |
-
2018
- 2018-09-20 CN CN201811099367.8A patent/CN109161546B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1338005A (en) * | 1998-10-09 | 2002-02-27 | 希龙公司 | Neisseria genomic sequences and methods of their use |
| CN102329862B (en) * | 2011-09-02 | 2013-06-05 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| WO2014059428A2 (en) * | 2012-10-12 | 2014-04-17 | The Schepens Eye Research Institute, Inc. | Compositions and methods for the diagnosis of retinal neovascularization |
| CN104789696A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| CN105785023A (en) * | 2016-04-22 | 2016-07-20 | 中国科学院南海海洋研究所 | Aptamer-based Sandwich ELASA method for detecting nervous necrosis virus infection of groupers |
| CN106916821A (en) * | 2017-04-11 | 2017-07-04 | 中国科学院南海海洋研究所 | A kind of ssDNA aptamers and its application |
| CN107619850A (en) * | 2017-09-08 | 2018-01-23 | 集美大学 | A kind of method of the quantitative detection vibrio alginolyticus based on aptamer |
| CN108034659A (en) * | 2017-12-01 | 2018-05-15 | 广西科学院 | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application |
| CN109161548A (en) * | 2018-09-26 | 2019-01-08 | 广西科学院 | Aptamer and its application in detection egg-shaped pompano source nervous necrosis virus |
Non-Patent Citations (6)
| Title |
|---|
| MINGLI YANG等: "Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery", 《JOURNAL OF HEMATOLOGY & ONCOLOGY》 * |
| PENGFEI LI等: "Isolation and characterization of a new class of DNA aptamers specific specificbinding to Singapore grouper iridovirus (SGIV) with antiviral activities", 《VIRUS RESEARCH》 * |
| PENGFEI LI等: "Selection and characterization of novel DNA aptamers specifically recognized by Singapore grouper iridovirus-infected fish cells", 《JOURNAL OF GENERAL VIROLOGY》 * |
| QING YU等: "Development of novel aptamer-based enzyme-linked apta-sorbent assay (ELASA) for rapid detection of mariculture pathogen Vibrio alginolyticus", 《JOURNAL OF FISH DISEASES》 * |
| QING YU等: "Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus", 《JOURNAL OF FISH DISEASES》 * |
| 张庆庆: "基于核酸适配体的两种水产病原弧菌检测技术的研究", 《中国优秀硕士学位论文全文数据库》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109161546B (en) | 2021-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109161547A (en) | A kind of aptamer and its application in the pathogenic vibrio alginolyticus of detection | |
| CN111073892B (en) | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof | |
| CN108034659A (en) | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application | |
| CN111073891B (en) | Aptamer for detecting grouper iridovirus as well as construction method and application thereof | |
| CN110643611B (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN104789569A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104789696A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104789568A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN107858358A (en) | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application | |
| CN113215167A (en) | Aptamer and application thereof in detection of cells infected by iridovirus of micropterus salmoides | |
| CN107858359B (en) | Nucleic acid aptamer capable of specifically recognizing vibrio alginolyticus and application thereof | |
| CN109136229B (en) | Aptamer for specifically recognizing trachinotus ovatus-derived nervous necrosis virus and application thereof | |
| CN109207480B (en) | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof | |
| CN107937404A (en) | A kind of aptamer and its application in identification, detection vibrio alginolyticus | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN109161548B (en) | Aptamer and application thereof in detection of trachinotus ovatus-derived nervous necrosis virus | |
| CN111454956B (en) | Nucleic acid aptamer for Chinese soft-shelled turtle iridovirus as well as construction method and application thereof | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof | |
| CN104789570B (en) | A kind of DNA aptamers for being used to detect grouper irido virus infection and its screening technique and application | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN109161546A (en) | A kind of aptamer and its application in the detection pathogenic vibrio alginolyticus in egg-shaped pompano source | |
| CN113462693A (en) | Application of ssDNA aptamer in identification of iridovirus infected cells of micropterus salmoides | |
| CN108004240A (en) | SsDNA aptamer and its application of one species specificity for vibrio alginolyticus | |
| CN110257387B (en) | Aptamer for identifying grass carp hemorrhagic disease virus as well as construction method and application thereof | |
| CN110257385B (en) | Aptamer for resisting grass carp reovirus I, and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |