CN107937404A - A kind of aptamer and its application in identification, detection vibrio alginolyticus - Google Patents
A kind of aptamer and its application in identification, detection vibrio alginolyticus Download PDFInfo
- Publication number
- CN107937404A CN107937404A CN201711246574.7A CN201711246574A CN107937404A CN 107937404 A CN107937404 A CN 107937404A CN 201711246574 A CN201711246574 A CN 201711246574A CN 107937404 A CN107937404 A CN 107937404A
- Authority
- CN
- China
- Prior art keywords
- ssdna aptamers
- vibrio alginolyticus
- supernatant
- ssdna
- aptamers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/30—Production chemically synthesised
- C12N2330/31—Libraries, arrays
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/28—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Vibrionaceae (F)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Wood Science & Technology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of application the invention discloses ssDNA aptamers and its in identification, detection vibrio alginolyticus, the nucleotides sequence of the ssDNA aptamers are classified as 5 ' TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC, 3 ' (SEQ ID NO：Or 5 ' GACGCTTACTCAGGTGTGACTCG TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC CGAAGGACGCAGATGAAGTCTC, 3 ' (SEQ ID NO 1)：2).The ssDNA aptamers of the present invention have vibrio alginolyticus specificity and high sensitivity, and non-immunogenicity.The ssDNA aptamers stable structure, easily modification, easy to synthesize and preserve, can carry out fast and accurately detect and diagnose to vibrio alginolyticus.
Description
Technical field
The present invention relates to a kind of ssDNA aptamers and its screening technique, detection method and application, more particularly to one
Kind ssDNA aptamers and its application in identification, detection vibrio alginolyticus.
Background technology
China is as aquaculture big country, and the 70% of aquaculture Liang Zhan worlds aquaculture total amount.However, in recent years
Bacterial pathogen break out and the popular aquaculture industry to China causes huge economic losses.In the South China coastals such as Guangxi
Area, vibrio alginolyticus are to cause marine fish that one of Main Pathogenic Bacteria of the bacterial diseases of fishes occurs, its caused fish disease morbidity
Rapidly, the death rate is high, popular wide, has serious threat against the development of South China's culture fishery.At present in the world to fish
The diagnosis of class bacteriosis is mainly using conventional view method, immunological detection method, Protocols in Molecular Biology etc..But these sides
There are the problems such as cumbersome, time-consuming, instrument reagent is expensive, accuracy is not high for method, it is impossible at the scene quickly to vibrio alginolyticus
Carry out accurate detect and diagnose.
Aglucon phyletic evolution technology (the Systematic Evolution of Ligands by of index concentration
Exponential Enrichment technology, SELEX) it is a kind of biological libraries screening technique, which uses capacity
Up to 1014-1015Random oligonucleotide library, finally being obtained by multi-turns screen in vitro being capable of specific recognition target substance
Single stranded oligonucleotide, i.e. aptamer.Aptamer have easily screening obtains, cost is low, easy modification, stability are strong,
Many advantages, such as high specific identifies and combines target substance, has evolved into a kind of wide concerned new detection and treatment at present
Instrument, it also shows that wide application prospect in the biomedical basic research of major disease, medical diagnosis on disease field.
The content of the invention
The invention reside in provide a kind of high specific, high sensitivity, non-immunogenicity and stablize easily modification, easy to synthesizing
With the ssDNA aptamers for being used to detect aquatic pathogenic bacteria vibrio alginolyticus of preservation, examined with least solving existing biology
The problem of survey technology quickly cannot carry out accurate detect and diagnose to vibrio alginolyticus at the scene.
Be to provide the mesh of the present invention it is a kind of can specific recognition vibrio alginolyticus ssDNA aptamers, it is described
The nucleotides sequence of ssDNA aptamers is classified as 5 '-
TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC-3’(SEQ ID NO：1).
Further, the nucleotides sequence of the ssDNA aptamers is classified as 5 '-GACGCTTACTCAGGTGTGACTCG-
TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC-CGAAGGACGCAGATGAAGTCTC-3’
(SEQ ID NO：2).
Further, any position can carry out phosphorylation, sulfydryl on the nucleotide sequence of the ssDNA aptamers
Change, methylate, the reaction of amination or isotopologue.
Further, it is combined with label on the nucleotide sequence of the ssDNA aptamers.
Further, one or more of the label in biotin, enzyme, luminophore.
Further, the luminophore is selected from fluorescein isothiocynate, carboxyl tetramethylrhodamine, double (2,2`- connection
Pyridine) one or more in (4,4`- dicarboxyl -2,2`- bipyridyls) ruthenium ligand.
It is to provide a kind of screening technique of above-mentioned ssDNA aptamers, including following step another mesh of the present invention
Suddenly：
Step 1：Synthesize the single-stranded DNA banks and primer shown in following sequence：
Random library Library50：
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC-3’；
5 ' primers of FITC marks：5’-FITC-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers of Biotin marks：5’-Biotin-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers of TAMRA marks：5’-TAMRA-GACGCTTACTCAGGTGTGACTCG-3’；
Step 2：The above-mentioned random libraries of 10nmol are taken to be dissolved in 300-500 μ l PBS, the water bath with thermostatic control at 80-95 DEG C
5min, then carries out rapidly ice bath, ice bath 5-20min, takes the random library after processing to be incubated with vibrio alginolyticus viable bacteria on ice
0.5-2h；After the completion for the treatment of hatching combination, centrifuge and remove supernatant, take the PBS of 10mL to wash vibrio alginolyticus viable bacteria, and at 92 DEG C
Water bath with thermostatic control 5-30min, centrifuges 1-20min under conditions of 12000g, and collects supernatant, and the supernatant is specificity
Identify the ssDNA aptamers storehouse of vibrio alginolyticus；
Step 3：The ssDNA aptamers storehouse for identifying vibrio alginolyticus that 100-200ul is screened is taken to carry out PCR expansions
Increase, the specific bar program that expands is：94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min, take turns by 15-25 and circulate, and 72
℃5min；
Step 4：The double-stranded DNA of the magnetic bead that 100 μ l streptavidins mark and amplification gained in step 3 is taken to incubate at normal temperatures
15-30min is educated, magnetic bead is drawn using magnetic separator and removes supernatant, after washing magnetic bead with 1-4mL PBS, adds 100-200
The 200mM NaOH solutions of μ l, normal-temperature reaction 5-20min, and using magnetic separation rack recycling magnetic bead, leave and take supernatant；
Step 5：Step 4 gained supernatant is taken to add after sterile water washing except salt plug carries out salinity separation, in gravity
It is lower to drip off naturally, 300-500 μ l PBS are added into the liquid being collected into, obtain the solution containing the single-stranded libraries of DNA；
Step 6：The single-stranded libraries of the DNA obtained in step 5 are taken to replace the random library in step 2, and repeat step 2-5
5-8 times；
Step 7：Take the DNA library of step 6 to heat 5-20min in 80-95 DEG C of water bath with thermostatic control, then carry out ice rapidly
Bath, ice bath 5-20min, the solution and Aeromonas hydrophila for taking the single-stranded libraries of DNA after processing are incubated 0.5-2h on ice；Wait to incubate
After the completion of educating combination, centrifuge and collect supernatant, supernatant solution and vibrio alginolyticus viable bacteria are incubated 0.5-2h on ice；Wait to be incubated
With reference to after the completion of, centrifugation removes supernatant, takes the PBS of 10mL to wash vibrio alginolyticus viable bacteria, and the water bath with thermostatic control 5- at 80-95 DEG C
30min, centrifuges 1-20min under conditions of 12000g, and collects supernatant, and the supernatant is the height by negative screening
The ssDNA aptamers storehouse of specific recognition vibrio alginolyticus；
Step 8：Gained supernatant solution in step 7 is taken, successively according to step 3, step 4, step 5, step 7, step 2, step
Rapid 3, the experimental implementation of step 4 and step 5 order is repeated 8 times, and final resulting solution is ssDNA aptamers.
Further, the primer further includes 3 ' primers of Biotin marks：
5’-Biotin-GAGACTTCATCTGCGTCCTTCG-3’(SEQ ID NO：3).
It is to provide a kind of ELISA detection method of above-mentioned ssDNA aptamers another mesh of the present invention, including with
Lower step：
Step 1：Biotin labeling is carried out to ssDNA aptamers；
Step 2：Sample to be tested 1-100mg is taken to be mixed with step 1 gained concentration for the ssDNA aptamers of 100-200nM
Close, and in hatching combination 20-40min on ice；After hatching combination, sample to be tested is cleaned, and add 100-200 μ l by horseradish mistake
The Streptavidin of oxide enzyme mark, is carrying out hatching combination 10-40min again on ice, clear with PBS solution after hatching combination
Sample to be tested is washed, and adds progress TMB nitrite ion colour developings in horseradish peroxidase colour reagent box, is read and treated using microplate reader
Light absorption value and record of the sample at 450nm according to the change of light absorption value as a result, detect in sample to be tested whether contain molten algae
Vibrios.
The present invention also have a mesh in provide it is a kind of using above-mentioned ssDNA aptamers in vibrio alginolyticus is detected
Purposes.
The present invention is relative to the prior art, the ssDNA aptamers obtained by SELEX technology screenings, and logical feminine gender
Screening effectively improves the specificity of ssDNA aptamers, the affinity with higher and spy compared with existing protein antibodies
The opposite sex, while have the advantages that non-immunogenicity, short preparation period, favorable reproducibility, molecular weight are small, external chemistry can be passed through
Synthesis is largely produced.When carrying out ELISA detections to vibrio alginolyticus based on ssDNA aptamers of the present invention in addition, operation
Simply, quickly.
Brief description of the drawings
Fig. 1 is that the ELISA of ssDNA aptamers in the embodiment of the present invention 1, embodiment 2, reference examples detects light absorption value pair
Than figure；
Fig. 2 is the fluorescein isothiocynate shooting figure of ssDNA aptamers in the embodiment of the present invention 2, reference examples；
Fig. 3 is the carboxyl tetramethylrhodamine mark shooting of ssDNA aptamers in the embodiment of the present invention 2, reference examples
Figure.
Embodiment
In order to make those skilled in the art more fully understand the present invention program, below by the skill in the embodiment of the present invention
Art scheme is clearly and completely described, it is clear that and described embodiment is only the embodiment of a present invention part, without
It is whole embodiments.
Embodiment 1
The preparation method of 1 ssDNA aptamers of embodiment is as follows：
Step 1：Synthesize the random single-stranded DNA banks and primer shown in following sequence
Random library Library50：
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC-3’；
5 ' primers (FITC marks)：5’-FITC-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers (Biotin marks)：5’-Biotin-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers (TAMRA marks)：5’-TAMRA-GACGCTTACTCAGGTGTGACTCG-3’；
Step 2：The above-mentioned random libraries of 10nmol are dissolved in 500 μ l PBS, are heated under 92 DEG C of water bath with thermostatic control
5min, is then rapidly inserted into ice, ice bath 10min, and the random library after processing and vibrio alginolyticus viable bacteria are incubated 1h on ice；
After the completion of hatching combination, centrifugation removes supernatant, and vibrio alginolyticus viable bacteria is washed with the PBS of 10mL, 92 DEG C of water bath with thermostatic control 10min,
Supernatant is collected by centrifugation in 12000g, is the ssDNA aptamers storehouse of specific recognition vibrio alginolyticus；
Step 3：The ssDNA aptamers storehouse for identifying vibrio alginolyticus that 100ul is screened is taken to carry out PCR amplification, tool
The amplification bar program of body is：94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min, are circulated, 72 DEG C of 5min by 20 wheels；
The supernatant obtained after first round screening, will be completely used for carrying out PCR amplification, obtain amplified production；
Step 4：By the magnetic bead of 100 μ l streptavidins mark with the double-stranded DNA obtained by PCR amplification in step 3 in room temperature
Lower incubation 20min, using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA, double-stranded DNA is attached to
Magnetic bead surfaces, using supernatant is removed on magnetic separator, magnetic bead is washed with 2mL PBS, 200 μ l are then added in EP pipes
NaOH solution (200mM), normal-temperature reaction 10min, recycles to obtain supernatant using magnetic separation rack；Except salt plug 10mL sterile waters
After washing, supernatant is added and removes salt plug, is dripped off naturally by gravity；500 μ l PBS are added, are collected into single-stranded containing DNA
The solution in library；
Step 5：The single-stranded libraries of the DNA obtained in step 4 are replaced into the random library in step 2, shown in repeat step 2-4
Positive-selecting process, the producing process 8 times of PCR amplification and single-stranded DNA banks；
Step 6：In being screened after the second wheel and the second wheel, it is control with Aeromonas hydrophila, will be screened after step 5
To the single-stranded libraries of DNA carry out negative screening to improve screening efficiency.Specifically feminine gender screening process is：It will screen what is obtained
After DNA library dissolving, 92 DEG C of waters bath with thermostatic control, ice baths, 1h is incubated on ice with Aeromonas hydrophila viable bacteria, is centrifuged after the completion of incubation
Collect supernatant solution；Then this supernatant soln is carried out ice bath with vibrio alginolyticus viable bacteria to be combined；After the completion of hatching combination, centrifugation
Supernatant is removed, washs vibrio alginolyticus viable bacteria with the PBS of 10mL, supernatant is collected by centrifugation in 92 DEG C of waters bath with thermostatic control 10min, 12000g
Liquid, the supernatant being collected into are the ssDNA aptamers storehouse of the high specific identification vibrio alginolyticus by negative screening；
Step 7：The supernatant soln that will be collected into step 6, the single stranded DNA of PCR amplification and step 4 by step 3
After prepared by library, it is repeated in carrying out the process of step 6, step 2, step 3 and step 4, institute is detected using multi-function microplate reader
Enhancing situation of the library to vibrio alginolyticus recognition capability is obtained, until after 8 wheel screenings, library reaches most vibrio alginolyticus recognition capability
By force；By gained amplified production after cloning and sequencing is analyzed, finally obtain and can be used for detection vibrio alginolyticus viable bacteria in embodiment 1
SsDNA aptamers, its sequence are 5 '-TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC-
3’(SEQ ID NO.1)。
The ELISA detection method of 1 ssDNA aptamers of embodiment is as follows：
Step 1：Biotin labeling is carried out to embodiment 1ssDNA aptamers；
Step 2：The sample 10mg of infection vibrio alginolyticus viable bacteria is taken to be fitted with step 1 gained concentration for the ssDNA nucleic acid of 200nM
Ligand mixes, and in hatching combination 20min on ice；After hatching combination, cleaning sample, and 200 μ l are added by horseradish peroxidating
The Streptavidin of thing enzyme mark, is carrying out hatching combination 40min, PBS solution cleaning sample is used after hatching combination again on ice,
And progress TMB nitrite ion colour developings in horseradish peroxidase colour reagent box are added, sample is read at 450nm using microplate reader
Light absorption value and record result.As shown in Figure 1, No.1 is 1 testing result light absorption value of the embodiment of the present invention.
Embodiment 2
The preparation method of embodiment 2ssDNA aptamers is as follows：
Step 1：Synthesize the random single-stranded DNA banks and primer shown in following sequence
Random library Library50：
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC-3’；
5 ' primers (FITC marks)：5’-FITC-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers (Biotin marks)：5’-Biotin-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers (TAMRA marks)：5’-TAMRA-GACGCTTACTCAGGTGTGACTCG-3’；
3 ' primers：5’-Biotin-GAGACTTCATCTGCGTCCTTCG-3’(SEQ ID NO：3)；
Step 2：The above-mentioned random libraries of 10nmol are dissolved in 500 μ l PBS, are heated under 92 DEG C of water bath with thermostatic control
5min, is then rapidly inserted into ice, ice bath 10min, and the random library after processing and vibrio alginolyticus viable bacteria are incubated 1h on ice；
After the completion of hatching combination, centrifugation removes supernatant, and vibrio alginolyticus viable bacteria is washed with the PBS of 10mL, 92 DEG C of water bath with thermostatic control 10min,
Supernatant is collected by centrifugation in 12000g, is the ssDNA aptamers storehouse of specific recognition vibrio alginolyticus；
Step 3：The ssDNA aptamers storehouse for identifying vibrio alginolyticus that 100ul is screened is taken to carry out PCR amplification, tool
The amplification bar program of body is：94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min, are circulated, 72 DEG C of 5min by 20 wheels；
The supernatant obtained after first round screening, will be completely used for carrying out PCR amplification, obtain amplified production；
Step 4：By the magnetic bead of 100 μ l streptavidins mark with the double-stranded DNA obtained by PCR amplification in step 3 in room temperature
Lower incubation 20min, using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA, double-stranded DNA is attached to
Magnetic bead surfaces, using supernatant is removed on magnetic separator, magnetic bead is washed with 2mL PBS, 200 μ l are then added in EP pipes
NaOH solution (200mM), normal-temperature reaction 10min, recycles to obtain supernatant using magnetic separation rack；Except salt plug 10mL sterile waters
After washing, supernatant is added and removes salt plug, is dripped off naturally by gravity；500 μ l PBS are added, are collected into single-stranded containing DNA
The solution in library；
Step 5：The single-stranded libraries of the DNA obtained in step 4 are replaced into the random library in step 2, shown in repeat step 2-4
Positive-selecting process, the producing process 8 times of PCR amplification and single-stranded DNA banks；
Step 6：In being screened after the second wheel and the second wheel, it is control with Aeromonas hydrophila, will be screened after step 5
To the single-stranded libraries of DNA carry out negative screening to improve screening efficiency.Specifically feminine gender screening process is：It will screen what is obtained
After DNA library dissolving, 92 DEG C of waters bath with thermostatic control, ice baths, 1h is incubated on ice with Aeromonas hydrophila viable bacteria, is centrifuged after the completion of incubation
Collect supernatant solution；Then this supernatant soln is carried out ice bath with vibrio alginolyticus viable bacteria to be combined；After the completion of hatching combination, centrifugation
Supernatant is removed, washs vibrio alginolyticus viable bacteria with the PBS of 10mL, supernatant is collected by centrifugation in 92 DEG C of waters bath with thermostatic control 10min, 12000g
Liquid, the supernatant being collected into are the ssDNA aptamers storehouse of the high specific identification vibrio alginolyticus by negative screening；
Step 7：The supernatant soln that will be collected into step 6, the single stranded DNA of PCR amplification and step 4 by step 3
After prepared by library, it is repeated in carrying out the process of step 6, step 2, step 3 and step 4, institute is detected using multi-function microplate reader
Enhancing situation of the library to vibrio alginolyticus recognition capability is obtained, until after 8 wheel screenings, library reaches most vibrio alginolyticus recognition capability
By force；By gained amplified production after cloning and sequencing is analyzed, finally obtain and can be used for detection vibrio alginolyticus viable bacteria in embodiment 1-3
SsDNA aptamers, its sequence are 5 '-GACGCTTACTCAGGTGTGACTCG-
TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC-CGAAGGACGCAGATGAAGTCTC-3’
(SEQ ID NO.2)。
The ELISA detection method of 2 ssDNA aptamers of embodiment is as follows：
Step 1：Biotin labeling is carried out to embodiment 2ssDNA aptamers；
Step 2：The sample 10mg of infection vibrio alginolyticus viable bacteria is taken to be fitted with step 1 gained concentration for the ssDNA nucleic acid of 200nM
Ligand mixes, and in hatching combination 20min on ice；After hatching combination, cleaning sample, and 200 μ l are added by horseradish peroxidating
The Streptavidin of thing enzyme mark, is carrying out hatching combination 40min, PBS solution cleaning sample is used after hatching combination again on ice,
And progress TMB nitrite ion colour developings in horseradish peroxidase colour reagent box are added, sample is read at 450nm using microplate reader
Light absorption value and record result.As shown in Figure 1, No.2 is 2 testing result light absorption value of the embodiment of the present invention.
The marked by fluorescein isothiocyanate detection method of 2 ssDNA aptamers of embodiment is as follows：
Step 1：Marked by fluorescein isothiocyanate is carried out to embodiment 2ssDNA aptamers；
Step 2：The sample 10mg of infection vibrio alginolyticus viable bacteria is taken to be fitted with step 1 gained concentration for the ssDNA nucleic acid of 200nM
Ligand mixes, and in hatching combination 20min on ice；After hatching combination, cleaning sample, and with PBS solution cleaning sample, utilize
Fluorescence microscope detects combination effect of the ssDNA aptamers of marked by fluorescein isothiocyanate in the present embodiment to vibrio alginolyticus
Fruit and its specificity, testing result is as shown in Fig. 2, No.2 is 2 testing result of the embodiment of the present invention.
The carboxyl tetramethylrhodamine mark detection method of 2 ssDNA aptamers of embodiment is as follows：
Step 1：Carboxyl tetramethylrhodamine mark is carried out to embodiment 2ssDNA aptamers；
Step 2：The sample 10mg of infection vibrio alginolyticus viable bacteria is taken to be fitted with step 1 gained concentration for the ssDNA nucleic acid of 200nM
Ligand mixes, and in hatching combination 20min on ice；After hatching combination, cleaning sample, and with PBS solution cleaning sample, utilize
Fluorescence microscope detects combination of the ssDNA aptamers of carboxyl tetramethylrhodamine mark in the present embodiment to vibrio alginolyticus
Effect and its specificity, testing result is as shown in figure 3, No.2 is 2 testing result of the embodiment of the present invention.
Embodiment 3
The embodiment of the present invention takes 2 gained ssDNA aptamers of embodiment, carries out ELISA kit assembling, forms one
Kind is used for the ELISA detection kit of aquatic pathogenic bacteria vibrio alginolyticus detection.
Reference examples
The preparation method of reference examples ssDNA aptamers is as follows：
Synthesize the random single-stranded DNA banks and primer shown in following sequence
Random library Library50：
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC-3’；
5 ' primers (FITC marks)：5’-FITC-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers (Biotin marks)：5’-Biotin-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers (TAMRA marks)：5’-TAMRA-GACGCTTACTCAGGTGTGACTCG-3’；
3 ' primers：5’-Biotin-GAGACTTCATCTGCGTCCTTCG-3’；
Above-mentioned random single-stranded DNA banks are reference examples ssDNA aptamers.
The ELISA detection method of reference examples ssDNA aptamers is as follows：
Step 1：Biotin labeling is carried out to reference examples ssDNA aptamers；
Step 2：The sample 10mg of infection vibrio alginolyticus viable bacteria is taken to be fitted with step 1 gained concentration for the ssDNA nucleic acid of 200nM
Ligand mixes, and in hatching combination 20min on ice；After hatching combination, cleaning sample, and 200 μ l are added by horseradish peroxidating
The Streptavidin of thing enzyme mark, is carrying out hatching combination 40min, PBS solution cleaning sample is used after hatching combination again on ice,
And progress TMB nitrite ion colour developings in horseradish peroxidase colour reagent box are added, sample is read at 450nm using microplate reader
Light absorption value and record result.As shown in Figure 1, Con is reference examples testing result light absorption value of the present invention.
The marked by fluorescein isothiocyanate detection method of reference examples ssDNA aptamers is as follows：
Step 1：Marked by fluorescein isothiocyanate is carried out to reference examples ssDNA aptamers；
Step 2：The sample 10mg of infection vibrio alginolyticus viable bacteria is taken to be fitted with step 1 gained concentration for the ssDNA nucleic acid of 200nM
Ligand mixes, and in hatching combination 20min on ice；After hatching combination, cleaning sample, and with PBS solution cleaning sample, utilize
Fluorescence microscope detects combination effect of the ssDNA aptamers of marked by fluorescein isothiocyanate in the present embodiment to vibrio alginolyticus
Fruit and its specificity, testing result is as shown in Fig. 2, Con is reference examples testing result of the present invention.
The carboxyl tetramethylrhodamine mark detection method of reference examples ssDNA aptamers is as follows：
Step 1：Carboxyl tetramethylrhodamine mark is carried out to reference examples ssDNA aptamers；
Step 2：The sample 10mg of infection vibrio alginolyticus viable bacteria is taken to be fitted with step 1 gained concentration for the ssDNA nucleic acid of 200nM
Ligand mixes, and in hatching combination 20min on ice；After hatching combination, cleaning sample, and with PBS solution cleaning sample, utilize
Fluorescence microscope detects combination of the ssDNA aptamers of carboxyl tetramethylrhodamine mark in the present embodiment to vibrio alginolyticus
Effect and its specificity, testing result is as shown in figure 3, Con is reference examples testing result of the present invention.
As shown in Figure 1, the ssDNA aptamers of the embodiment of the present invention 1, embodiment 2 and vibrio alginolyticus viable bacteria can be into
The row spy property led combines, and testing result is respectively provided with higher light absorption value, and reference examples are compared to embodiment 1, embodiment 2, light absorption value compared with
It is low, without the ability specifically bound with vibrio alginolyticus viable bacteria, specific recognition can not be carried out to vibrio alginolyticus viable bacteria.
In addition, the light absorption value of embodiment 1 has preferably specific binding performance apparently higher than embodiment 2 for vibrio alginolyticus viable bacteria.
As shown in Fig. 2, determine vibrio alginolyticus viable bacteria position by fluorescence microscope, by can be seen that in figure, reference examples it is molten
Algae vibrios does not show fluorescence in fluorescence detection, illustrates that reference examples ssDNA aptamers can not be carried out with vibrio alginolyticus
Specific binding, it is impossible to vibrio alginolyticus is effectively detected, and vibrio alginolyticus institute is in place in the fluorescence detection of embodiment 2
Putting has fluorescence display, illustrates that the ssDNA aptamers of embodiment 2 can effectively be combined with vibrio alginolyticus.
As shown in figure 3, determine vibrio alginolyticus viable bacteria position by fluorescence microscope, by can be seen that in figure, reference examples it is molten
Algae vibrios does not show fluorescence in fluorescence detection, illustrates that reference examples ssDNA aptamers can not be carried out with vibrio alginolyticus
Specific binding, it is impossible to vibrio alginolyticus is effectively detected, and vibrio alginolyticus institute is in place in the fluorescence detection of embodiment 2
Putting has fluorescence display, and the ssDNA aptamers and vibrio alginolyticus tool for illustrating embodiment 2 preferably combine effect.In addition, figure
The fluoroscopic examination picture of embodiment 2 clearly visible other miscellaneous bacterias under visible light irradiation in 3, and in fluorescence detection, it is miscellaneous
Without obvious fluorescent absorption, specific knot can be carried out with vibrio alginolyticus by illustrating the ssDNA aptamers of embodiment 2 for bacterium position
Close, be not likely to produce false positive results.
It is based on Fig. 1,2,3 as a result, the embodiment of the present invention 1, the ssDNA aptamers shown in embodiment 2 can be proved
After the fluorescent materials such as biotin, enzyme, fluorescein isothiocynate, carboxyl tetramethylrhodamine or luminescent material mark modification,
It can still be specifically bound with vibrio alginolyticus, can be used in the detection of vibrio alginolyticus.
The ssDNA aptamers that the embodiment of the present invention 1,2 is obtained by SELEX technology screenings have preferable affinity
And specificity, and the ssDNA aptamer stable structure of the embodiment of the present invention 1,2, after group mark and modification is carried out, still
With preferable affinity and specificity, can be applied in ELISA detection kit, and the ssDNA cores of the embodiment of the present invention 1,2
Sour aptamers have the characteristics that short preparation period, favorable reproducibility, molecular weight are small compared to protein antibodies, easy to synthesize in vitro,
The detection field of aquatic pathogenic bacteria vibrio alginolyticus has good application prospect.
Finally it should be noted that the above embodiments are merely illustrative of the technical scheme of the present invention and are not intended to be limiting thereof, to the greatest extent
Pipe is described in detail the present invention with reference to above-described embodiment, it should be understood by a person of ordinary skill in the art that technology
Personnel read present specification after still can to the present invention embodiment technical scheme is modified or replaced equivalently, but this
A little modifications are changed within all without departing from the present patent application accompanying claims protection domain.
Sequence table
<110>Guangxi Academy Of Sciences
<120>A kind of aptamer and its application in identification, detection vibrio alginolyticus
<130> PY1710281
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 49
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
tttcttctat tcgcgatctc atacaactta cttatctcat ttctttacc 49
<210> 2
<211> 94
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gacgcttact caggtgtgac tcgtttcttc tattcgcgat ctcatacaac ttacttatct 60
catttcttta cccgaaggac gcagatgaag tctc 94
Claims (10)
- A kind of 1. ssDNA aptamers, it is characterised in that the nucleotides sequence of the ssDNA aptamers is classified as 5 '- TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC-3’(SEQ ID NO：1).
- A kind of 2. ssDNA aptamers, it is characterised in that the nucleotides sequence of the ssDNA aptamers is classified as 5 '- GACGCTTACTCAGGTGTGACTCG-TTTCTTCTATTCGCGATCTCATACAACTTACTTATCTCATTTCTTTACC- CGAAGGACGCAGATGAAGTCTC-3’(SEQ ID NO：2).
- 3. ssDNA aptamers according to claim 1 or 2, it is characterised in that the ssDNA aptamers Any position can carry out phosphorylation, sulfhydrylation, methylate, the reaction of amination or isotopologue on nucleotide sequence.
- 4. ssDNA aptamers according to claim 1 or 2, it is characterised in that the ssDNA aptamers Label is combined with nucleotide sequence.
- 5. ssDNA aptamers according to claim 4, it is characterised in that the label be selected from biotin, enzyme, One or more in luminophore.
- 6. ssDNA aptamers according to claim 5, it is characterised in that the luminophore is selected from isothiocyanic acid One in fluorescein, carboxyl tetramethylrhodamine, double (2,2`- bipyridyls) (4,4`- dicarboxyl -2,2`- bipyridyls) ruthenium ligand Kind is a variety of.
- 7. a kind of screening technique of ssDNA aptamers as claimed in claim 1 or 2, it is characterised in that including following step Suddenly：Step 1：Synthesize the single-stranded DNA banks and primer shown in following sequence：Random library Library50：5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC-3’；5 ' primers of FITC marks：5’-FITC-GACGCTTACTCAGGTGTGACTCG-3’；5 ' primers of Biotin marks：5’-Biotin-GACGCTTACTCAGGTGTGACTCG-3’；5 ' primers of TAMRA marks：5’-TAMRA-GACGCTTACTCAGGTGTGACTCG-3’；Step 2：The above-mentioned random libraries of 10nmol are taken to be dissolved in 300-500 μ l PBS, the water bath with thermostatic control 5min at 80-95 DEG C, Then ice bath is carried out rapidly, and ice bath 5-20min, takes the random library after processing to be incubated 0.5- on ice with vibrio alginolyticus viable bacteria 2h；After the completion for the treatment of hatching combination, centrifuge and remove supernatant, take the PBS of 10mL to wash vibrio alginolyticus viable bacteria, and the constant temperature at 92 DEG C Water-bath 5-30min, centrifuges 1-20min under conditions of 12000g, and collects supernatant, and the supernatant is specific recognition The ssDNA aptamers storehouse of vibrio alginolyticus；Step 3：The ssDNA aptamers storehouse for identifying vibrio alginolyticus that 100-200ul is screened is taken to carry out PCR amplification, tool The amplification bar program of body is：94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min, take turns by 15-25 and circulate, 72 DEG C 5min；Step 4：The double-stranded DNA of the magnetic bead that 100 μ l streptavidins mark and amplification gained in step 3 is taken to be incubated at normal temperatures 15-30min, draws magnetic bead using magnetic separator and removes supernatant, after washing magnetic bead with 1-4mL PBS, adds 100-200 μ l 200mM NaOH solutions, normal-temperature reaction 5-20min, and using magnetic separation rack recycling magnetic bead, leave and take supernatant；Step 5：Step 4 gained supernatant is taken to add after sterile water washing except salt plug carries out salinity separation, under the effect of gravity certainly So drip off, 300-500 μ l PBS are added into the liquid being collected into, obtain the solution containing the single-stranded libraries of DNA；Step 6：The single-stranded libraries of the DNA obtained in step 5 are taken to replace the random library in step 2, and repeat step 2-5 5-8 It is secondary；Step 7：Take the DNA library of step 6 to heat 5-20min in 80-95 DEG C of water bath with thermostatic control, then carry out ice bath, ice rapidly 5-20min is bathed, the solution and Aeromonas hydrophila for taking the single-stranded libraries of DNA after processing are incubated 0.5-2h on ice；Wait to be incubated knot After the completion of conjunction, centrifuge and collect supernatant, supernatant solution and vibrio alginolyticus viable bacteria are incubated 0.5-2h on ice；Treat hatching combination After the completion of, centrifugation removes supernatant, takes the PBS of 10mL to wash vibrio alginolyticus viable bacteria, and the water bath with thermostatic control 5-30min at 80-95 DEG C, 1-20min is centrifuged under conditions of 12000g, and is collected supernatant, the supernatant is the high specific by negative screening Identify the ssDNA aptamers storehouse of vibrio alginolyticus；Step 8：Take in step 7 gained supernatant solution, successively according to step 3, step 4, step 5, step 7, step 2, step 3, The experimental implementation of step 4 and step 5 order is repeated 8 times, and final resulting solution is ssDNA aptamers.
- 8. screening technique according to claim 7, it is characterised in that the primer further includes 3 ' that Biotin is marked and draws Thing：5’-Biotin-GAGACTTCATCTGCGTCCTTCG-3’(SEQ ID NO：3).
- A kind of 9. ELISA detection method for applying ssDNA aptamers as claimed in claim 1 or 2, it is characterised in that bag Include following steps：Step 1：Biotin labeling is carried out to ssDNA aptamers；Step 2：Sample to be tested 1-100mg is taken to be mixed with the ssDNA aptamers that step 1 gained concentration is 100-200nM, and In hatching combination 20-40min on ice；After hatching combination, sample to be tested is cleaned, and add 100-200 μ l by horseradish peroxidating The Streptavidin of thing enzyme mark, is carrying out hatching combination 10-40min, is being cleaned and treated with PBS solution after hatching combination again on ice Sample, and progress TMB nitrite ion colour developings in horseradish peroxidase colour reagent box are added, read using microplate reader and treat test sample Light absorption value and record of the product at 450nm according to the change of light absorption value as a result, detect in sample to be tested whether contain vibrio alginolyticus.
- 10. purposes of the ssDNA aptamers as claimed in claim 1 or 2 in vibrio alginolyticus is detected.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711246574.7A CN107937404B (en) | 2017-12-01 | 2017-12-01 | Nucleic acid aptamer and application thereof in identification and detection of vibrio alginolyticus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711246574.7A CN107937404B (en) | 2017-12-01 | 2017-12-01 | Nucleic acid aptamer and application thereof in identification and detection of vibrio alginolyticus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107937404A true CN107937404A (en) | 2018-04-20 |
| CN107937404B CN107937404B (en) | 2020-12-08 |
Family
ID=61947246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711246574.7A Active CN107937404B (en) | 2017-12-01 | 2017-12-01 | Nucleic acid aptamer and application thereof in identification and detection of vibrio alginolyticus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107937404B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161548A (en) * | 2018-09-26 | 2019-01-08 | 广西科学院 | Aptamer and its application in detection egg-shaped pompano source nervous necrosis virus |
| CN113278621A (en) * | 2021-05-14 | 2021-08-20 | 广西科学院 | ssDNA aptamer and application thereof in identification and detection of vibrio harveyi |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199667A (en) * | 2011-04-12 | 2011-09-28 | 集美大学 | Oligonucleotide sequence for detecting vibrio alginolyticus and application thereof |
| CN102329862A (en) * | 2011-09-02 | 2012-01-25 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
-
2017
- 2017-12-01 CN CN201711246574.7A patent/CN107937404B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199667A (en) * | 2011-04-12 | 2011-09-28 | 集美大学 | Oligonucleotide sequence for detecting vibrio alginolyticus and application thereof |
| CN102329862A (en) * | 2011-09-02 | 2012-01-25 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| DUAN NUO等: "Selection and Identification of a DNA Aptamer Targeted to Vibrio parahemolyticus", 《JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY》 * |
| LI P.,等: "Development and characterization of aptamer-based enzyme-linked apta-sorbent assay for the detection of Singapore grouper iridovirus infection", 《JOURNAL OF APPLIED MICROBIOLOGY》 * |
| ZHOU L.,等: "Rapid and sensitive detection of redspotted grouper nervous necrosis virus (RGNNV) infection by aptamer-coat protein-aptamer sandwich enzyme-linked apta-sorbent assay (ELASA)", 《JOURNAL OF FISH DISEASES》 * |
| 刘腾飞等: "核酸适体的筛选制备及分析应用", 《生物技术通报》 * |
| 胡丽芝等: "核酸适配体在酶联免疫吸附测定法中的应用", 《山东化工》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161548A (en) * | 2018-09-26 | 2019-01-08 | 广西科学院 | Aptamer and its application in detection egg-shaped pompano source nervous necrosis virus |
| CN113278621A (en) * | 2021-05-14 | 2021-08-20 | 广西科学院 | ssDNA aptamer and application thereof in identification and detection of vibrio harveyi |
| CN113278621B (en) * | 2021-05-14 | 2022-10-28 | 广西科学院 | ssDNA aptamer and application thereof in identification and detection of vibrio harveyi |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107937404B (en) | 2020-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108034659A (en) | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application | |
| CN107858358A (en) | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application | |
| CN102844445B (en) | Enhanced multiple FISH | |
| CN107858359A (en) | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application | |
| CN104789696B (en) | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection | |
| CN104789569B (en) | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection | |
| CN104789568B (en) | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection | |
| CN109161547A (en) | A kind of aptamer and its application in the pathogenic vibrio alginolyticus of detection | |
| CN102002531B (en) | Toxoplasma gondii detection kit and application thereof | |
| CN109055381B (en) | ssDNA nucleic acid aptamer for vibrio anguillarum specific recognition and screening and application | |
| CN111073892B (en) | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof | |
| CN102766693B (en) | Nucleic acid aptamer for detecting human hepatoma cell line SMMC-7721 as well as screening method and application thereof | |
| CN103205431A (en) | Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line | |
| CN105385691A (en) | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit | |
| CN109136229B (en) | Aptamer for specifically recognizing trachinotus ovatus-derived nervous necrosis virus and application thereof | |
| CN107937404A (en) | A kind of aptamer and its application in identification, detection vibrio alginolyticus | |
| CN101381767B (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN104212915A (en) | Primer group and kit for carrying out spot quick detection on shrimp covert mortality nodavirus | |
| CN109207480B (en) | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof | |
| CN108004240A (en) | SsDNA aptamer and its application of one species specificity for vibrio alginolyticus | |
| CN104789570B (en) | A kind of DNA aptamers for being used to detect grouper irido virus infection and its screening technique and application | |
| CN109161548B (en) | Aptamer and application thereof in detection of trachinotus ovatus-derived nervous necrosis virus | |
| CN107190010A (en) | One group of high-affinity aptamers and its application with Vibrio vulnificus specific binding | |
| CN109161546A (en) | A kind of aptamer and its application in the detection pathogenic vibrio alginolyticus in egg-shaped pompano source | |
| JP2010022336A (en) | Radioactive probe for counting live campylobacter quickly and specifically by method of culture combined with in situ hybridization, and method by the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |