CN109097485A - A kind of kit and its detection method of new quick detection bacterium mcr-1 gene - Google Patents
A kind of kit and its detection method of new quick detection bacterium mcr-1 gene Download PDFInfo
- Publication number
- CN109097485A CN109097485A CN201811008348.XA CN201811008348A CN109097485A CN 109097485 A CN109097485 A CN 109097485A CN 201811008348 A CN201811008348 A CN 201811008348A CN 109097485 A CN109097485 A CN 109097485A
- Authority
- CN
- China
- Prior art keywords
- mcr
- primer
- kit
- gene
- bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the kit and its detection method of a kind of new quick detection bacterium mcr-1 gene, kit contains the reaction tube of loop-mediated isothermal amplification reaction solution, contains in each reaction tube: the Tris-HCl that 20mM pH is 8.8；0.1%Tween20；The MgSO of 2mM4；10mM(NH4)2SO4,50mM KCl)；1mM dNTP；1.2M betaine；8U Bst archaeal dna polymerase large fragment；Each 1.6 μM of inner primer FIP and inner primer BIP；Each 0.4 μM of outer primer F3 and outer primer B3；0.4 μM of ring primer LB, aseptic double-distilled water.Its method are as follows: Step 1: in measuring samples bacterial genomes DNA extraction；Step 2: being detected using above-mentioned kit；Step 3: presenting, green is then positive for bacterium polymyxins drug resistant gene mcr-1, and orange is then feminine gender.Low in cost and high-throughput can detect the utility model has the advantages that have many advantages, such as high sensitivity, high specificity, facilitate implementation, can be used for animal doctor and people doctor field includes that mcr-1 gene drug-resistant bacteria is quickly detected at laboratory, farm and meiofauna hospital scene.
Description
Technical field
The present invention relates to a kind of kit and its detection method for detecting gene, in particular to a kind of new quick detection is thin
The kit and its detection method of bacterium mcr-1 gene.
Background technique
In recent years, since antibiotic is in clinical a large amount of or even improper uses, under the selection pressure of antibiotic, clinical disease
The antibody-resistant bacterium of sick Related Bacteria continuously emerges, and multidrug resistant strain occurs, since drug-fast bacteria can carry out multipath high-speed
It propagates, the especially cross-infection of people and animals has seriously threatened the life security of the mankind, while considerably increasing clinical anti-infectious
Difficulty.The drug resistant enterobacteriaceae lactobacteriaceae of carbapenem antibiotic occurred having aggravated this threat, carbon mould successively in recent years
Carbapenem antibiotic (Imipenem, Meropenem etc.) is effective treatment gram negative bacilli, and it is interior to produce super wide spectrum β-for especially treatment
The important drugs of amidase (ESBLs) and Sustainable high yield C class cephalosporinase (AmpC enzyme) Gram-negative bacilli.With facing
The increase of such medicinal application of bed, drug-fast bacteria are especially the enterobacteriaceae lactobacteriaceae with Carbapenem-resistant class antibiotic resistance genes
Appearance, clinical infection treatment is caused greatly to threaten, it is serious caused by the enterobacteriaceae lactobacteriaceae for producing carbapenem enzyme
Infection, therapeutic choice depends on plus ring element and colistin class antibiotic, is used alone or combines other antibiotic usages,
Therefore it is continuously increased the increase for causing colistin to use with the enterobacteriaceae lactobacteriaceae for producing carbapenem enzyme in the world,
Us are made inevitably to be faced with the related drug resistant increase of colistin class.Colistin belongs to polymyxins family, be it is a kind of from
The basic polypeptide class antibiotic obtained in bacillus polymyxa culture solution, to a variety of gram negative bacillis, including most of clinic
Pathogenic enterobacteriaceae lactobacteriaceae and Bacteria is effective.In Gram-negative bacteria in polymyxin B resistance mechanism, in bacterium
Binary regulator control system (pmrAB, phoPQ and negative regulatory factor mgrB) play an important role, mainly by being repaired to lipopolysaccharides
Decorations.After the modification of bacterial cell membrane lipopolysaccharides, melanoma cells, in the case where Fe3+ and low ph value are mediated, polymyxins is positively charged
Peptide chain and the electrostatic reaction between negatively charged lipopolysaccharides originally can not carry out, cause bacterium to polymyxins drug resistance.
It is also recently found the presence of colistin drug resistant gene on plasmid, there is mechanism investigation discovery, the mcr-1 base that plasmid carries recently
It is widely distributed because of mediated anti-stick rhzomorph drug-resistant bacteria: in 804 pigs in Chinese four province slaughterhouses, to find 166 headbands
There is the gene；During 2011 to 2014,30 markets and 27 supermarkets in Guangzhou, from the pork and chicken of sale
Have found the gene.Since the gene is present on plasmid, so that this drug resistance is spread between a large amount of bacteria cultures, wherein
Including Escherichia coli, klebsiella spp and Pseudomonas aeruginosa.With a large amount of detections in animal, it is faced with our mankind also
The threat of this drug-fast bacteria.Once this bacterium for having drug resistance spreads rapidly, the whole world will be shrouded in the infection that can not be cured
In sick shade.Therefore, there is an urgent need to establish fast and convenient detection method, the prevalence of mcr-1 drug resistant gene is timely and effectively monitored.
In existing drug resistant gene detection method, generally determined by traditional culture of microorganism and drug sensitive test method micro-
Whether biology has drug resistance to a certain antibiotic, and the method is time-consuming, cumbersome, is not able to satisfy veterinary clinic on-site test
It needs；Can also be by polymerase chain reaction (PCR) technology, the means such as biochip technology detect drug resistant gene, but this two
Kind detection means has the defects of being easy pollution, instrument that is cumbersome, needing profession, is not suitable for clinical large-scale promotion and answers
With.Therefore research and development are independent of expensive instrument, can monitoring method and reagent quick, sensitive, that be easy to execute-in-place, to mediation
The anti-stick drug resistant mcr-1 gene of rhzomorph is detected, and is monitored its popularity and is of great significance.Application number 201710153044.1
Application for a patent for invention disclose " a kind of LAMP primer group of quick detection bacterium polymyxins drug resistant gene mcr-1, kit
And detection method ".In contrast, LAMP primer group, the composition of kit and content are entirely different, and detection method is more by the present invention
It is sensitive, it is easy.The application for a patent for invention of application number 201511026072.4 discloses " for drawing for detection bacterium MCR-1 gene
Object is to, probe and kit ", the composition of kit and content are entirely different in contrast by the present invention, and detection method is completely not yet
Together, with more specificity, sensitivity and simplicity.
Summary of the invention
The purpose of the present invention is to solve the false positive rates of current drug resistant gene detection high, testing cost height, operation are again
Kit and its detection side of the long problem of miscellaneous and detection time and the quick detection bacterium mcr-1 gene of the one kind provided newly
Method.
The kit of new quick detection bacterium mcr-1 gene provided by the invention contains loop-mediated isothermal amplification reaction solution
Reaction tube, contain in each reaction tube: the Tris-HCl that 20mM pH is 8.8；0.1%Tween20；The MgSO of 2mM4；10mM
(NH4)2SO4,50mM KCl)；1mM dNTP；1.2M betaine；8U Bst archaeal dna polymerase large fragment；Inner primer FIP and interior
Each 1.6 μM of primer BIP；Each 0.4 μM of outer primer F3 and outer primer B3；0.4 μM of ring primer LB, aseptic double-distilled water.
Outer primer F3, outer primer B3, inner primer FIP, inner primer BIP and ring primer LB sequence be respectively SEQ ID No:
1-5, nucleotide sequence difference are as follows:
Outer primer F3:5'-AAAAGCGCAATTTGCCGATT-3'(SEQ ID No.1)；
Outer primer B3:5'-TGGCGTGAATTTGGCAAACT-3'(SEQ ID No.2)；
Inner primer FIP:5'-CGAGCATACCGACATCGCGGTAAATCCGCGACCAACAACG-3'(SEQ ID
No.3)；
Inner primer BIP:5'-TTGTCGCTGCCAATAACGGCAATACGCAGGCCCGTGATT-3'(SEQ ID No.4)；
Ring primer LB:5'-TGCCAATAACGGCAAAGAT-3'(SEQ ID No.5).
Also contain in kit: LAMP reaction solution, color developing agent, positive control and negative control, color developing agent SYBR
Green I, the positive control contain the part DNA sequence of amplimer bacterium polymyxins drug resistant gene mcr-1 detected
Column, as shown in SEQ ID No.6；The negative control is DEPC water.
The detection method of new quick detection bacterium mcr-1 gene provided by the invention, method are as described below:
Step 1: in measuring samples bacterial genomes DNA extraction；
Step 2: being detected using above-mentioned kit, concrete operations are as follows: the DNA of bacteria to be checked of preparation to be added
It is mixed in the reaction solution of LAMP reaction tube, while setting negative control and positive control, be in addition reaction solution in positive control
Plasmid pMD18T-mcr-1 containing bacterium polymyxins drug resistant gene mcr-1 segment, negative control are DEPC aseptic double-distilled water,
Using the above-mentioned LAMP primer group for quick detection bacterium polymyxins drug resistant gene mcr-1 in reaction tube to measuring samples
DNA carries out isothermal duplication, and amplification condition is 50 DEG C of -55 DEG C of isothermal reaction 20-25min；95 DEG C, 6-8min terminates reaction；
Step 3: result judges: the color developing agent that kit provides being added in the above-mentioned reaction tube after amplified reaction, mixes
The color of observing response liquid afterwards, it is positive for bacterium polymyxins drug resistant gene mcr-1 if green is presented, it is orange for feminine gender.
Beneficial effects of the present invention:
The present invention uses LAMP technology detection bacterium polymyxins drug resistant gene, and specificity with higher can be accurately
Bacterium polymyxins drug resistant gene is expanded and is distinguished with other nucleic acid.In addition, kit of the invention can be at 40 minutes
Interior detection bacterium polymyxins drug resistant gene mcr-1, does not need instrument and equipment costly, it is only necessary to common metal bath or
Water-bath, that is, implementable；Testing result is very intuitive, can determine that result by direct visual perception.With high sensitivity, spy
It is anisotropic strong, facilitate implementations, it is low in cost and can high-throughput detection the advantages that, can be used for animal doctor and people doctor field include laboratory,
Mcr-1 gene drug-resistant bacteria is quickly detected at farm and meiofauna hospital scene.
Detailed description of the invention
Fig. 1: for the positive control plasmid pMD18T-mcr-1 structural representation of Carried bacteria polymyxins drug resistant gene mcr-1
Figure.
Fig. 2: in embodiment 2 LAMP method detect polymyxins drug resistant gene mcl-1 testing result, wherein No. 1-4
The DNA for the different samples being added in pipe ,+number pipe be positive reference substance ,-number be negative control；No. S1 pipe, No. S2 pipe are detection
Sample.
Specific embodiment
It please refers to shown in Fig. 1 to Fig. 2:
The kit of embodiment 1, preparation detection polymyxins drug resistant gene mcr-1:
The kit of detection polymyxins drug resistant gene mcr-1 is set, which includes the LAMP equipped with reaction solution anti-
Ying Guan, reaction system 25uL, wherein containing: Tris-HCl, 0.1%Tween20 that 20mM pH is 8.8,2mmol/L's
MgSO4、10mM(NH4)2SO4, 50mM KCl), it is 1mM dNTP, 1.2M betaine, 1.0uL BstDNA polymerase (8U), interior
Primers F IP and BIP is 1.6 μM each, outer primer F3 and B3 is 0.4 μM each, 0.4 μM of ring primer LB, complements to 23 μ L with aseptic double-distilled water.
Primer nucleic acid sequence is as follows:
Outer primer F3:5'-AAAAGCGCAATTTGCCGATT-3'
Outer primer B3:5'-TGGCGTGAATTTGGCAAACT-3'
Inner primer FIP:5'-CGAGCATACCGACATCGCGGTAAATCCGCGACCAACAACG-3'
Inner primer BIP:5'-TTGTCGCTGCCAATAACGGCAATACGCAGGCCCGTGATT-3'
Ring primer LB:5'-TGCCAATAACGGCAAAGAT-3'
Further include positive control reaction tube in kit of the invention, bacterium polymyxins drug resistance is contained in the tube reaction liquid
The plasmid pMD18T-mcr-1 of gene mcr-1 segment, remaining composition are identical as detection pipe.
The synthesis and building of Plasmid DNA template containing mcr-1 gene:
The website American National Bioinformatics Institute (NCBI) is logged in, phosphoethanolamine lipid A transferase mcr-1 gene is searched for
(GeneBank:LC114018.1), which is synthesized by Jin Sirui biotech firm (GENESCRIPT).By the mcr- of synthesis
Under the action of ligase, 16 DEG C of connections convert large intestine bar overnight, by the product after connection for 1 genetic fragment and pMD-18T carrier
Bacterium competence DH5 α, obtains positive strain by resistance screening；Preparation and reorganization plasmid is correctly named as pMD- through sequencing identification
18T-mcr-1。
It further include color developing agent in kit of the invention: fluorescent dye 10xSYBR Green I.
Embodiment 2, the detection method that polymyxins drug resistant gene mcr-1 is detected with loop-mediated isothermal amplification method:
Step 1: the extraction of genome of sample to be tested total DNA:
Bacterial genomes DNA is extracted using water-boiling method: taking 200-500mg measuring samples, is placed in 1.5mL centrifuge tube, is used
12000 revs/min of centrifugation 10min of desk centrifuge, abandon supernatant, be added 1.5mL sterilize distilled water, mix, 12000 revs/min from
Heart 1Omin abandons supernatant；100uL sterilizing distilled water is added, mixes, after heating 10min in boiling water bath, 12000 revs/min of centrifugations
5min takes supernatant into a new 1.5mL centrifuge tube, template DNA as to be checked.
Step 2: carrying out the ring mediated isothermal amplification of mcr-1 gene:
Using the kit in embodiment 1, detection pipe, a positive control pipe and a negative control pipe are set, examined
2uL DNA sample to be checked is added in test tube, the Plasmid DNA template of 2uL mcr-1 gene, negative control are added in positive control pipe
2uL sterilizing distilled water is added in pipe.12000 revs/min of centrifugation 10s after mixing.Reaction tube is set in thermostat water bath and is expanded,
Amplification condition are as follows: 50 DEG C of constant temperature water bath reaction 25min are placed in 95 DEG C of thermostat water baths, react stopped reaction after 6min.
Step 3: color developing detection and interpretation of result:
The color developing agent provided in 2uL embodiment 1 is provided in each reaction tube, is directly detected by an unaided eye after mixing anti-
Mixed liquor color after answering, positive control pipe become green, negative control Guan Zhongwei is orange, be in detection pipe green, illustrate to
It examines and contains mcr-1 gene in bacterium.It is in orange explanation bacterium to be checked in detection pipe without containing mcr-1 gene.
Above embodiments show that kit of the invention has the characteristics that accuracy is good, high sensitivity, and do not need valuableness
Instrument and equipment, be suitble to on-site test.
Positive control polymyxins drug resistant gene mcr-1 is detected sequence (SEQ ID No.6):
AAAAGCGCAATTTGCCGATTATAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGA
ATGCCGCGATGTCGGTATGCTCGTTGGCTTAGATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGC
TGCACCAAATGGGCAATCACGGGCCTGCGTATTTTAAGCGATATGATGAAAAGTTTGCCAAATTCACGCCA
Sequence table
<110>Jilin University
<120>a kind of kit and its detection method of new quick detection bacterium mcr-1 gene
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
aaaagcgcaa tttgccgatt 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tggcgtgaat ttggcaaact 20
<210> 3
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cgagcatacc gacatcgcgg taaatccgcg accaacaacg 40
<210> 4
<211> 39
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ttgtcgctgc caataacggc aatacgcagg cccgtgatt 39
<210> 5
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
tgccaataac ggcaaagat 19
<210> 6
<211> 217
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
aaaagcgcaa ttgccgatta taaatccgcg accaacaacg ccatctgcaa caccaatcct 60
tataacgaat gccgcgatgt cggtatgctc gttggcttag atgactttgt cgctgccaat 120
aacggcaaag atatgctgat catgctgcac caaatgggca atcacgggcc tgcgtatttt 180
aagcgatatg atgaaaagtt tgccaaattc acgccag 217
Claims (4)
1. a kind of kit of new quick detection bacterium mcr-1 gene, it is characterised in that: kit contains ring mediated isothermal expansion
Increase the reaction tube of reaction solution, contain in each reaction tube: the Tris-HCl that 20mM pH is 8.8；0.1%Tween20；2mM's
MgSO4；10mM(NH4)2SO4,50mM KCl)；1mM dNTP；1.2M betaine；8U Bst archaeal dna polymerase large fragment；It is interior
Each 1.6 μM of primers F IP and inner primer BIP；Each 0.4 μM of outer primer F3 and outer primer B3；0.4 μM of ring primer LB, aseptic double-distilled water.
2. a kind of kit of new quick detection bacterium mcr-1 gene according to claim 1, it is characterised in that: institute
The sequence of the outer primer F3, outer primer B3, inner primer FIP, inner primer BIP and the ring primer LB that state are respectively SEQ ID No:1-5,
Nucleotide sequence difference is as follows:
Outer primer F3:5'-AAAAGCGCAATTTGCCGATT-3'(SEQ ID No.1)；
Outer primer B3:5'-TGGCGTGAATTTGGCAAACT-3'(SEQ ID No.2)；
Inner primer FIP:5'-CGAGCATACCGACATCGCGGTAAATCCGCGACCAACAACG-3'(SEQ ID No.3)；
Inner primer BIP:5'-TTGTCGCTGCCAATAACGGCAATACGCAGGCCCGTGATT-3'(SEQ ID No.4)；
Ring primer LB:5'-TGCCAATAACGGCAAAGAT-3'(SEQ ID No.5).
3. a kind of kit of new quick detection bacterium mcr-1 gene according to claim 1, it is characterised in that: institute
Also contain in the kit stated: LAMP reaction solution, color developing agent, positive control and negative control, color developing agent are SYBR Green I,
The positive control contains the partial dna sequence of amplimer bacterium polymyxins drug resistant gene mcr-1 detected, such as SEQ
Shown in ID No.6；The negative control is DEPC water.
4. a kind of detection method of new quick detection bacterium mcr-1 gene, it is characterised in that: its method is as described below:
Step 1: in measuring samples bacterial genomes DNA extraction；
Step 2: being detected using the kit described in claim 1, concrete operations are as follows: by the DNA of bacteria to be checked of preparation
It is added in the reaction solution of LAMP reaction tube and mixes, while setting negative control and positive control, be added in reaction solution in positive control
It is the plasmid pMD18T-mcr-1 containing bacterium polymyxins drug resistant gene mcr-1 segment, negative control is DEPC sterile double
Water is steamed, is treated using the above-mentioned LAMP primer group for quick detection bacterium polymyxins drug resistant gene mcr-1 in reaction tube
It examines sample DNA and carries out isothermal duplication, amplification condition is 50 DEG C of -55 DEG C of isothermal reaction 20-25min；95 DEG C, 6-8min terminates anti-
It answers；
Step 3: result judges: kit described in claim 1 being added in the above-mentioned reaction tube after amplified reaction and provides
Color developing agent, the color of observing response liquid after mixing is positive for bacterium polymyxins drug resistant gene mcr-1 if green is presented,
Orange is then feminine gender.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811008348.XA CN109097485A (en) | 2018-08-31 | 2018-08-31 | A kind of kit and its detection method of new quick detection bacterium mcr-1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811008348.XA CN109097485A (en) | 2018-08-31 | 2018-08-31 | A kind of kit and its detection method of new quick detection bacterium mcr-1 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109097485A true CN109097485A (en) | 2018-12-28 |
Family
ID=64864356
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811008348.XA Pending CN109097485A (en) | 2018-08-31 | 2018-08-31 | A kind of kit and its detection method of new quick detection bacterium mcr-1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109097485A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996272A (en) * | 2020-09-21 | 2020-11-27 | 山东省兽药质量检验所（山东省畜产品质量检测中心） | RPA detection primer group, kit and method for drug-resistant gene mcr-8 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834506A (en) * | 2017-03-15 | 2017-06-13 | 中山大学 | A kind of LAMP primer group of quick detection bacterium polymyxins drug resistant gene mcr 1, kit and detection method |
-
2018
- 2018-08-31 CN CN201811008348.XA patent/CN109097485A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834506A (en) * | 2017-03-15 | 2017-06-13 | 中山大学 | A kind of LAMP primer group of quick detection bacterium polymyxins drug resistant gene mcr 1, kit and detection method |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996272A (en) * | 2020-09-21 | 2020-11-27 | 山东省兽药质量检验所（山东省畜产品质量检测中心） | RPA detection primer group, kit and method for drug-resistant gene mcr-8 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988325B (en) | RAA constant temperature fluorescence detection method and reagent for shrimp liver Enterocytozoon (EHP) | |
| CN104328204B (en) | The LAMP detection method of clostridium difficile AB toxin and primer special thereof and test kit | |
| CN109486972A (en) | A kind of CPA primer sets for detecting pseudomonas aeruginosa, CPA nucleic acid test strip kit and its application | |
| Girlich et al. | Evaluation of the CRE and ESBL ELITe MGB® kits for the accurate detection of carbapenemase-or CTX-M–producing bacteria | |
| CN107460242A (en) | A kind of detection kit that can detect a variety of high drug resistant genes simultaneously and its application | |
| CN110964857A (en) | Kit for detecting bovine sarcoidosis virus by excluding capripoxvirus, preparation method and application thereof | |
| CN107523619A (en) | The PCR detection kit of drug-fast bacteria comprising mcr genes and its application | |
| CN109880896A (en) | A kind of multiple LAMP kit and detection method for the specific parting of quick discriminating bacteria polymyxins drug resistant gene mcr | |
| CN105525023A (en) | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method | |
| CN101880709B (en) | Salmonella enteritidis detection reagent kit and method based on loop-mediated isothermal amplification technology | |
| CN109680056A (en) | A kind of kit, detection method and its application detecting MCR gene | |
| CN102230019A (en) | Primer of loop-mediated isothermal amplification (LAMP) for detecting multidrug-resistant cfr gene as well as kit and method for detecting multidrug-resistant cfr gene | |
| CN109402276A (en) | A kind of primer sets, kit and application for Multi-drug resistant Acinetobacter baumannii LAMP detection | |
| CN109097485A (en) | A kind of kit and its detection method of new quick detection bacterium mcr-1 gene | |
| CN115820818B (en) | One-step method nucleic acid detection method and application thereof | |
| CN102367493B (en) | Animal Torque Teno virus rapid detection kit and detection method using loop-mediated isothermal amplification technology | |
| CN104561267A (en) | Loop-mediated isothermal amplification reaction primer for detecting streptococcus agalactiae of tilapias | |
| CN111500751A (en) | Detection method and kit for rapidly detecting high-toxicity Klebsiella pneumoniae | |
| CN104328206B (en) | The LAMP detection method and its primer special of clostridium difficile binary toxin and test kit | |
| CN107723375B (en) | RPA method for detecting rickettsia rickettsii, special primer and probe thereof and application | |
| CN104278024B (en) | For identifying Primer composition and their application of human adenovirus 55 type | |
| CN105368951B (en) | For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile | |
| Wang et al. | An improved recombinase polymerase amplification assay for the visual detection of Staphylococcus epidermidis with lateral flow strips | |
| CN108315451A (en) | Primer and probe for detecting C.perfringens and its application | |
| CN107523620A (en) | PCR detection kit and its application comprising production NDM drug-fast bacterias |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181228 |
|
| RJ01 | Rejection of invention patent application after publication |