CN105368951B - For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile - Google Patents
For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile Download PDFInfo
- Publication number
- CN105368951B CN105368951B CN201510885537.5A CN201510885537A CN105368951B CN 105368951 B CN105368951 B CN 105368951B CN 201510885537 A CN201510885537 A CN 201510885537A CN 105368951 B CN105368951 B CN 105368951B
- Authority
- CN
- China
- Prior art keywords
- tet
- primer
- clostridium difficile
- resistance gene
- tetracycline resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses the LAMP kits and its primer special of the tetracycline resistance gene (tet M) for detecting clostridium difficile.Testing principle of the invention is to be detected using LAMP technology to specific conservative's target sequence of the tetracycline resistance gene (tet M) of clostridium difficile, can under isothermal conditions quickly, conveniently, efficiently, Gao Teyi, the tetracycline resistance gene (tet M) for detecting clostridium difficile with sensitivity, complex instrument is not needed, detection for the tetracycline resistance gene (tet M) of clostridium difficile provides new technology platform, it can be used for the screening of primary care health unit and detection clostridium difficile to the drug resistance situation of tetracycline medication, instruct clinic diagnosis and prognosis.
Description
Technical field
The invention belongs to the molecular Biological Detections of gene in field of biotechnology, difficult for detecting more particularly to one kind
The LAMP kit and its primer special and detection method of the tetracycline resistance gene (tet M) of difficult clostridium.
Background technique
Clostridium difficile (Clostridium difficile, Cd) is a kind of Gram-positive anaerobic spore-bearing bacilli, and is produced from part
Toxic bacterial strain causes antibiotic-associated diarrhea, colitis even lethal pseudo- by the A that excretes poison, toxin B and binary toxin
Enteritis membranacea is referred to as clostridium difficile infection (Clostridium difficile infection, CDI).In infection from hospital sense
It is most commonly seen with clostridium difficile in the specific pathogen of metachromia diarrhea institute；In the antibiotic-associated diarrhea cause of disease, clostridium difficile
Also 15%-25% is accounted for；And pseudomembranous enteritis is then almost 100% caused by clostridium difficile.Currently, the first-line treatment drug of CDI is
Metronidazole and/or vancomycin, numerous studies discovery: metronidazole curative effect reduces and occurs antibody-resistant bacterium, vancomycin sensitive
It reduces, causes clostridium difficile associated diarrhea (Clostridium difficile associated disease, CDAD) resistance to
Medicine rate height, high recurrence rate, refractory rate are high, the death rate is high, medical expense is high.Clostridium difficile epidemic strain has a variety of antibacterials
Drug resistance, and a large amount of unreasonable uses of antibacterials are to lead to the most important risk factor of CDI.The report such as Guangzhou Li Yongqiang is difficult
Clostridium multidrug resistant situation is universal, and the triple and above persister accounts for 80%, and (Li Yongqiang, Nie Yuqiang, it is difficult that Yang Yinmei is clinically separated
Drug resistance analysis [J] the gastroenterology and hepatopathy magazine of clostridium, 2010,19 (10): 922-925)；The report such as Britain Mutlu
Certain type bacterial strains of clostridium difficile are dual and triple resistant rates be up to 52.6%-95.4% (Mutlu, E.and A.J.Wroe,
et al.(2007)."Molecular characterization and antimicrobial susceptibility
patterns of Clostridium difficile strains isolated from hospitals in south-
east Scotland."J Med Microbiol 56(Pt 7):921-9.).Clostridium difficile especially can be mould to Tetracyclines, woods
Plain class, quinolones, rifomycins and first-line drug drug resistance constantly enhance.
Tetracycline is a kind of extensive pedigree antibiotic, including natural product aureomycin, terramycin, demeclocycline etc. and hemizygous
Finished product Doxycycline, minocycline etc. are widely used in the anti-of animal and Human clinical's disease since it is efficient, less toxic, inexpensive
In controlling.Tetracycline includes: active outlet to the resistance mechanism of bacterium, ribosomes protection, generates inactivator and a kind of unknown mechanism.
It has been investigated that tetracycline resistance gene multidigit is on conjugative plasmid or conjugative transposon.Drug resistance of the tetracycline to gram-negative bacteria
Mechanism is mainly related with the genes such as tet A, tet B and tet C based on active outlet；And tetracycline is to gram positive bacteria
It is mainly related with the genes such as tet W, tet K, tet L, tet M and tet o based on resistance mechanism is then protected with ribosomes.Four
Ring element class antibiotic prevents aminoacyl tRNA from entering ribosomes A and inhibit bacterioprotein in conjunction with the ribosomes of clostridium difficile
Matter synthesis, to play antibacterial, bactericidal effect.Clostridium difficile is tet M to the Main Drug-Resistant Gene of tetracycline, and tet M is
Ribosomes protected protein, is present in cytoplasm, protects ribosomes from the effect of tetracycline medication, there is ribosomes to rely on
Guanosine triphosphate (GTP) hydrolytic enzyme activities, weaken tetracycline and ribosomes binding ability, to generate drug resistance.A large amount of states
It is inside and outside studies have shown that clostridium difficile is higher to tetracycline resistant rate.Shanghai Huanghai Sea brightness etc. is reported in 110 plants of clostridium difficiles to Fourth Ring
It is 97.1% (Huang, H.and A.Weintraub, et al. that the resistant rate of element, which is 62.7%, tet M gene recall rate,
(2010)."Antimicrobial susceptibility and heteroresistance in Chinese
Clostridium difficile strains."Anaerobe 16(6):633-5.)；The report such as Italian Spigaglia 90
It is 21.1% (Spigaglia, P.and F.Barbanti, et al. to tet M gene recall rate in strain clostridium difficile
(2006)."New variants of the tet(M)gene in Clostridium diffici le clinical
isolates harbouring Tn916-like elements."J Antimicrob Chemother 57(6):1205-
9.).In conclusion domestic clostridium difficile is generally higher to tetracycline resistant rate and tet M gene recall rate, therefore in clinical use
When tetracycline medication, it should be noted that patient's close observation and monitoring, once there is diarrhea, should detect in time clostridium difficile and its
Toxin, and respective handling is made, to prevent there is serious pseudomembranous enteritis.
Currently, domestic the most frequently used PCR detects tet M gene, but because experimental facilities requirement is high, complicated for operation, speed is slow, expand
Need to carry out product electrophoresis, some tedious steps such as development after the completion of increasing, unsuitable basic hospital and field quick detection
Using.Therefore, the tetracycline resistance gene (tet M) found quickly, specifically, in sensitive detection clostridium difficile is conducive to control
CDI risk factor, instructs clinic diagnosis.
With being constantly progressive for molecular diagnostic techniques, a kind of novel nucleic acids amplification technique-ring of T.Notomi invention is mediated
Isothermal amplification technology (LAMP), which designs 4 special primers for 6 regions of target gene, in constant temperature (63-67 DEG C)
Under the conditions of, using high activity strand displacement archaeal dna polymerase (Bst archaeal dna polymerase) so that strand displacement DNA synthesis ceaselessly self
Circulation generates while largely synthesizing target dna with by-product-white magnesium pyrophosphate precipitating, so that realization is to purpose
Quick detection (Notomi T, Okayama H, MasubuchiH, the et al.Loop-mediated isothermal of gene
amplification of DNA.Nucleic Acids Res 2000；28(12):63.).Short (the 30- of this method detection time
60min), it is not necessarily to specific apparatus, it is easy to operate, cooperate corresponding colour reagent to be also able to achieve unaided eye discrimination result.LAMP method mesh
Preceding qualitative and quantitative detection, the sex identification etc. for being successfully applied to clinical diagnosis prevalence bacterium or virus, becomes normal
One of clinical rapid checking method.But so far, the tetracycline that yet there are no in the market for detecting clostridium difficile is resistance to
The LAMP kit and its primer special of medicine gene (tet M).
Summary of the invention
The present invention provides for clostridium difficile tetracycline resistance gene (tet M) carry out LAMP detection primer,
To realize the batch detection of the tetracycline resistance gene (tet M) of clostridium difficile, the specificity and sensitivity of detection are improved.
The LAMP primer of the tetracycline resistance gene (tet M) provided by the present invention for being used to detect clostridium difficile, is root
According to specific conservative's target sequence design of the tetracycline resistance gene (tet M) (GenBank:AB054984.1) of clostridium difficile
, it is described to the tetracycline resistance gene (tet M) of the clostridium difficile in the samples such as qualitative detection muscle, blood, excrement
LAMP primer is made of five primers, including outer primer tet M-F3 and tet M-B3, inner primer tet M-FIP and tet M-
The combination of BIP and ring primer tet M-LB；Specific conservative's target of the tetracycline resistance gene (tet M) of the clostridium difficile
Sequence is as shown in SEQ ID NO:1 in sequence table.
Specifically, the tetracycline resistance gene (tet M) for clostridium difficile carries out five of LAMP detection
SEQ ID NO:2 (tet M-F3), SEQ ID NO:3 (tet M-B3), SEQ ID in the nucleotide sequence of primer such as sequence table
NO:4 (tet M-FIP), SEQ ID NO:5 (tet M-BIP) and SEQ ID NO:6 (tet M-LB) are shown.
The LAMP primer is outer primer tet M-F3 and tet M-B3, inner primer tet M-FIP and tet M-BIP
And the composition of ring primer tet M-LB 1:8:3 in molar ratio.
A second object of the present invention is to provide a kind of tetracycline resistance gene (tet M) progress for clostridium difficile
The kit of LAMP detection.
Kit provided by the present invention, including it is above-mentioned for the tetracycline resistance gene (tet M) of clostridium difficile into
The primer of row LAMP detection.
Specifically, the kit includes the reagent for being used for 23 μ L reaction systems (being free of template) below: Mixture
(main component includes: 0.7 μ L, 10mM KCl of 2mM TrisHCl (pH 8.8), 3.8 μ L, 10mM (NH to 20.9 μ L4)2SO4
3.8 0.4 μ L, 0.8M glycine betaine (betaine) of μ L, 0.1%Tween20,0.3 μ L, 8mM MgSO43 μ L, 1.4mM dNTP
0.5 μ L, 8U Bst DNA polymerase of each 1 μ L, ddH27.4 μ L of O), primer additional amount is respectively as follows: 1. 50mM primer
0.1 μ L of tet M-F3, makes final concentration of 5pmol；2. 0.1 μ L of 50mM primer tet M-B3, makes final concentration of 5pmol；③
0.8 μ L of 50mM primer tet M-FIP, makes final concentration of 40pmol；4. 0.8 μ L of 50mM primer tet M-BIP, makes final concentration of
40pmol 5. 0.3 μ L of 50mM primer tet M-LB, makes final concentration of 15pmol.
For convenience of detection, it may also include positive control and negative control in the kit, the positive control is containing four
The clostridium difficile genomic DNA of ring element drug resistant gene (tet M), the negative control be the LAMP amplification system without DNA (such as
Distilled water, deionized water).
Above-mentioned LAMP primer or kit answering in the LAMP detection of the tetracycline resistance gene (tet M) of clostridium difficile
With also belonging to protection scope of the present invention.
Third object of the present invention is to provide above-mentioned LAMP primer or kit clostridium difficile tetracycline resistant base
Because of the application in the LAMP detection of (tet M).
The application is related to the LAMP detection of the tetracycline resistance gene (tet M) of clostridium difficile, it may include following steps:
1) using the genomic DNA of sample to be tested as template, LAMP amplification, LAMP reaction are carried out under the guidance of above-mentioned primer
System are as follows: sample to be tested genomic DNA 2 μ L, Mixture 20.9 μ L (main component includes: 2mM TrisHCl (pH
8.8) 0.7 μ L, 10mM KCl, 3.8 μ L, 10mM (NH4)2SO43.8 0.4 μ L, 0.8M glycine betaine of μ L, 0.1%Tween20
(betaine) 0.3 μ L, 8mM MgSO43 μ L, 1.4mM dNTP each, 0.5 μ L, 8U Bst DNA polymerase, 1 μ L,
ddH27.4 μ L of O), primer additional amount is respectively as follows: 1. 0.1 μ L of 50mM primer tet M-F3, makes final concentration of 5pmol；②50mM
0.1 μ L of primer tet M-B3, makes final concentration of 5pmol；3. 0.8 μ L of 50mM primer tet M-FIP, makes final concentration of
40pmol；4. 0.8 μ L of 50mM primer tet M-BIP makes final concentration of 40pmol 5. 0.3 μ L of 50mM primer tet M-LB, makes
Final concentration of 15pmol；LAMP amplification condition are as follows: set 60-65 DEG C of constant temperature 60min；
2) result judgement is carried out after reaction: calcein indicator is added in reaction solution, according to the face of reaction solution
Color change judging result, green indicate that there are the tetracycline resistance gene of clostridium difficile (tet M) (result sun in sample to be tested
Property), it is orange to indicate that there is no the tetracycline resistance gene (tet M) of clostridium difficile in sample to be tested (result is negative)；Or not
It adds calcein indicator and directly detects the turbidity variation of reaction front and back reaction solution with transmissometer come judging result, turbidity (ratio
Turbidity >=0.1) rise there are the tetracycline resistance gene of clostridium difficile (tet M) (result is positive) in expression sample to be tested, it is turbid
It spends in unchanged expression sample to be tested and the tetracycline resistance gene (tet M) of clostridium difficile is not present (result is negative).
In above-mentioned detection, it is additionally provided with positive control and negative control in the LAMP reaction system in the step 1), institute
Stating positive control is the clostridium difficile genomic DNA containing tetracycline resistance gene (tet M), and the negative control is without DNA
LAMP amplification system (such as distilled water, deionized water)；The LAMP amplification condition is preferred are as follows: sets 64 DEG C of constant temperature 60min.
The additive amount of calcein indicator can be 1 μ L (end reaction system is 26 μ L) in the step 2), contain 0.5mM
Calcein and 10mM manganese chloride.
The present invention provides the LAMP of the tetracycline resistance gene of clostridium difficile (tet M) detection primer special and its answer
With testing principle is specific conservative's target sequence using LAMP technology to the tetracycline resistance gene (tet M) of clostridium difficile
It is detected.
The invention has the following advantages that
1) easy to operate: as long as will test sample (target nucleic acid) and detection reagent is put into togerther 60-65 DEG C of thermostat (water
Bath, constant-temperature metal bath or transmissometer etc.) in be incubated in 60 minutes can judging result；
2) result judgement method is easy: can observe by the naked eye result (calcein colour developing), can also directly use turbidity
Instrument judging result is not necessarily to complex instrument；
3) short (quick), the amplification efficiency height (efficient) of detection time: entire LAMP amplified reaction can be completed in one hour,
And yield can reach 0.5mg/mL.
4) specificity is high: specific conservative's target sequence of the tetracycline resistance gene (tet M) of 5 primer pair clostridium difficiles
8 specific regions identification ensure that LAMP amplification high degree of specificity, i.e. LAMP can from difference only one nucleotide base
It is expanded because finding out corresponding target sequence in sample；
5) high sensitivity: remolding sensitivity regular-PCR is 10 times high.
In conclusion the present invention can under isothermal conditions quickly, conveniently, efficiently, Gao Teyi, detect with sensitivity it is difficult
The tetracycline resistance gene (tet M) of difficult clostridium, does not need complex instrument, is the tetracycline resistance gene (tet of clostridium difficile
M detection) provides new technology platform, can be used for the screening of primary care health unit and detection clostridium difficile to Tetracyclines
The drug resistance situation of drug, instructs clinic diagnosis and prognosis, has broad application prospects and biggish economical, societal benefits, fits
It is promoted and applied in a wide range of.
The present invention is described in further details combined with specific embodiments below.
Detailed description of the invention
Fig. 1 is the turbidity of the LAMP detection method optimum reaction condition of the tetracycline resistance gene (tet M) of clostridium difficile
Instrument testing result；
Fig. 2 is the transmissometer detection of the LAMP detection method specificity of the tetracycline resistance gene (tet M) of clostridium difficile
As a result；
Fig. 3 is the calcein dye of the LAMP detection method specificity of the tetracycline resistance gene (tet M) of clostridium difficile
Color testing result；
Fig. 4 is the turbidity of the LAMP detection method sensitivity of the tetracycline resistance gene (tet M) of clostridium difficile of the present invention
Instrument testing result；
Fig. 5 is the calcein dye of the LAMP detection method sensitivity of the tetracycline resistance gene (tet M) of clostridium difficile
Color testing result；
Fig. 6 is that the PCR of the LAMP detection method sensitivity of the tetracycline resistance gene (tet M) of clostridium difficile detects knot
Fruit.
Specific embodiment
Method therefor is conventional method unless otherwise instructed in following embodiments, and specific steps can be found in:
" Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W.,
Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring
Harbor)。
The percent concentration is mass/mass (W/W, unit g/100g) percent concentration, matter unless otherwise instructed
Amount/volume (W/V, unit g/100mL) percent concentration or volume/volume (V/V, Unit/mL/100mL) percent concentration.
The acquirement approach of various biomaterials described in embodiment is to provide a kind of approach of experiment acquisition only to reach
To specifically disclosed purpose, the limitation to biological material source of the present invention should not be become.In fact, used biomaterial
Source be it is extensive, it is any keep on the right side of the law the biomaterial that can be obtained with moral ethics can be according to mentioning in embodiment
Show and is replaced.
The primer is synthesized by Sheng Gong bioengineering limited liability company.
Embodiment is implemented under the premise of the technical scheme of the present invention, gives detailed embodiment and specific
Operating process, embodiment will be helpful to understand the present invention, but protection scope of the present invention is not limited to following embodiments.
Embodiment 1, the primer that LAMP detection is carried out designed for the tetracycline resistance gene (tet M) to clostridium difficile
Difficult shuttle is obtained from the nucleic acid database GenBank (http://www.ncbi.nlm.nih.gov) of NCBI retrieval
Tetracycline resistance gene (tet M) sequence (GenBank:AB054984.1) of bacterium carries out homology point by BLAST software
Analysis, obtain the tetracycline resistance gene (tet M) of clostridium difficile specific conservative's target sequence (SEQ ID NO in sequence table:
1) target DNA sequence, is guarded further according to this, is designed for the tetracycline resistant to clostridium difficile with software Primer design V4
Gene (tet M) carries out the primer of LAMP detection, and final preferred primer sequence is as shown in table 1.
Table 1 is used to carry out the tetracycline resistance gene (tet M) of clostridium difficile the primer of LAMP detection
Embodiment 2, clostridium difficile tetracycline resistance gene (tet M) LAMP detection method foundation
One, the optimum reaction condition of the LAMP detection of the tetracycline resistance gene (tet M) for clostridium difficile is determined
Clostridium difficile Guangzhou strain with the primer pair in embodiment 1 containing tetracycline resistance gene (tet M) is (from south doctor
Nanfang Hospital, university, section gastroenterology, gastrointestinal disease key lab, Guangdong Province) LAMP detection is carried out, to obtain optimum response body
System, the specific method is as follows:
1) genomic DNA of clostridium difficile Guangzhou strain is extracted
Use PromegaGenomic DNA Purification Kit A1125 extracts the strain of clostridium difficile Guangzhou
Genomic DNA, specific extracting method the following steps are included:
1. drawing the ready buffer AVL of 560 μ L (containing carrier RNA) into 1.5mL centrifuge tube (according to sample
Buffer AVL-carrier RNA is scaled in the actual amount of product)；
2. serum, urine, cultivates cell supernatant or cell-free body fluid is added to equipped with buffer by 140 μ L blood plasma
In the centrifuge tube of AVL-carrier RNA.It mediates 15 seconds, mixes；
3. being placed at room temperature for 10min；
4. the drop on lid is got rid of return pipe bottom by brief centrifugation；
5. 560 μ L dehydrated alcohols (96%-100%) are added in sample, mediation 15s is mixed well, then brief centrifugation, will
Drop on lid gets rid of return pipe bottom；
6. drawing in the careful addition column (having been loaded into 2mL centrifuge tube) of solution on 630 μ L in step, pay attention to not
Encounter the edge of pillar.It closes the lid, 6000 × g (8000rpm) is centrifuged 1min, and column is put into new 2mL centrifuge tube
In, discard old collecting pipe；
7. the lid of careful opening column, repeats step 6；
8. 500 μ L buffer AW1 are added in careful opening column lid.It closes the lid, 8000rpm centrifugation,
1min.Column is put into new 2mL collecting pipe (Kit offer), old collecting pipe is discarded；
9. careful opening column lid is added 500 μ L buffer AW2, closes the lid, it is centrifuged at full speed
(14000rpm), 3min；
10. column is placed in 1.5mL centrifuge tube (not providing in kit), old collecting pipe, careful opening are discarded
Column is added the buffer AVE of 60 μ L room temperatures, closes the lid, and is placed at room temperature for 1min, and 8000rpm is centrifuged 1min.
2) LAMP amplification is carried out under the guidance of primer in embodiment 1,25 μ L LAMP reaction systems include: difficult shuttle
Bacterium Guangzhou strain genomic DNA 2 μ L, Mixture 20.9 μ L (main component includes: 0.7 μ of 2mM TrisHCl (pH 8.8)
3.8 μ L, 10mM (NH of L, 10mM KCl4)2SO43.8 0.4 μ L, 0.8M glycine betaine (betaine) 0.3 of μ L, 0.1%Tween20
μ L, 8mM MgSO43 μ L, 1.4mM dNTP each, 0.5 μ L, 8U Bst DNA polymerase 1 μ L, ddH27.4 μ L of O),
Primer additional amount is respectively as follows: 1. 0.1 μ L of 50mM primer tet M-F3, makes final concentration of 5pmol；2. 50mM primer tet M-B3
0.1 μ L, makes final concentration of 5pmol；3. 0.8 μ L of 50mM primer tet M-FIP, makes final concentration of 40pmol；4. 50mM primer
0.8 μ L of tet M-BIP makes final concentration of 40pmol 5. 0.3 μ L of 50mM primer tet M-LB, makes final concentration of 15pmol；
LAMP amplification condition are as follows: set 60-65 DEG C of constant temperature 60min；
3) result judgement is carried out after reaction: calcein indicator is added in reaction solution, according to the face of reaction solution
Color change judging result, green indicate that there are the tetracycline resistance gene of clostridium difficile (tet M) (result sun in sample to be tested
Property), it is orange to indicate that there is no the tetracycline resistance gene (tet M) of clostridium difficile in sample to be tested (result is negative)；Or not
It adds calcein indicator and directly detects the turbidity variation of reaction front and back reaction solution with transmissometer come judging result, turbidity (ratio
Turbidity >=0.1) rise there are the tetracycline resistance gene of clostridium difficile (tet M) (result is positive) in expression sample to be tested, it is turbid
It spends in unchanged expression sample to be tested and the tetracycline resistance gene (tet M) of clostridium difficile is not present (result is negative).
As a result as shown in Figure 1, achieving preferable reaction effect under the LAMP amplification condition of 60-65 DEG C of constant temperature 60min,
Reaction effect under the LAMP amplification condition of 64 DEG C of constant temperature 60min is best.
The LAMP amplification condition of the tetracycline resistance gene (tet M) of clostridium difficile are as follows: 60-65 DEG C of constant temperature 60min is set, it is excellent
It is selected as setting 64 DEG C of constant temperature 60min.
Embodiment 3, clostridium difficile tetracycline resistance gene (tet M) LAMP detection method specific detection
Respectively with bacillus megaterium, shark vibrios, Pseudomonas Maltophilia, tubercle bacillus, vibrio cholerae O 139 group, charcoal
Subcutaneous ulcer bacillus, enterohemorrhagic escherichia coli, yersinia enterocolitica, vibrio parahemolyticus, enteropathogenic E.Coli, intestines
Adhesiveness Escherichia coli, enteroinvasive E.Coli, enterotoxigenic E.Coli, yersinia pestis, streptococcus pneumonia, meninx
It is scorching Neisseria, Burkholderia Pseudomallei, methicillin-resistant staphylococcus aureus, the Acinetobacter bauamnnii containing NDM-1, big
Intestines Escherichia, Bordetella pertussis, haemophilus influenzae, Bacterium diphtheriae, Pseudomonas aeruginosa, the bloodthirsty bar of Type B influenza
Bacterium, Bu Shi acinetobacter calcoaceticus (all bacterial strains are all from Diseases Preventing and Controlling Institute) genomic DNA be template,
Using distilled water as negative control, using the genomic DNA of the clostridium difficile containing tetracycline resistance gene (tet M) as positive control,
Detect the specificity of the LAMP detection method of the tetracycline resistance gene (tet M) for the clostridium difficile that embodiment 2 obtains.
The transmissometer testing result of the specificity of the LAMP detection method of the tetracycline resistance gene (tet M) of clostridium difficile
As shown in Figure 2 (1: bacillus megaterium, 2: shark vibrios, 3: Pseudomonas Maltophilia, 4: tubercle bacillus, 5: comma bacillus
O139 groups, 6: bacillus anthracis, 7: enterohemorrhagic escherichia coli, 8: yersinia enterocolitica, 9: vibrio parahemolyticus,
10: enteropathogenic E.Coli, 11: intestinal adhesion to E. coli, 12: enteroinvasive E.Coli, 13: enterotoxigenic large intestine bar
Bacterium, 14: yersinia pestis, 15: streptococcus pneumonia, 16: Neisseria meningitidis, 17: Burkholderia Pseudomallei, 18: resistance to
Methicillin staphylococcus aureus, 19: Acinetobacter bauamnnii, 20: escherichia coli, 21: Bordetella pertussis, 22: influenza
Haemophilus, 23: Bacterium diphtheriae, 24: Pseudomonas aeruginosa, 25:B type Hemophilus influenzae, 26: Bu Shi not lever
Bacterium, 27: positive control, 28: negative control), only positive control (27) turbidity rises, the turbidity of other bacterial strains and negative control
Do not change.
The calcein of the specificity of the LAMP detection method of the tetracycline resistance gene (tet M) of clostridium difficile dyes inspection
Survey result as shown in Figure 3 (1: bacillus megaterium, 2: shark vibrios, 3: Pseudomonas Maltophilia, 4: tubercle bacillus, 5: cholera
O139 groups, vibrios, 6: bacillus anthracis, 7: enterohemorrhagic escherichia coli, 8: yersinia enterocolitica, 9: parahemolyticas arc
Bacterium, 10: enteropathogenic E.Coli, 11: intestinal adhesion to E. coli, 12: enteroinvasive E.Coli, 13: enterotoxigenic is big
Enterobacteria, 14: yersinia pestis, 15: streptococcus pneumonia, 16: Neisseria meningitidis, 17: Burkholderia Pseudomallei,
18: methicillin-resistant staphylococcus aureus, 19: Acinetobacter bauamnnii, 20: escherichia coli, 21: Bordetella pertussis, 22:
Haemophilus influenzae, 23: Bacterium diphtheriae, 24: Pseudomonas aeruginosa, 25:B type Hemophilus influenzae, 26: Bu Shi is motionless
Bacillus, 27: positive control, 28: negative control), only positive control (27) shows green (result positive "+"), shows exist
The tetracycline resistance gene (tet M) of clostridium difficile, remaining shows orange (result is negative), shows that there is no clostridium difficiles
Tetracycline resistance gene (tet M).
Calcein coloration result and transmissometer testing result are consistent, illustrate the tetracycline resistance gene (tet of clostridium difficile
M the specificity with higher of LAMP detection method) can specifically detect the tetracycline resistance gene (tet of clostridium difficile
M)。
Embodiment 4, clostridium difficile tetracycline resistance gene (tet M) LAMP detection method sensitivity technique
Detect the spirit of the tetracycline resistance gene (tet M) of LAMP detection method and regular-PCR method detection clostridium difficile
Sensitivity, detection method are as follows: the genomic DNA for extracting the clostridium difficile containing tetracycline resistance gene (tet M), then with 10 times of ladders
Spend (1 times, 10 times, 102Again, 103Again, 104Again, 105Again, 106Again, 107Again, 108Again, 109Times) be diluted, make 1-10 template
The concentration of the genomic DNA of middle clostridium difficile be respectively 361ng/ μ L, 36.1ng/ μ L, 3.61ng/ μ L, 361pg/ μ L,
36.1pg/ μ L, 3.61pg/ μ L, 0.361pg/ μ L, 0.0361pg/ μ L, 0.00361pg/ μ L, 0.000361pg/ μ L, then with warp
The genomic DNA of the clostridium difficile of gradient dilution is template, using deionized water as negative control, is examined respectively with LAMP of the invention
Survey method and regular-PCR method (primer is tetM1:TTAATATTGGAGTTTTAGCTCATGTTGATG and tetM2:
CTGATAAACCGTTGATAAATCAATTC it) is detected.
The transmissometer testing result of the sensitivity of the LAMP detection method of the tetracycline resistance gene (tet M) of clostridium difficile
As shown in Figure 4 (in 1-10 template the concentration of the genomic DNA of clostridium difficile respectively be 361ng/ μ L, 36.1ng/ μ L,
3.61ng/μL、361pg/μL、36.1pg/μL、3.61pg/μL、0.361pg/μL、0.0361pg/μL、0.00361pg/μL、
0.000361pg/ μ L, 11 be negative control), 1-5 sample (being corresponding in turn to No. 1-5 from left to right) turbidity rises (ratio in Fig. 4
Turbidity >=0.1), show the tetracycline resistance gene (tet M) for detecting clostridium difficile, the tetracycline resistance gene of clostridium difficile
The lowest detection sensitivity of transmissometer is 36.1pg/ μ L in the LAMP detection method of (tet M).
The calcein of the sensitivity of the LAMP detection method of the tetracycline resistance gene (tet M) of clostridium difficile dyes knot
Fruit as shown in Figure 5 (in 1-10 template the concentration of the genomic DNA of clostridium difficile be respectively 361ng/ μ L, 36.1ng/ μ L,
3.61ng/μL、361pg/μL、36.1pg/μL、3.61pg/μL、0.361pg/μL、0.0361pg/μL、0.00361pg/μL、
0.000361pg/ μ L, 11 be negative control；"+" indicates that result is positive (green), and "-" indicates that result is negative (orange)), wherein
1-5 test tube shows green, shows the tetracycline resistance gene (tet M) for detecting clostridium difficile, the Fourth Ring of clostridium difficile
The lowest detection sensitivity that calcein dyes in the LAMP detection method of plain drug resistant gene (tet M) is 36.1pg/ μ L.
The testing result of regular-PCR as shown in Figure 6 (M:DNA marker D2000,1:361ng/ μ L, 2:36.1ng/ μ L,
3:3.61ng/ μ L, 4:361pg/ μ L, 5:36.1pg/ μ L, 6:3.61pg/ μ L, 7:361pg/ μ L, 8:0361pg/ μ L, 9:
0.00361pg/ μ L, 10:0.000361pg/ μ L, 11: negative control (deionized water)), wherein 1-4 sample has the mesh of 416bp
Band (tetracycline resistance gene (tet M)) occur, show the common of the tetracycline resistance gene (tet M) of clostridium difficile
The most bottom detection sensitivity of PCR method is 361pg/ μ L.
Compare it is found that the LAMP detection method of the tetracycline resistance gene (tet M) of clostridium difficile of the present invention can be detected
36.1pg/ μ L, calcein coloration result and transmissometer testing result are consistent, and regular-PCR method is only capable of detecting 361pg/ μ
L shows spirit of the LAMP detection method than regular-PCR detection method of the tetracycline resistance gene (tet M) of clostridium difficile of the present invention
Sensitivity is 10 times high.
Embodiment 5, clostridium difficile tetracycline resistance gene (tet M) LAMP detection kit
Kit provided by the invention includes: to carry out LAMP for the tetracycline resistance gene (tet M) to clostridium difficile
The primer of detection: outer primer tet M-F3 (SEQ ID NO:2) and tet M-B3 (SEQ ID NO:3), inner primer tet M-FIP
(SEQ ID NO:4) and tet M-BIP (SEQ ID NO:5), ring primer tet M-LB (SEQ ID NO:6).
Specifically, the kit includes the reagent for being used for 23 μ L reaction systems (being free of template) below: Mixture20.9
(main component includes: 0.7 μ L, 10mM KCl of 2mM TrisHCl (pH 8.8), 3.8 μ L, 10mM (NH to μ L4)2SO43.8 μ L,
0.4 μ L, 0.8M glycine betaine (betaine) of 0.1%Tween20,0.3 μ L, 8mM MgSO43 μ L, 1.4mM dNTP each 0.5
μ L, 8U Bst DNA polymerase 1 μ L, ddH27.4 μ L of O), primer additional amount is respectively as follows: 1. 50mM primer tet M-F3
0.1 μ L, makes final concentration of 5pmol；2. 0.1 μ L of 50mM primer tet M-B3, makes final concentration of 5pmol；3. 50mM primer tet
0.8 μ L of M-FIP, makes final concentration of 40pmol；4. 0.8 μ L of 50mM primer tet M-BIP, makes final concentration of 40pmol 5. 50mM
0.3 μ L of primer tet M-LB, makes final concentration of 15pmol.
It may also include positive control and negative control in kit, positive control is containing tetracycline resistance gene (tet M)
Clostridium difficile genomic DNA, negative control be the LAMP amplification system (such as distilled water, deionized water) without DNA.
The method that the LAMP detection kit of the tetracycline resistance gene (tet M) of the clostridium difficile can refer to embodiment 2
It uses.
Specific method, it may include following steps:
1) using the genomic DNA of sample to be tested as template, LAMP amplification, LAMP reaction are carried out under the guidance of above-mentioned primer
System are as follows: sample to be tested genomic DNA 2 μ L, Mixture 20.9 μ L (main component includes: 2mM TrisHCl (pH
8.8) 0.7 μ L, 10mM KCl, 3.8 μ L, 10mM (NH4)2SO43.8 0.4 μ L, 0.8M glycine betaine of μ L, 0.1%Tween20
(betaine) 0.3 μ L, 8mM MgSO43 μ L, 1.4mM dNTP each, 0.5 μ L, 8U Bst DNA polymerase, 1 μ L,
ddH27.4 μ L of O), primer additional amount is respectively as follows: 1. 0.1 μ L of 50mM primer tet M-F3, makes final concentration of 5pmol；②50mM
0.1 μ L of primer tet M-B3, makes final concentration of 5pmol；3. 0.8 μ L of 50mM primer tet M-FIP, makes final concentration of
40pmol；4. 0.8 μ L of 50mM primer tet M-BIP makes final concentration of 40pmol 5. 0.3 μ L of 50mM primer tet M-LB, makes
Final concentration of 15pmol；LAMP amplification condition are as follows: set 60-65 DEG C of constant temperature 60min (preferably 64 DEG C of constant temperature 60min)；
2) result judgement is carried out after reaction: calcein indicator is added in reaction solution, according to the face of reaction solution
Color change judging result, green indicate that there are the tetracycline resistance gene of clostridium difficile (tet M) (result sun in sample to be tested
Property), it is orange to indicate that there is no the tetracycline resistance gene (tet M) of clostridium difficile in sample to be tested (result is negative)；Calcium is yellowish green
The additive amount of plain indicator can be 1 μ L (end reaction system is 26 μ L), contain 0.5mM calcein and 10mM manganese chloride；
Or it does not add calcein indicator and directly detects the turbidity variation of reaction front and back reaction solution with transmissometer to sentence
It is disconnected that as a result, turbidity (reduced turbidity >=0.1) rises in expression sample to be tested, there are the tetracycline resistance gene tet M bases of clostridium difficile
Because of (result is positive), the unchanged tetracycline resistance gene tet M gene for indicating that clostridium difficile is not present in sample to be tested of turbidity
(result is negative).
Claims (9)
1. the LAMP primer for the tetracycline resistance gene tet M for detecting clostridium difficile, is the tetracycline according to clostridium difficile
The design of drug resistant gene tet M specific conservative's target sequence as shown in SEQ ID NO:1 in sequence table, to qualitative detection flesh
The tetracycline resistance gene tet M of clostridium difficile in the samples such as meat, blood, excrement, the LAMP primer is by five primer sets
At, including nucleotide sequence outer primer tet M-F3 and tet as shown in SEQ ID NO:2 in sequence table and SEQ ID NO:3
Inner primer tet M-FIP and tet M-BIP and SEQ ID NO:5 shown in M-B3, SEQ ID NO:4 and SEQ ID NO:5
Shown in ring primer tet M-LB combination.
2. it is according to claim 1 for detecting the LAMP primer of the tetracycline resistance gene tet M of clostridium difficile, it is special
Sign is: the LAMP primer, be outer primer tet M-F3 and tet M-B3, inner primer tet M-FIP and tet M-BIP and
The composition of ring primer tet M-LB 1:8:3 in molar ratio.
3. a kind of tetracycline resistance gene tet M for clostridium difficile carries out the kit of LAMP detection, including right is wanted
The 1 or 2 tetracycline resistance gene tet M for clostridium difficile are asked to carry out the primer of LAMP detection.
4. the examination that the tetracycline resistance gene tet M according to claim 3 for clostridium difficile carries out LAMP detection
Agent box, it is characterised in that: the kit includes the following reagent for being used for 25 μ L reaction systems: 20.9 μ L of Mixture, primer
Additional amount is respectively as follows: 1. 0.1 μ L of 50mM primer tet M-F3, makes final concentration of 5pmol；2. 0.1 μ of 50mM primer tet M-B3
L makes final concentration of 5pmol；3. 0.8 μ L of 50mM primer tet M-FIP, makes final concentration of 40pmol；4. 50mM primer tet M-
0.8 μ L of BIP makes final concentration of 40pmol 5. 0.3 μ L of 50mM primer tet M-LB, makes final concentration of 15pmol；It is described
Mixture main component includes: 0.7 μ L, 10mM KCl of TrisHCl, 3.8 μ L, the 10mM (NH of 2mM pH 8.84)2SO4
3.8 0.4 μ L, 0.8M glycine betaine of μ L, 0.1%Tween20,0.3 μ L, 8mM MgSO43 μ L, 1.4mM dNTP each, 0.5 μ L,
8U Bst DNA polymerase 1 μ L, ddH2O 7.4μL。
5. the tetracycline resistance gene tet M according to claim 3 or 4 for clostridium difficile carries out LAMP detection
Kit, it is characterised in that: may also include positive control and negative control in the kit, the positive control is containing Fourth Ring
The clostridium difficile genomic DNA of plain drug resistant gene tet M, the negative control are distilled water or deionized water without DNA.
6. LAMP primer of any of claims 1 or 2 is detected in the LAMP for the tetracycline resistance gene tet M for preparing clostridium difficile
Application in reagent.
7. applying according to claim 6, it is characterised in that: the LAMP of the tetracycline resistance gene tet M of clostridium difficile is examined
It surveys, comprising the following steps:
1) using the genomic DNA of sample to be tested as template, LAMP amplification, LAMP reaction system are carried out under the guidance of above-mentioned primer
Are as follows: 2 20.9 μ L of μ L, Mixture of genomic DNA of sample to be tested, primer additional amount are respectively as follows: 1. 50mM primer tet M-F3
0.1 μ L, makes final concentration of 5pmol；2. 0.1 μ L of 50mM primer tet M-B3, makes final concentration of 5pmol；3. 50mM primer tet
0.8 μ L of M-FIP, makes final concentration of 40pmol；4. 0.8 μ L of 50mM primer tet M-BIP, makes final concentration of 40pmol 5. 50mM
0.3 μ L of primer tet M-LB, makes final concentration of 15pmol；LAMP amplification condition are as follows: set 60-65 DEG C of constant temperature 60min；
2) result judgement is carried out after reaction: adding calcein indicator in reaction solution, is become according to the color of reaction solution
Change judging result, green indicates that there are the tetracycline resistance gene tet M of clostridium difficile in sample to be tested, it is as a result positive, it is orange
Indicate the tetracycline resistance gene tet M that clostridium difficile is not present in sample to be tested, it is as a result negative；Or do not add calcein
Indicator directly detects the turbidity variation of reaction front and back reaction solution with transmissometer come judging result, when reduced turbidity >=0.1 on turbidity
Rising indicates that there are the tetracycline resistance gene tet M of clostridium difficile in sample to be tested, as a result positive, and turbidity is unchanged to indicate to be measured
The tetracycline resistance gene tet M of clostridium difficile is not present in sample, it is as a result negative.
8. applying according to claim 7, it is characterised in that: be additionally provided with the positive in the LAMP reaction system in the step 1)
Control and negative control, the positive control are the clostridium difficile genomic DNA of the M of tet containing tetracycline resistance gene, the yin
Property control be distilled water or deionized water without DNA；The LAMP amplification condition is to set 64 DEG C of constant temperature 60min.
9. applying according to claim 8, it is characterised in that: the additive amount of calcein indicator is 1 μ in the step 2)
L makes 26 μ L of end reaction system, contains 0.5mM calcein and 10mM manganese chloride.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510885537.5A CN105368951B (en) | 2015-12-04 | 2015-12-04 | For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510885537.5A CN105368951B (en) | 2015-12-04 | 2015-12-04 | For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105368951A CN105368951A (en) | 2016-03-02 |
| CN105368951B true CN105368951B (en) | 2019-04-23 |
Family
ID=55371577
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510885537.5A Active CN105368951B (en) | 2015-12-04 | 2015-12-04 | For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105368951B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164505A (en) * | 2017-06-16 | 2017-09-15 | 苏州乔纳森新材料科技有限公司 | A kind of molecular labeling and its application for being used to detect B races streptococcus tetracycline resistance gene |
| CN113005211A (en) * | 2019-12-20 | 2021-06-22 | 中国农业大学 | LAMP primer and method for detecting tigecycline high-level drug resistance gene tet (X) and variant thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103540660A (en) * | 2013-10-10 | 2014-01-29 | 中国人民解放军疾病预防控制所 | Loop-mediated isothermal amplification (LAMP) method based on TaqMan probe, and LAMP primer and kit special for same |
| CN104328206A (en) * | 2014-11-21 | 2015-02-04 | 南方医科大学南方医院 | LAMP detection method of clostridium difficile binary toxin and special primers and kit for LAMP detection method |
-
2015
- 2015-12-04 CN CN201510885537.5A patent/CN105368951B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103540660A (en) * | 2013-10-10 | 2014-01-29 | 中国人民解放军疾病预防控制所 | Loop-mediated isothermal amplification (LAMP) method based on TaqMan probe, and LAMP primer and kit special for same |
| CN104328206A (en) * | 2014-11-21 | 2015-02-04 | 南方医科大学南方医院 | LAMP detection method of clostridium difficile binary toxin and special primers and kit for LAMP detection method |
Non-Patent Citations (3)
| Title |
|---|
| Comparative analysis of Clostridium difficile clinical isolates belonging to different genetic lineages and time periods;Patrizia Spigaglia et al;《Journal of Medical Microbiology》;20041231;第53卷;第1129-1136页 |
| 临床分离艰难梭菌188株的耐药性研究;黄海辉等;《中国感染与化疗杂志》;20110120;第11卷(第1期);第1-5页 |
| 快速检测粪便中艰难梭菌的方法研究;刘畅等;《国际检验医学杂志》;20121031;第33卷(第20期);第2488-2491页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105368951A (en) | 2016-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Loop-mediated isothermal amplification (LAMP): A novel rapid detection platform for pathogens | |
| Lindberg et al. | Real-time PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering a chimeric C/D sequence—Application on outbreaks of botulism in poultry | |
| CN104328204B (en) | The LAMP detection method of clostridium difficile AB toxin and primer special thereof and test kit | |
| Werner et al. | Comparison of direct cultivation on a selective solid medium, polymerase chain reaction from an enrichment broth, and the BD GeneOhm™ VanR Assay for identification of vancomycin-resistant enterococci in screening specimens | |
| Elsheshtawy et al. | Direct detection of unamplified Aeromonas hydrophila DNA in clinical fish samples using gold nanoparticle probe-based assay | |
| Lu et al. | LAMP-based method for a rapid identification of Legionella spp. and Legionella pneumophila | |
| Dugan et al. | Detection of Bacillus anthracis from spores and cells by loop-mediated isothermal amplification without sample preparation | |
| CN109680056A (en) | A kind of kit, detection method and its application detecting MCR gene | |
| CN104946758A (en) | LAMP detection primer set, detection kit and detection method for candida albicans | |
| Rortana et al. | Antimicrobial resistance and pirAB-like profiles of Vibrio parahaemolyticus in Pacific white shrimp | |
| CN104372099B (en) | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method | |
| CN102230019A (en) | Primer of loop-mediated isothermal amplification (LAMP) for detecting multidrug-resistant cfr gene as well as kit and method for detecting multidrug-resistant cfr gene | |
| Xing et al. | Improvement and evaluation of loop-mediated isothermal amplification combined with chromatographic flow dipstick assays for Vibrio parahaemolyticus | |
| CN105368951B (en) | For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile | |
| Waso et al. | Assessment of predatory bacteria and prey interactions using culture-based methods and EMA-qPCR | |
| CN104328171A (en) | Loop-mediated isothermal amplification primer, kit and method for detecting rat staphylococcus aureus | |
| Shi et al. | WarmStart colorimetric loop-mediated isothermal amplification for the one-tube, contamination-free and visualization detection of Shigella flexneri | |
| CN104561267A (en) | Loop-mediated isothermal amplification reaction primer for detecting streptococcus agalactiae of tilapias | |
| CN104328174B (en) | A kind of detect the LAMP primer of Mus Klebsiella pneumonia, test kit and method | |
| CN107828905A (en) | Tobacco smoke pollution LAMP detection primer and detection method | |
| CN104328206B (en) | The LAMP detection method and its primer special of clostridium difficile binary toxin and test kit | |
| CN105177157B (en) | For detecting the LAMP kit and its primer special of VanB gene | |
| CN109750114A (en) | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production | |
| Dong et al. | A loop-mediated isothermal amplification with a nanoparticle-based lateral flow biosensor assay to detect pseudomonas aeruginosa in endophthalmitis | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |