CN108998535A - A kind of KRAS gene multiple mutation site primer kit - Google Patents
A kind of KRAS gene multiple mutation site primer kit Download PDFInfo
- Publication number
- CN108998535A CN108998535A CN201811056207.5A CN201811056207A CN108998535A CN 108998535 A CN108998535 A CN 108998535A CN 201811056207 A CN201811056207 A CN 201811056207A CN 108998535 A CN108998535 A CN 108998535A
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- kras gene
- mutation
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This application discloses a kind of KRAS gene multiple mutation site primer kits, it includes the primer and probe for hot spot mutations a variety of on KRAS gene, the probe is SEQ ID NO.3 and selected from least one of SEQ ID NO.4-SEQ ID NO.11, or is the reverse complementary sequence of above-mentioned probe sequence；The primer is SEQ ID NO.1 and SEQ ID NO.2.Primer and assist probes are designed as sharing sequence by the present invention, can not only reduce the detection architecture complexity, can also reduce late phase reaction system optimization and the interactional defect of primed probe, increase the practicability of this method while reducing detection reagent cost.
Description
Technical field
The invention belongs to molecular biotechnologies and genetic test field, are specifically related to a kind of KRAS gene multiple mutation position
Point detection kit.
Background technique
KRAS gene is generally acknowledged oncogene, participates in EGFR signal transduction process.Earliest in June, 2008 is swollen in U.S. clinical
Clinical study results are issued in tumor association (ASCO) annual meeting, i.e. KRAS mutation type patient can not obtain from anti-EGFR treatment
Benefit delay treatment and wastes medical expense instead；And KRAS wild type patient just probably benefits from this kind of drug therapy.
" NCCN colorectal cancer clinical practice guideline " explicitly points out two o'clock simultaneously: first is that all metastatic colorectal cancer patients should all detect
KRAS gene appearance, second is that only KRAS wild type patient just suggests receiving EGFR inhibitor that (such as Cetuximab and Pa Ni are mono-
It is anti-) treatment；" NCCN non-small cell lung cancer clinical practice guideline " explicitly points out: KRAS gene mutates, it is not recommended that patient makes
Molecular targeted therapy is carried out with Tarceva (Tarceva/Tarceva/Erlotinib), therefore KRAS gene mutation is examined
Measuring tool has critically important Clinical significance of MG.
Summary of the invention
Based on this, an object of the present invention is to provide 7 kinds of lists of reagent KRAS gene that are a kind of flexible, sensitive and can quantifying
Mutation detection kit only or arranged side by side.
Realize that the technical solution of above-mentioned purpose is as follows.
A kind of KRAS gene multiple mutation site primer kit includes for hot spot mutations a variety of on KRAS exon
Primer and probe, the probe be SEQ ID NO.3 and in SEQ ID NO.4-SEQ ID NO.11 at least one
Kind, or be the reverse complementary sequence of above-mentioned probe sequence；The primer is SEQ ID NO.1 and SEQ ID NO.2.
It is a further object of the present invention to provide KRAS gene multiple mutation probes.
Realize that the technical solution of above-mentioned purpose is as follows.
The probe is SEQ ID NO.3 and at least one of selected from SEQ ID NO.4-SEQ ID NO.11, or
For the reverse complementary sequence of above-mentioned probe sequence.
The present invention has given full play to PCR amplification and nucleic acid intrusion reaction technology advantage, by single amplification and multiple prominent
Become site primer to combine, realize flexible and changeable KRAS gene mutation site primer, concrete principle is: is a pair of by design
PCR primer expands KRAS gene mutation site target area, to expand target region to be checked.Targetedly design one
Assist probes are shared, and separately design the detection probe for each hot spot mutation.It is specific in order to further increase simultaneously,
Specific probe also introduces LNA base, to increase the binding specificity of probe, increases the difference with wild probe.In reaction,
Assist probes, detection probe can hybridize with amplification target template annealing, form a single base overlapping intrusion structure, the structure
It can be identified by Afu enzyme spcificity, to cut the chemical bond of detection probe first base complementary with template, generate signal point
Son.Since the detection probe of design and the Tm value of template bound fraction are close to reaction temperature, new complete detection probe can be again
Secondary and template annealing, forms the cutting of a new round, to realize the amplification of signaling molecule, so realizes to targeted mutagenesis template
Detection.
The invention has the following advantages:
Primer and assist probes are designed as sharing sequence by the present invention, can not only reduce the detection architecture complexity, also
Late phase reaction system optimization and the interactional defect of primed probe can be reduced, the practicability of this method is increased while reducing inspection
Test agent cost.
Present invention design realizes the spirit in KRAS gene mutation site by combining general primer probe and specific probe
Biopsy is surveyed, and both can also pass through list by the detection of a variety of hot spot mutations on multiprobe monomer KRAS gene mutation site
The corresponding hot spot mutation of probe combinations or according to actual needs combine detection.
Method in the present invention, which can also be realized, carries out definite value to clinical sample gene mutation abundance, by the way that different bases are arranged
Because the reference material of mutation percentage makes standard curve, the mutation abundance contained in sample is demarcated by standard curve.
Pattern detection can be completed by means of conventional fluorescent PCR equipment in method in the present invention, and detection sensitivity is far high
In current conventional method, it can be achieved that down in 0.5ng sample size at least 10% even lower gene mutation target molecules detection,
Increase sample size simultaneously and can detecte gene mutation template down to 0.1% to 50ng or more, this is other conventional fluorescents PCR inspection
Survey method is incomparable.
Detailed description of the invention
Following drawings is not used in for illustrating specific embodiments of the present invention and defines this hair that claim is defined
Bright range.
Fig. 1 is the testing principle of Kras gene multiple mutation site primer kit in embodiment 1.
Fig. 2 is the sensitivity of Kras gene multiple mutation site primer kit in embodiment 2.
Fig. 3-Fig. 4 is the various combination probe system verifying knot of Kras gene multiple mutation detection kit in embodiment 3
Fruit.
Fig. 5 is the clinical detection result of Kras gene multiple mutation detection kit in embodiment 4.
Fig. 6 is the quantitative detection result of Kras gene multiple mutation detection kit in embodiment 5.
Fig. 7 is the effect confirmatory experiment result that 7 middle probe of embodiment does LNA modification.
Specific embodiment
Unless otherwise defined, all technical and scientific terms used in the present invention and belong to technical field of the invention
The normally understood meaning of technical staff it is identical.Term used in the description of the invention is intended merely to describe specific reality
The purpose for applying example is not used in the limitation present invention.Term "and/or" used in the present invention includes one or more relevant listed
Any and all combinations of project.
The present invention provides a kind of KRAS gene multiple mutation kit in one of the embodiments, includes for more
The primer and probe of kind hot spot mutation, the probe are SEQ ID NO.3 and in SEQ IDNO.4-SEQ ID NO.11
At least one；The primer is SEQ ID NO.1 and SEQ ID NO.2.
The probe may be the reverse complementary sequence of SEQ ID NO.3 and be selected from one of the embodiments,
The reverse complementary sequence of at least one of SEQ ID NO.4-SEQ ID NO.11.
The present invention is directed to KRAS gene mutation different loci respectively and separately designs for the probe and primer being mutated, for simplification
Reaction system and increase kit applicability, primer and assist probes are designed as to share sequence, mutant probe is designed as fluorescence
Specific probe so can not only reduce KRAS gene mutation not to realize single amplification and multiple mutation site primer
With the difficulty of site primer System Design, late phase reaction system optimization and the interactional defect of primed probe can also be reduced,
Increase the practicability of this method.In addition, this method, which can also be realized, carries out definite value to clinical sample gene mutation abundance, when definite value
The reference material production standard curve of different mutation percentages is set, the mutation abundance contained in sample is demarcated by standard curve.
It can also flexibly be detected simultaneously for this kind design, such as when needing to detect mutational site parting respectively, it is only necessary to will be total to
Use primed probe and the probe of specific mutation type as a kind of combination, without carrying out optimization experimental system again and setting
Meter, this embodies the advantage of this method, provides a kind of flexible selection for the detection of Kras gene-correlation site mutation.
Further, the probe is one kind or two in SEQ ID NO.3 and SEQ ID NO.4-SEQ ID NO.23
Kind or three kinds or four kinds and more kinds of any combination.A kind of detection for sporting site can be thus achieved, it can also be real
The detection arranged side by side in existing a variety of sites.
The probe is SEQ ID NO.3 and SEQ ID NO.4-SEQ IDNO.11 in one of the embodiments,.Institute
Stating every probe in probe SEQ ID NO.5-SEQ ID NO.11 can be modified at least one base by LNA, into one
Step increases specificity.
In a specific embodiment, on the probe SEQ ID NO.4-SEQ ID NO.11 label have and
Quenching group.It is preferred that the fluorophor label, at 5 ' ends, the quenching group label has been held in the 6th base 5 '.
In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition, such as Sambrook etc.
People, molecular cloning: institute in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989)
The condition stated, or according to the normal condition proposed by manufacturer.Used various common chemical reagent, are commercially available in embodiment
Product.
To facilitate the understanding of the present invention, a more comprehensive description of the invention is given in the following sections with reference to the relevant attached drawings.In attached drawing
Give presently preferred embodiments of the present invention.But the invention can be realized in many different forms, however it is not limited to this paper institute
The embodiment of description.On the contrary, purpose of providing these embodiments is keeps the understanding to the disclosure more thorough
Comprehensively.
The testing principle of 1 Kras gene multiple mutation detection kit of embodiment (referring to Fig. 1)
KRAS gene mutation site target area is expanded by designing one couple of PCR primers, to expand target to be checked
Region.A shared assist probes are targetedly designed, and separately design the detection probe for each hot spot mutation, and mark
Remember fluorescence group and quenching group.Specific in order to further increase simultaneously, specific probe also introduces LNA base, to increase
Add the binding specificity of probe, increases the difference with wild probe.In reaction, assist probes, detection probe can be with amplification targets
Template annealing hybridization is marked, forms a single base overlapping intrusion structure, which can be identified by Afu enzyme spcificity, to cut
The chemical bond of detection probe first base complementary with template generates signaling molecule.Due to the detection probe and template knot of design
The Tm value of part is closed close to reaction temperature, new complete detection probe can form the cutting of a new round again with template annealing,
To realize the amplification of signaling molecule, the detection to targeted mutagenesis template is so realized.
By taking hot spot mutation in table 1 as an example, the Kras gene multiple mutation detection kit includes 2 primers, 9 spies
Needle, reaction solution, amplification enzyme, restriction endonuclease etc., the restriction endonuclease are Afu enzyme, and the amplification enzyme is Taq archaeal dna polymerase.
The common Kras hotspot mutation type of table 1.
| Position(AA) | Mutation(CDS) | Mutation(COSM) | Mutation Type |
| 34 | c.34G>A | COSM517 | Substitution |
| 34 | c.34G>C | COSM518 | Substitution |
| 34 | c.34G>T | COSM516 | Substitution |
| 35 | c.35G>A | COSM521 | Substitution |
| 35 | c.35G>C | COSM522 | Substitution |
| 35 | c.35G>T | COSM520 | Substitution |
| 38 | c.38G>A | COSM532 | Substitution |
Primer, probe sequence such as primer 1- primer 2, probe 1- probe 9, or be the complementary series of above-mentioned sequence: 5 ' ends are arrived
3 ' ends:
Primer 1:AGTCACATTTTCATTATTTTTATTATAAGGCCTGCT, SEQ ID NO.1；
Primer 2: TCGTCCACAAAATGATTCTGAATTAGCTGTATCG, SEQ ID NO.2；
Probe 1:TAA ACT TGT GGT AGT TGG AGC TT, SEQ ID NO.3；
Probe 2:VIC-CG GGT (BHQ) GGCGTAGGCAA, SEQ ID NO.4；
Probe 3:FAM-AG AGTG (BHQ) GCGTAGG, SEQ ID NO.5；
Probe 4:FAM-AG CGTG (BHQ) GCGTAGG, SEQ ID NO.6；
Probe 5:FAM-AG TGTG (BHQ) GCGTAGG, SEQ ID NO.7；
Probe 6:FAM-AG GATG (BHQ) GCGTAGG, SEQ ID NO.8；
Probe 7:FAM-AG GCTG (BHQ) GCGTAGG, SEQ ID NO.9；
Probe 8:FAM-AG GTTG (BHQ) GCGTAGG, SEQ ID NO.10；
Probe 9:FAM-AG GGTG (BHQ) ACGTAGG, SEQ ID NO.11；
Note: italic font is LNA modification, and runic is position corresponding to corresponding hot spot mutation.
The sensitivity of 2 Kras gene multiple mutation detection kit of embodiment
The present embodiment has detected various concentration and gene mutation using the Kras gene multiple mutation detection kit
The KRAS gene mutation DNA profiling of percentage, for verifying the sensitivity of kit of the present invention, with detected hot spot mutation
C.34G sensitivity verifying is carried out for > A.
Reaction condition:
40 μ L amplification systems include: on 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/LPCR
Downstream primer and probe (SEQ ID NO.1 to SEQ ID NO.11), 3U Taq archaeal dna polymerase, 60U Afu enzyme and template
DNA.By detected hot spot mutation c.34G > A for, the template of addition is the reagent that concentration is determined by ultraviolet specrophotometer
Box reference material, mutation percentage are mixed by determining correspondence mutant plasmids and human gene group DNA referring to copy number ratio respectively
It forms；Kit reference material genomic DNA matrix is added and is respectively as follows: 200ng, 50ng, 10ng and 2.5ng, mutated gene hundred
Dividing than (mutant DNA and wild type DNA ratio) is respectively 50%, 10%, 1%, 0.1% and 0%, and water is added to be supplemented to 40 μ L.
Amplified reaction program: 95 DEG C, 1min；95 DEG C of 5s, 72 DEG C, 20s, 10 circulations of pre- amplification；95 DEG C of 5s, 62 DEG C, 30s, 68 DEG C,
10s, expands 30 circulations, and each circulation terminates to read first order fluorescence signal.
As a result shown in Figure 2, as the result is shown under not same amount genome matrix, Kras gene multiple mutation detection kit
Minimum gene mutation percentage that can be detected difference, in 10-250ng, the minimum detectable gene down to 0.1% is prominent
Become；When down to 2ng, the gene mutation down to 1% can be detected and signal still can achieve bracket signal intensity at this time, shown
The kit has very high detection sensitivity.
The various combination probe system verification result of 3 Kras gene multiple mutation detection kit of embodiment
The present embodiment is that verifying Kras gene multiple mutation detection kit can detect specific Kras gene with flexible combination
Mutational site is combined shown in the table 2 for hot mutant site respectively, verify under quadruple system condition as a result, simultaneously
Substance detection is separately verified with the detection accuracy of determination kit of the present invention.
For the flexibility and accuracy for preferably verifying kit detection of the present invention, it is with hot mutant site shown in table 2
Example, quadruple mutant probe system detects corresponding four target templates respectively, while preparing the detection architecture of each hot spot mutation,
Detect corresponding single target template.
Reaction condition:
40 μ L amplification systems include: on 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/LPCR
Downstream primer and probe (SEQ ID NO.1 to SEQ ID NO.8；Or SEQ ID NO.1 to SEQ ID NO.5；Or SEQ ID
NO.1 to SEQ ID NO.4, SEQ ID NO.6；Or SEQ ID NO.1 to SEQ ID NO.4, SEQ ID NO.7；Or SEQ ID
NO.1 to SEQ ID NO.4, SEQ ID NO.8), 3U Taq archaeal dna polymerase, 60U Afu enzyme and template DNA.The template of addition
For the kit reference material for determining concentration by ultraviolet specrophotometer, percentage is mutated respectively by determining correspondence saltant type matter
Grain and human gene group DNA mix referring to copy number ratio；The kit reference material matrix of addition is 10ng, gene mutation
Percentage is respectively 0.1% and 0%, and water is added to be supplemented to 40 μ L amplified reaction programs: 95 DEG C, 1min；95 DEG C of 5s, 72 DEG C, 20s,
10 circulations of pre- amplification；95 DEG C of 5s, expand 30 circulations by 62 DEG C, 30s, 68 DEG C, 10s, and each circulation terminates to read first order fluorescence letter
Number.
Table 2. combines Kras hotspot mutation type
| Position(AA) | Mutation(CDS) | Mutation(COSM) | Mutation Type |
| 34 | c.34G>A | COSM517 | Substitution |
| 34 | c.34G>C | COSM518 | Substitution |
| 35 | c.35G>A | COSM521 | Substitution |
| 38 | c.38G>A | COSM532 | Substitution |
As a result it is shown in Fig. 3 and Fig. 4, when not changing 4 re-detection of combination of system other conditions, result and 4 kinds of substances
System testing result is consistent, can detect 0.1% gene mutation percentage in the case where templet gene group matrix is 10ng.
The clinical detection result of 4 Kras gene multiple mutation detection kit of embodiment
The present embodiment is that Kras gene multiple mutation detection kit detects 4 colorectal cancer patients paraffin-embedded tissue samples
DNA (the EGFR genetic mutation result of its sample confirms through clinical detection reagent).
Reaction condition:
40 μ L amplification systems include: on 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/LPCR
Downstream primer and probe (SEQ ID NO.1 to SEQ ID NO.11), 3U Taq archaeal dna polymerase, 60U Afu enzyme and template
DNA is added the genomic DNA that corresponding clinical sample extracts, and water is added to be supplemented to 40 μ L.Amplified reaction program: 95 DEG C,
1min；95 DEG C of 5s, 72 DEG C, 20s, 10 circulations of pre- amplification；95 DEG C of 5s, expand 30 circulations, often by 62 DEG C, 30s, 68 DEG C, 10s
A circulation terminates to read first order fluorescence signal.
According to Fig. 5 as a result, wild type (VIC) signal is internal standard signal, indicate whether entire reaction process is normal；Saltant type
(FAM) signal is jump signal, whether contains mutagenesis template in Indicator Reaction template.As a result the wild type of middle sample 1- sample 4
Signal is normal, illustrates that detection process is effective；2 sample (sample 2 and sample 3) mutant signals lift and remaining 2 samples
This (sample 1 and sample 4) no signal is lifted, and illustrates there is 2 positives, 2 feminine genders, this detection knot in 4 pattern detection results
Fruit is consistent with clinical effectiveness.These results suggest that kit of the present invention can be used in the accurate detection of clinical sample DNA.
The quantitative performance of 5 Kras gene multiple mutation detection kit of embodiment
The present embodiment detects reference material sample to be verified using the Kras gene multiple mutation detection kit and (mixes
Close gene mutation percentage be 1%), and using different genes be mutated percentage (mutant DNA and wild type DNA ratio) gradient
Qualitative reference product do standard curve its testing result quantified, to confirm the quantitative detection of kit of the present invention
Ability.
Reaction condition:
40 μ L amplification systems include: on 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/LPCR
Downstream primer and probe (SEQ ID NO.1 to SEQ ID NO.11), 5U Taq archaeal dna polymerase, 60U Afu enzyme and detection mould
Plate (10ng/ μ L), be added clinical sample genomic DNA and a group reagent box qualitative reference product (respectively 5%, 1%, 0.2%,
0.04%), and water is added to be supplemented to 40 μ L.Amplified reaction program: 95 DEG C, 1min；95 DEG C of 5s, 72 DEG C, 20s, pre- amplification 10 follows
Ring；95 DEG C of 5s, expand 30 circulations by 62 DEG C, 30s, 68 DEG C, 10s, and each circulation terminates to read first order fluorescence signal.
According to as a result, using using detection kit of the present invention detection definite value reference material result as shown in table 3 and Fig. 6,
It is analyzed by calculating, R2Reach 0.98, the mutant proportion definite value result of sample DNA to be detected is 1.02%, and with theoretical value 1%
Height is consistent, and the accurate definite value to gene mutation percentage in sample may be implemented in this display this method.
3 reference material definite value pattern detection result of table
| Content | It is mutated percentage | Delta Ct |
| Reference material 1 | 10% | 1.2 |
| Reference material 2 | 2% | 3.6 |
| Reference material 3 | 0.5% | 6.9 |
| Reference material 4 | 0.1% | 12.1 |
| Sample to be examined | ? | 4.1 |
6 probe of embodiment does the effect confirmatory experiment result of LNA modification
The present embodiment is different in the probe in detecting of different location with and without the LNA probe modified and LNA modification by comparison
Gene mutation percent effect further verifies inspection of the present invention to verify the function and effect of specific LNA modification in probe
The advantage and creativeness of survey method.
Reaction condition:
40 μ L amplification systems include: on 4 μ L 10 × buffer, 200-500 μm of ol/L dNTP, 200-500nmol/LPCR
(experimental group and probe in 3 groups of control groups and primer sequence are SEQ ID NO.1 to SEQ ID for downstream primer and probe
NO.11, wherein control group middle probe and the difference in experimental group are whether there is or not the quantity of LNA modification and LNA modification is different, such as implementation
Shown in example 1, the probe in no LNA probe group is the probe system without containing LNA modification, and the probe of LNA1 group is to be mutated
LNA is modified at base, the probe of LNA2 group is at mutating alkali yl and 3 ' hold the 3rd base modification LNA；The probe of LNA3 group
Be at mutating alkali yl and 3 ' end the 2nd, 3 base modification LNA), 3U Taq archaeal dna polymerase, 60U Afu enzyme, be added correspond to
Kit reference material template, percentage is 50%, 10%, 1%, 0.1% and 0% respectively (mutation percentage is respectively by true
The correspondence mutant plasmids and human gene group DNA for determining concentration are mixed referring to copy number ratio), and water is added to be supplemented to 40 μ L.
Amplified reaction program: 95 DEG C, 1min；95 DEG C of 5s, 72 DEG C, 20s, 10 circulations of pre- amplification；95 DEG C of 5s, 62 DEG C, 30s, 68 DEG C,
10s, expands 30 circulations, and each circulation terminates to read first order fluorescence signal.
According to Fig. 7 as a result, the Kras gene multiple mutation detection kit in no LNA modification probe is only able to detect 1%
Sample, and modified LNA probe 1 combination, probe 2 combination and 3 groups of probe be combined into reaction systems detection mutation percentages
The ability of ratio greatly improves, 3 groups of middle probe be combined into reaction system signal enhancing while background also dramatically increase, and
The combination of probe 1, then background increase is not significant for 2 groups of reaction systems being combined into of probe, and can detecte the sample down to 0.1%
This, it should be noted that modify the ability of the combination of probe 2 (LNA probe i.e. of the invention finally determined) detection 0.1% of LNA
The probe 1 for better than having modified LNA combines, and shows that LNA modification can make to detect 10 times or so of atopic raising, and this hair
The bright selected LNA modification of middle probe is best.
Each technical characteristic of embodiment described above can be combined arbitrarily, for simplicity of description, not to above-mentioned reality
It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited
In contradiction, all should be considered as described in this specification.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art
It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to protection of the invention
Range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Sequence table
<110>Guangzhou Bao Chuan Bioisystech Co., Ltd
<120>a kind of kras gene multiple mutation site primer kit
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
agtcacattt tcattatttt tattataagg cctgct 36
<210> 2
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tcgtccacaa aatgattctg aattagctgt atcg 34
<210> 3
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
taaacttgtg gtagttggag ctt 23
<210> 4
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgggtggcgt aggcaa 16
<210> 5
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
agagtggcgt agg 13
<210> 6
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
agcgtggcgt agg 13
<210> 7
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
agtgtggcgt agg 13
<210> 8
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
aggatggcgt agg 13
<210> 9
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
aggctggcgt agg 13
<210> 10
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
aggttggcgt agg 13
<210> 11
<211> 13
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
agggtgacgt agg 13
Claims (10)
1. a kind of KRAS gene multiple mutation site primer kit, which is characterized in that include for a variety of heat of KRAS gene
The primer and probe of point mutation, the probe are SEQ ID NO.3 and in SEQ ID NO.4-SEQ ID NO.11
At least one, or the reverse complementary sequence for above-mentioned probe sequence；
The primer is SEQ ID NO.1 and SEQ ID NO.2.
2. KRAS gene multiple mutation site primer kit according to claim 1, which is characterized in that the probe is
SEQ ID NO.3 and SEQ ID NO.4-SEQ ID NO.11.
3. -2 described in any item KRAS gene multiple mutation site primer kits according to claim 1, which is characterized in that institute
Stating on probe SEQ ID NO.4-SEQ ID NO.11 label has and quenching group.
4. KRAS gene multiple mutation site primer kit according to claim 3, which is characterized in that the fluorescent base
Group's label has been held in the 6th base in 5 ' ends, the quenching group label 5 '.
5. KRAS gene multiple mutation site primer kit according to claim 1-3, which is characterized in that institute
Stating every probe in probe SEQ ID NO.5-SEQ ID NO.11, there are two bases by LNA modification.
6. KRAS gene multiple mutation site primer kit according to claim 5, which is characterized in that the probe
SEQ ID NO.5-SEQ ID NO.11 is as follows:
AG AGTGGCGTAGG；
AG CGTGGCGTAGG；
AG TGTGGCGTAGG；
AG GATGGCGTAGG；
AG GCTGGCGTAGG；
AG GTTGGCGTAGG；
AG GGTGACGTAGG, wherein italicized bases are LNA modification.
7. a kind of probe of Multiple detection KRAS gene multiple mutation, which is characterized in that the probe be SEQ ID NO.3 and
It selected from least one of SEQ ID NO.4-SEQ ID NO.11, or is the reverse complementary sequence of above-mentioned probe sequence.
8. the probe of Multiple detection KRAS gene multiple mutation according to claim 7, which is characterized in that the probe is
SEQ ID NO.3 and at least one of selected from SEQ ID NO.4-SEQ ID NO.11.
9. the probe of Multiple detection KRAS gene multiple mutation according to claim 8, which is characterized in that the probe is
SEQ ID NO.3 and SEQ ID NO.4-SEQ ID NO.11.
10. according to the probe for the Multiple detection KRAS gene multiple mutation that claim 9 is stated, which is characterized in that the probe SEQ
ID NO.5-SEQ ID NO.11 is as follows:
AG AGTGGCGTAGG；
AG CGTGGCGTAGG；
AG TGTGGCGTAGG；
AG GATGGCGTAGG；
AG GCTGGCGTAGG；
AG GTTGGCGTAGG；
AG GGTGACGTAGG, wherein italicized bases are LNA modification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811056207.5A CN108998535B (en) | 2018-09-11 | 2018-09-11 | KRAS gene multiple mutation site detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811056207.5A CN108998535B (en) | 2018-09-11 | 2018-09-11 | KRAS gene multiple mutation site detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108998535A true CN108998535A (en) | 2018-12-14 |
| CN108998535B CN108998535B (en) | 2021-09-10 |
Family
ID=64591500
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811056207.5A Active CN108998535B (en) | 2018-09-11 | 2018-09-11 | KRAS gene multiple mutation site detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108998535B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110835644A (en) * | 2019-12-16 | 2020-02-25 | 广州市宝创生物技术有限公司 | K-ras gene mutation site detection kit |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100105575A1 (en) * | 2008-10-23 | 2010-04-29 | Wendy Wang | Single nucleotide polymorphism genotyping detection via the real-time invader assay microarray platform |
| CN102827922A (en) * | 2011-06-16 | 2012-12-19 | 华东医学生物技术研究所 | Cascade intrusion signal amplification reaction combined nanogold-oligonucleotide probe visual nucleic acid detection method |
| US20130231256A1 (en) * | 2011-10-18 | 2013-09-05 | Rebecca Oldham-Haltom | Multiplexed kras mutation detection assay |
| CN105074009A (en) * | 2013-03-19 | 2015-11-18 | 凸版印刷株式会社 | Method for predicting sensitivity to egfr inhibitor |
| CN105463076A (en) * | 2010-11-15 | 2016-04-06 | 精密科学公司 | Mutation detection assay |
| WO2016103727A1 (en) * | 2014-12-25 | 2016-06-30 | 凸版印刷株式会社 | Method for promoting amplification of specific nucleic acid sequence |
| CN107002145A (en) * | 2014-10-08 | 2017-08-01 | 康奈尔大学 | Method for use for leaving combination nuclease, coupled reaction and polymeric enzyme reaction identification and the expression of relative quantification nucleotide sequence, splice variant, transposition, copy number or the change that methylates of prevention |
-
2018
- 2018-09-11 CN CN201811056207.5A patent/CN108998535B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100105575A1 (en) * | 2008-10-23 | 2010-04-29 | Wendy Wang | Single nucleotide polymorphism genotyping detection via the real-time invader assay microarray platform |
| CN105463076A (en) * | 2010-11-15 | 2016-04-06 | 精密科学公司 | Mutation detection assay |
| CN102827922A (en) * | 2011-06-16 | 2012-12-19 | 华东医学生物技术研究所 | Cascade intrusion signal amplification reaction combined nanogold-oligonucleotide probe visual nucleic acid detection method |
| US20130231256A1 (en) * | 2011-10-18 | 2013-09-05 | Rebecca Oldham-Haltom | Multiplexed kras mutation detection assay |
| CN105074009A (en) * | 2013-03-19 | 2015-11-18 | 凸版印刷株式会社 | Method for predicting sensitivity to egfr inhibitor |
| CN107002145A (en) * | 2014-10-08 | 2017-08-01 | 康奈尔大学 | Method for use for leaving combination nuclease, coupled reaction and polymeric enzyme reaction identification and the expression of relative quantification nucleotide sequence, splice variant, transposition, copy number or the change that methylates of prevention |
| WO2016103727A1 (en) * | 2014-12-25 | 2016-06-30 | 凸版印刷株式会社 | Method for promoting amplification of specific nucleic acid sequence |
Non-Patent Citations (4)
| Title |
|---|
| GEORGE M. YOUSEF等: "《Molecular Testing in Cancer》", 31 December 2014, SPRINGER * |
| GUNTER MAYER: "《The Chemical of Nucleic Acids》", 31 December 2010, WILEY * |
| MICHAEL OLIVER: "The Invader assay for SNP genotyping", 《MUTAT RES.》 * |
| TAKESHI YAMADA等: "Utility of KRAS mutation detection using circulating cell‐free DNA from patients with colorectal cancer", 《CANCER SCI.》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110835644A (en) * | 2019-12-16 | 2020-02-25 | 广州市宝创生物技术有限公司 | K-ras gene mutation site detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108998535B (en) | 2021-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Soulières et al. | KRAS mutation testing in the treatment of metastatic colorectal cancer with anti-EGFR therapies | |
| CN104520442B (en) | Quantitative multiplex methylation status of PTEN promoter method-cMethDNA, reagent and application thereof | |
| CN104805208B (en) | For detecting the primer combination of probe thing, kit and detection method of 7 kinds of hot spot mutations of mankind KRAS genes | |
| CN107447013B (en) | Method for detecting mutation sites of codons 12 and 13 of Kras gene and kit thereof | |
| CN108676872B (en) | One kind biomarker relevant to asthma and its application | |
| CN110438223A (en) | Detect primer, probe and its kit and detection method of Kras point mutation | |
| US20200172983A1 (en) | Egfr assay | |
| CN114277151A (en) | Method and kit for detecting MET gene 14 exon skipping mutation by one-step method | |
| CN104818340B (en) | Detect primer, kit and its PCR method of JAK2 gene V617F loci polymorphisms | |
| CN108998535A (en) | A kind of KRAS gene multiple mutation site primer kit | |
| Oh et al. | A digital PCR-based protocol to detect and quantify RNA editing events at hotspots | |
| CN109112189A (en) | The a variety of hot spot mutation kits of 19 exon of Multiple detection EGFR gene | |
| WO2023105295A2 (en) | Urine mirna marker for renal cancer diagnosis, diagnostic reagent and kit | |
| KR101371697B1 (en) | Patient-Tailored Cancer Chemotherapy | |
| CN108192977A (en) | A kind of and relevant molecular marker of gastric cancer occurrence and development | |
| CN108531598A (en) | ROS1 Gene Fusions detection primer, method and kit | |
| CN113122629B (en) | Primer and probe for hairpin amplification blocking method for gene mutation detection and application thereof | |
| CN109652539A (en) | A kind of kit detected for EGFR T790M site mutation | |
| CN110964830A (en) | Kit and method for multiple detection of ROS1 gene mutation | |
| CN106544401A (en) | The kit of detection human EGFR gene mutations | |
| CN110373467A (en) | A kind of detection reagent and detection method of human EGFR gene mutations site T790M | |
| CN110904202A (en) | Kit for detecting KRAS gene mutation | |
| CN108220481A (en) | For detecting congo fever virus, three kinds of viral nucleic acid of library wave fever virus 1 and 2 types, kit and method simultaneously | |
| CN114959034B (en) | Application of lenvatinib drug sensitive marker and related reagent thereof | |
| CN115807092B (en) | Primer, probe and kit for detecting jump mutation of MET gene No. 14 exon |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |