KR101371697B1 - Patient-Tailored Cancer Chemotherapy - Google Patents

Abstract

The present invention comprises the steps of (a) obtaining a biological sample from the cancer patient; (b) ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERα, ERβ, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART ( GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c-RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXRβ Measuring expression levels of at least two targets selected from the group consisting of, RXRγ, B-RAF, SRC, TARC1 (NK1R), TLR7, TOP1, TOP2A, TYMS and YES1; And (c) selecting a drug that acts on the target determined to be highly expressed in step (b). According to the present invention, it is possible to select a medicine suitable for a specific cancer patient through which a personalized chemotherapy for each cancer patient can be performed very effectively.

Description

Patient-Tailored Cancer Chemotherapy

The present invention relates to a method for screening a customized medicine for cancer patients and a kit used therein.

There are approximately 220 types of cancer drugs that are already used in the clinic, licensed by the US Food and Drug Administration. Many of these anticancer agents have no known molecular targets or have no specificity even if the molecular targets are known. However, about 48 anticancer drugs target specific molecular targets, and their biological mechanisms in cancer are also somewhat elucidated.

On the other hand, according to conventional chemotherapy (cancer chemotherapy), the appropriate anticancer agent is selected and administered according to the type of cancer and the severity of the cancer, not individual cancer patients. However, the general clinical results vary greatly depending on the patient's chemotherapy, and various methods have been suggested to overcome this. In order to overcome the shortcomings of the above-described chemotherapy, many attempts have been made to analyze individual single nucleotide polymorphisms (SNPs) and select appropriate anticancer drugs accordingly.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The inventors of the present invention have tried to develop a method for more effectively performing chemotherapy of cancer patients, and as a result, the above-described 48 targets are expressed in different forms for each cancer patient. The present invention has been completed by confirming that the administration of cancer patients by the administration of anticancer agents tailored to cancer patients can be more effective.

Accordingly, an object of the present invention is to provide a method for screening medicines for cancer patients.

Another object of the present invention is to provide a kit for screening medicines for cancer patients.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a cancer patient-specific drug selection method comprising the following steps:

(a) obtaining a biological sample from the cancer patient;

(b) ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERα, ERβ, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART ( GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c-RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXRβ Measuring expression levels of at least two targets selected from the group consisting of, RXRγ, B-RAF, SRC, TARC1 (NK1R), TLR7, TOP1, TOP2A, TYMS and YES1; And

(c) selecting a drug that acts on the target determined to be highly expressed in step (b).

According to another aspect of the present invention, the present invention provides a combination of (a) ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERα, ERβ, ERBB2 (HER2), FLT1, FLT3 , FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c-RAF), RET, RRM1, Primer or hybridization specifically hybridizing to each of at least two target genes selected from the group consisting of RRM2, RRM2B, RXRα, RXRβ, RXRγ, B-RAF, SRC, TARC1 (NK1R), TLR7, TOP1, TOP2A, TYMS and YES1 Probes; Or (b) ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERα, ERβ, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c-RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXRβ, RXRγ, B-RAF, SRC, TARC1 (NK1R), TLR7 Provided is a kit for screening a customized medicine for cancer patients comprising an antibody or antigenic determinant thereof that specifically binds to a protein of at least two targets selected from the group consisting of TOP1, TOP2A, TYMS and YES1.

The inventors of the present invention have tried to develop a method for more effectively performing chemotherapy of cancer patients, and as a result, the above-described 48 targets are expressed in different forms for each cancer patient. It was confirmed that the administration of cancer can be more effectively treated by administration of anticancer drugs tailored to cancer patients.

According to the method of the present invention, a biological sample is first obtained from a cancer patient. Cancers to which the present invention can be applied include various solid and hematological cancers, for example, gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, colon cancer, cervical cancer , Brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, thyroid cancer, parathyroid cancer and ureter cancer.

Biological samples that can be used in the present invention include various biological samples, preferably blood, serum, plasma, tissue, cells, lymph, bone marrow fluid, saliva, urine, feces, ocular fluid, semen, brain extract, spinal fluid, Joint fluid, thymic fluid, ascites or amniotic fluid, more preferably tissue or cell, most preferably cancer tissue or cancer cell.

Targets for analyzing expression levels in the present invention are ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERα, ERβ, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN , GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c-RAF), RET, RRM1, RRM2, RRM2B, At least two targets selected from the group consisting of RXRα, RXRβ, RXRγ, B-RAF, SRC, TARC1 (NK1R), TLR7, TOP1, TOP2A, TYMS and YES1, preferably at least 5 targets, more preferably minimum 10 targets, even more preferably at least 20 targets, even more preferably at least 30 targets, most preferably at least 40 targets.

According to a preferred embodiment of the invention, the expression level measurement of the target is carried out according to a gene hybridization method, a gene amplification method or an immunoassay method.

The present invention can be carried out in an immunoassay mode, ie, antigen-antibody response mode. In this case, the antibody or antigenic determinant thereof specifically binds to the target protein of the present invention.

The antibody used in the present invention is a polyclonal or monoclonal antibody, preferably a monoclonal antibody. Antibodies can be prepared by methods routinely practiced in the art, for example, the fusion method (Kohler and Milstein, European Journal of (Clackson et al., Nature , 352: 624-628 (1991) and Marks et al., J. Immunology , 6: 511-519 (1976)), recombinant DNA methods (US Pat. No. 4,816,56) or phage antibody library methods . Mol Biol, 222:.. 58, can be prepared by 1-597 (1991)). General procedures for antibody preparation are described in Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; And Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley / Greene, NY, 1991, the disclosures of which are incorporated herein by reference. For example, the preparation of hybridoma cells producing monoclonal antibodies is accomplished by fusing an immortalized cell line with an antibody-producing lymphocyte, and the techniques necessary for this process are well known and readily practicable by those skilled in the art. Polyclonal antibodies can be obtained by injecting a protein antigen into a suitable animal, collecting the antiserum from the animal, and then separating the antibody from the antiserum using a known affinity technique.

When the method of the present invention is carried out using an antibody, the present invention can be carried out according to a conventional immunoassay method.

Such immunoassays can be performed according to various quantitative or qualitative immunoassay protocols developed in the past. The immunoassay format includes radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, ELISA (enzyme-linked immunosorbant assay), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, protein chip, flow cytometry. ), But is not limited to immunofluorescence staining and immunoaffinity purification. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.

For example, when the method of the present invention is carried out in accordance with radioimmunoassay methods, antibodies labeled with radioisotopes (eg, C ₁₄ , I ₁₂₅ , P ₃₂ and S ₃₅ ) may be used to determine the expression level of the target of the present invention. Can be used to detect.

When the method of the present invention is carried out by an ELISA method, a specific embodiment of the present invention comprises the steps of (i) coating the surface of a solid substrate with an unknown cell sample lysate to be analyzed; (Ii) reacting said cell lysate with an antibody to a target as a primary antibody; (Iii) reacting the result of step (ii) with an enzyme-conjugated secondary antibody; And (iv) measuring the activity of the enzyme.

Suitable as said solid substrate are hydrocarbon polymers (e.g., polystyrene and polypropylene), glass, metal or gel, and most preferably microtiter plates.

The enzyme bound to the secondary antibody may include an enzyme catalyzing a chromogenic reaction, a fluorescence reaction, a luminescent reaction, or an infrared reaction, but is not limited thereto. For example, an alkaline phosphatase,? -Galactosidase, Radish peroxidase, luciferase, and cytochrome P450. In the case where alkaline phosphatase is used as an enzyme binding to the secondary antibody, it is preferable that the substrate is selected from the group consisting of bromochloroindole phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS -Bl-phosphate and ECF (enhanced chemifluorescence) are used. When horseradish peroxidase is used, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (n-butyllithium), tetramethylbenzidine, ABTS (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronin, glucose oxidase and nitroblue tetrazolium a substrate such as phenzaine methosulfate It can be.

When the method of the invention is carried out in a capture-ELISA mode, certain embodiments of the invention comprise the steps of: (i) coating an antibody against a target of the invention as a capturing antibody on the surface of a solid substrate; (Ii) reacting the capture antibody with the sample; (Iii) reacting the result of step (ii) with a detecting antibody having a label that generates a signal and which specifically reacts with the target; And (iv) measuring a signal originating from said label.

The detection antibody carries a label which generates a detectable signal. These labels include chemical (e.g., biotin), enzymes (alkaline phosphatase, beta -galactosidase, horseradish peroxidase and cytochrome P450), radioactive materials (e.g., C14, I125, P32, and S35) , Fluorescent materials (e.g., fluorescein), luminescent materials, chemiluminescent materials and fluorescence resonance energy transfer (FRET). Various labels and labeling methods are described in Ed. Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.

Measurement of the final enzyme activity or signal in the ELISA method and the capture-ELISA method can be carried out according to various methods known in the art. The detection of such signals enables a qualitative or quantitative analysis of the target of the present invention. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal.

By analyzing the intensity of the final signal by the above-described immunoassay process, the expression level of the target can be measured.

According to a preferred embodiment of the present invention, step (b) in the present invention can be carried out according to a gene hybridization method or a gene amplification method. In the case of the gene hybridization method, a probe, and in the case of the gene amplification method, a primer or a primer and a probe are used.

Probes or primers used in the present invention have a sequence complementary to the nucleotide sequence of the target molecule. The term " complementary " as used herein means having complementarity enough to selectively hybridize to the nucleotide sequences described above under any particular hybridization or annealing conditions. Thus, the term “complementary” has a meaning different from that of the term perfectly complementary, and the primer or probe used in the present invention may be capable of selectively hybridizing to the above-described nucleotide sequence, so long as it has one or more misses. It can have a mismatch sequence.

As used herein, the term " primer " refers to a primer that, under suitable conditions (i.e., four different nucleoside triphosphates and polymerization enzymes) in a suitable buffer at a suitable temperature, - means strand oligonucleotide. The suitable length of the primer is typically 15-30 nucleotides, although it varies with various factors such as temperature and use of the primer. Short primer molecules generally require lower temperatures to form hybrid complexes that are sufficiently stable with the template.

The sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient if the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer in the present invention does not need to have a perfectly complementary sequence to the above-mentioned nucleotide sequence, which is a template, and it is sufficient that the primer has sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer. The design of such a primer can be easily carried out by a person skilled in the art with reference to the above-mentioned nucleotide sequence, for example, by using a program for primer design (for example, PRIMER 3 program).

As used herein, the term “probe” refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides, and can specifically hybridize to a target nucleotide sequence, naturally Present or artificially synthesized. The probe of the present invention is preferably a single strand, and is an oligodioxyribonucleotide.

The nucleotide sequence of the target of the present invention, which should be referenced when preparing a primer or probe, can be found in GenBank, and the primer or probe can be designed with reference to this sequence.

In the case of using the probe in the present invention, a microarray can be prepared and kitted. In the microarray of the present invention, the probe is used as a hybridizable array element and immobilized on a substrate. Preferred gases include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports. Said hybridization array element is arranged and immobilized on said gas. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bound by UV on a polylysine coating surface. In addition, the hybridization array element may be coupled to the gas through a linker (e.g., ethylene glycol oligomer and diamine).

On the other hand, the sample DNA applied to the microarray of the present invention can be labeled and hybridized with array elements on the microarray. Hybridization conditions can be varied. The detection and analysis of the hybridization degree can be variously carried out according to the labeling substance.

The present invention can be practiced based on hybridization. In this case, a probe having a sequence complementary to the nucleotide sequence of the target of the present invention described above is used.

The label of the probe may provide a signal to detect hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorophores (eg, fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia), chromophores, chemilumines, magnetic particles, radioisotopes Elements (P32 and S35), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg gold) and antibodies, streptavidin, biotin And hapten with specific binding partners such as digoxigenin and chelating groups. Markers can be obtained by a variety of methods routinely practiced in the art, such as the nick translation method, the Multiprime DNA labeling systems booklet ("Amersham" (1989)) and the kaination method (Maxam & Gilbert, Methods in Enzymology , 65: 499 (1986)). The label provides signals that can be detected by fluorescence, radioactivity, colorimetry, weighing, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, and nanocrystals.

The nucleic acid sample to be analyzed can be prepared using mRNA obtained from various biological samples, and preferably, can be prepared using mRNA obtained from cancer tissue cells. Instead of the probe, the cDNA to be analyzed may be labeled and subjected to a hybridization reaction-based analysis.

When a probe is used, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. The detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc .; NY (1999). For example, high stringency conditions were hybridized at 65 ° C in 0.5 M NaHPO ₄ , 7% SDS (sodium dodecyl sulfate) and 1 mM EDTA, followed by addition of 0.1 x SSC / 0.1% SDS Lt; RTI ID = 0.0 > 68 C < / RTI > Alternatively, high stringency conditions means washing at < RTI ID = 0.0 > 48 C < / RTI > in 6 x SSC / 0.05% sodium pyrophosphate. Low stringency conditions mean, for example, washing in 0.2 x SSC / 0.1% SDS at 42 ° C.

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be carried out in various ways depending on, for example, the type of label attached to the probe. For example, when a probe is labeled with an enzyme, the substrate of the enzyme can be reacted with the result of hybridization reaction to confirm hybridization. Combinations of enzymes / substrates that can be used include peroxidase (eg horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium Nitrate), resoruppin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2 , 2'-Azine-di [3-ethyl benzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronine; (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate, and ECF substrate; alkaline phosphatase and bromochloroindoleyl phosphate; Glucose oxidase, t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate. Therefore, when the method for detecting the target molecule of the present invention is carried out on the basis of hybridization, specifically, (i) hybridizing a probe having a sequence complementary to the nucleotide sequence of the target molecule of the present invention to a nucleic acid sample; (ii) detecting whether the hybridization reaction has occurred.

According to a more preferred embodiment of the invention, the invention is carried out according to a gene amplification method, most preferably according to a quantitative real time gene amplification method.

The term " amplification " as used herein refers to a reaction that amplifies a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 17,18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA, WO 88/10315) (SEQ ID NO: 1), self-sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction CP-PCR), U.S. Patent No. 4,437,975) (AP-PCR), U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA), U.S. Patent No. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (21,22), and loop-mediated isothermal amplification. (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse polymerase) chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications. For more information on PCR see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

When the present invention is used as a primer, gene amplification reactions are performed to examine the expression level of the nucleotide sequence of the target of the present invention. Since the present invention analyzes the expression level of the nucleotide sequence of the target of the present invention, the expression level of the nucleotide sequence of the target of the present invention is determined by examining the mRNA amount of the nucleotide sequence of the target of the present invention in the sample to be analyzed. .

Therefore, in principle, the present invention uses a mRNA in a sample as a template and performs a gene amplification reaction using a primer that binds to mRNA or cDNA.

To obtain mRNA, total RNA is isolated from the sample. The isolation of total RNA can be carried out according to conventional methods known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere , C. et al., Plant Mol . Biol . Rep . 9: 242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology , John Willey & Sons (1987); And Chomczynski, P. et al., Anal . Biochem . 162: 156 (1987). For example, TRIzol can be used to easily isolate total RNA in a cell. Next, cDNA is synthesized from the separated mRNA, and this cDNA is amplified. Since the total RNA of the present invention is isolated from a human sample, it has a poly-A tail at the end of the mRNA, and the cDNA can be easily synthesized using the oligo dT primer and the reverse transcriptase using such a sequence characteristic ( See, for example, PNAS USA, 85: 8998 (1988); Libert F, et al., Science , 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning . A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001). In addition, cDNA can be synthesized using random hexamer and reverse transcriptase. Next, the synthesized cDNA is amplified through gene amplification reaction.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Nucleic acid hybridization conditions suitable for forming such a double-stranded structure can be found in Nucleic Acid Hybridization < RTI ID = 0.0 > (" , A Practical Approach, IRL Press, Washington, DC (1985).

Various DNA polymerases can be used for amplification of the present invention and include “Clenow” fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu) .

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. To provide joinja, dATP, dCTP, dGTP and dTTP, such as Mg ^{+ 2} to the reaction mixtures to have a desired degree of amplification can be achieved is required. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reaction without changing the conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

The cDNA of the nucleotide sequence of the target of the present invention thus amplified is analyzed by a suitable method to investigate the expression level of the nucleotide sequence of the target of the present invention. For example, the degree of expression of the nucleotide sequence of the target of the present invention is examined by gel electrophoresis of the amplification reaction product described above, and by observing and analyzing the resulting band.

Therefore, when the detection method of the target of the present invention is carried out based on an amplification reaction using cDNA, specifically (i) performing the amplification reaction using a primer annealed to the nucleotide sequence of the target of the present invention; And (ii) analyzing the product of the amplification reaction to determine the expression level of the nucleotide sequence of the target of the present invention.

When step (b) of the present invention is carried out according to the quantitative real-time PCR method, it can be carried out according to the TaqMan probe method or Syb green analysis method described in US Pat. Nos. 5,210,015, 5,538,848 and 6,326,145.

By selecting a drug that acts on the target determined to be highly expressed in step (b), a patient-specific anticancer drug treatment can be performed. That is, when measured using a biological sample of an individual patient, cancer can be effectively treated by selectively administering a medicament acting on the target that is determined to be highly expressed.

The term "high expression" as used herein refers to a case where the expression level of the target target in the sample to be investigated is high compared to the normal sample. For example, expression analysis methods conventionally used in the art, such as RT-PCR or ELISA methods (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001) In the case of expression analysis, it means that the expression is analyzed to be high. For example, as a result of the analysis according to the above-described analysis method, when the target molecule is 2-10 times higher than normal cells, it is determined as "high expression" in the present invention and selects an appropriate anticancer agent. .

According to a preferred embodiment of the present invention, step (c) comprises at least one (more preferred) selected from the targets having the highest expression level up to the expression level 5 rank by comparing the expression levels measured in step (b) with relative comparison. Preferably, at least two drugs are selected that act on the target.

Examples of anticancer agents finally selected in the present invention and acting on the 48 targets described above include targets such as Axitinib, Pazopanib, Sunitinib, Sorafenib, Toceranib, Herceptin, Avastin, Tarceva, Iressa, Gleevec, Rituxan, Velcade, Ibritumomab and Dasatinib. It is a well-defined medicine.

For example, if FLT4 is found to be highly expressed, anticancer drugs acting on FLT4, such as Axitinib, Pazopanib, Sunitinib, Sorafenib or Toceranib, are selected as treatments for this cancer patient. If FLT4 and Erb-2 (HER2) are found to be highly expressed, the anticancer drugs Sorafenib and Erb-2, which act on FLT4, may be selected as a combination dose of this cancer patient.

In this manner, by measuring the expression level of the anticancer drug target expressed in the biological sample of the cancer patient, it is possible to implement the chemotherapy tailored to the individual cancer patient very effectively.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a new patient-specific chemotherapy method based on the finding that the expression pattern for the anticancer drug targets is different for each cancer patient.

(b) The targets to be analyzed in the present invention are 48 target molecules known as targets of conventional anticancer agents, and by measuring the expression level of these target molecules, medicines suitable for a specific cancer patient can be selected and thereby cancer patients. Personalized chemotherapy can be very effective.

1 is a graph showing the expression of anticancer drug molecular targets in a panel of lung cancer cell lines. The x axis represents the type of lung cancer cell line, and the y axis represents the relative expression of molecular targets.
FIG. 2 is a graph showing the expression patterns of the anticancer drug molecular targets, FLT4 and KDR, in a panel of lung cancer cell lines in more detail.
Figure 3 is a graph confirming the mRNA expression level of AR and ERα in lung cancer cell line.
Figure 4 is a graph confirming the degree of cell growth of each lung cancer cell line when treated with DHT which is an agent of AR by distinguishing the lung cancer cell line according to the expression of AR.
Figure 5 is a graph confirming the degree of cell growth of each lung cancer cell lines when the lung cancer cell lines are distinguished according to the expression of ER and treated with DHT and ERα antagonist Tamoxifen.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Experimental Materials and Methods

The present invention is to investigate the mRNA expression profile of all known molecular biological targets for the anticancer agent approved by the US FDA in the patient tissue using the Quantitative Real-time PCR (QPCR) method to 'tailored treatment' method for the patient The purpose is to present. Therefore, 48 molecular biological targets suitable for the present invention were selected from the FDA-approved therapeutic targets for about 220 anticancer agents (Table 1), and QPCR primers for these targets were designed to improve their workability. Proved. In addition, 48 different lung cancer cell lines were used to demonstrate the expression profile of 47 genes among 48 targets using proven primers (FIG. 2). A 384 well QPCR machine with ABI 7900HT Sequence Detection System was used. This data was obtained by the Sybr Green method, the experimental protocols are described in ' Current Protocols in Molecular Biology (2006) 15.8.1 15.8.28'.

In addition, based on the expression profile of the present invention obtained as described above, the target genes were evaluated by applying to the actual lung cancer cell line, respectively.

Molecular Targets for Chemotherapy Gene name Official full name ABL1 c-abl oncogene 1, receptor tyrosine kinase ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 ALAD aminoleuvulinate dehydratase AR Androgen receptor CD33 CD33 molecule CHD1 chromodomain helicase DNA binding protien 1 CSF1R colony stimulating factor 1 receptor Cyp19a1 Aromatase DHFR dihydrofolate reductase DNMT1 DNA (cytosine-5-)-methyltransferase 1 EGFR Epidermal Growth Factor Receptor EPHA2 EPH receptor A2 ERa estrogen receptor alpha ERb estrogen receptor beta ERBB2 (HER2) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro / glioblastoma derived oncogene homolog (avian) FLT1 fms-related tyrosine kinase 1 FLT3 fms-related tyrosine kinase 3 FLT4 fms-related tyrosine kinase 4 FYN FYN oncogene related to SRC, FGR, YES GART (GARFT) phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosyladminoimidazole synthetase HDAC1 histone deacetylase 1 HDAC6 histone deacetylase 6 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) c-KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog LCK lymphocyte-specific protein tyrosine kinase MS4A1 (CD20) membrane-spanning 4-domains, subfamily A, member 1 mTOR mechanistic target of rapamycin (serine / threonine kinase) PDGFRa platelet-derived growth factor receptor, alpha polypeptide PDGFRb platelet-derived growth factor receptor, beta polypeptide POLA1 polymerase (DNA directed), alpha 1, catalytic subunit POLB polymerase (DNA directed), beta PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 RAF1 (c-RAF) v-raf-1 murine leukemia viral oncogene homolog 1 RET ret proto-oncogene RRM1 ribonucleotide reductase M1 RRM2 ribonucleotide reductase M2 RRM2B ribonucleotide reductase M2 B (TP53 inducible) RXRa Retinoid X Receptor alpha RXRb Retinoid X Receptor beta RXRg Retinoid X Receptor gamma B-RAF v-raf-1 murine leukemia viral oncogene homolog B1 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) TARC1 (NK1R) tachykinin receptor 1 TLR7 toll-like receptor 7 TOP1 topoisomerase I TOP2A topoisomerase II alpha 170kDa TYMS thymidylate synthetase YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1

RNA  Ready and Reverse transcription  reaction

RNA  Ready

After purifying total RNA from a lung cancer cell line (ATCC and University of Texas Southwestern Medical Center) cultured under the same conditions using Qiagen RNeasy Kit (Cat # 74134), 2 μg of RNA was added to 2 units of DNAse I (4.2 μM MgCl). ₂ ) The reverse transcription reaction was carried out in a 20 μl volume under the conditions. The reaction solution is of the following composition: adjusted to 20 μl total reaction volume with 2 μg total RNA, 3.68 μl 50 mM MgCl ₂ , 0.96 μl DNAse I and DEPC-water.

Reverse transcription  reaction

The DNAse I-treated samples were subjected to reverse transcription using Superscript II Reverse Transcription Kit (Invitrogen cat # 18064-071) under the following conditions: 20 μl of 5 × First Strand buffer. 10 μl 100 mM DTT, 20 μl 10 mM dNTPs, 5 μl pdN6 (1.6 μg / μl), 0.5 μl RTase (200 U / μl), 20 μl RNA and 24.5 μlL of DEPC-water. 100 μl total reaction solution volume.

Reverse transcription was carried out at the following temperature conditions: 25 ° C. 10 min, 42 ° C. 50 min, 72 ° C. 10 min, 4 ° C. hold.

After completion of the reverse transcription reaction, 100 μl of DEPC-water was added and adjusted to a volume of 200 μl for the final 2 μg cDNA.

Quantitative real-time PCR  And analysis

Data were analyzed using the PCR efficiency-corrected method (2) after QPCR was performed under the following conditions on the ABI 7900HT SDS machine using the standard curve method (1). The experiment consisted of three replicates for each gene. At this time, the standard curve method infers the standard curve for each gene at 0 ng, 0.016 ng, 0.08 ng, 0.4 ng, 2.0 ng, 10 ng and 50 ng based on the RNA concentration using a human universal cDNA. Genes were quantified by inducing standard curves at concentrations of 0 ng, 0.008 ng, 0.04 ng, 0.2 ng, 1 ng, 5 ng and 25 ng using 18S. PCR efficiency-corrected method calculated PCR efficiency ( e ) using e = 10 ^{[-1 / slope ]} . The slope is a value derived from the standard curve of each gene. Thus quantity = (e) ^- the amount was calculated for each gene using the ^Ct. The composition of the QPCR reaction solution is as follows: (30 μl, based on three replicates). Each well in a 384 well plate contains 10 μl of reaction mixture: 10.05 μl of DEPC-water; 15 μl 2 × SYBR Buffer, SYBR GreenER (Invitrogen, Cat 11760-500); 1.2 μl 1: 1 primer mix, 3.75 μl template cDNA.

30 μl of master mixture was dispensed at 10 μl per well and then run the ABI 7900 HT machine via SDS 2.4 software.

QPCR primer sequence Gene name Visibility GenBank Access Number Primer sequence 18S open X00686 5'ACCGCAGCTAGGAATAATGGA3 '
5'GCCTCAGTTCCGAAAACCA3 ' ABL1  - NM_005157.3 5'TAACACTCTAAGCATAACTAAAGGT3 '
5'CACACCATTCCCCATTGTGATT3 ' ABL2  - NM_007314.2 5'TGACCCTAATCTCTTCGTTGCA3 '
5'TGTAACCAAGGACTCGTAGCTTTT3 ' ALAD  - NM_001003945.1 5'TGAGGCCCTTGGTGGA3 '
5'CGCTCGTCCTTGGGAACT3 ' AR open NM_000044 5'GAATTCCTGTGCATGAAAGCA3 '
5'CGAAGTTGATGAAAGAATTTTTGATT3 ' B-RAF1  - NM_004333.3 5'CAACAACAGGGACCAGATAATTTT3 '
5'CGTACCTTACTGAGATCTGGAGACA3 ' CD20  - NM_152866.2 5'TGTCTTCACTGGTGGGCC3 '
5'AGCCCATTCATAATCTGGACA3 ' CD33  - NM_001772.3 5'CGCTCTTTGTCTCTGCCTCAT3 '
5'CTGCTGTCCTGGCTGCTTT3 ' c-Kit  - NM_000222.2 5'CAACCAAGGCCGACAAAA3 '
5'TGATGGCGGGAGTCACAT3 ' c-RAF  - NM_002880.2
5'GGTAGCTGACTGTGTGAAGA3 '
5'CAGTGTTGGAGCAGCTCAAT3 ' CSF1R - NM_005211.2 5'AGCAGGCCCAAGAGGAC3 '
5'CCGCTGCCACCGCTTC3 ' CHD1  - NM_001270.2 5'CTTCAGGAACAGAACGAACAGG3 '
5'GGAGATGACTAGTTTGGCATTCA3 ' Cyp19a1  -  NM_00103 5'GGATCCCTTTGGACGAAAGT3 '
5'AGCTTGCCATGCATCAAAAT3 ' DHFR  - NM_00791.3 5'CTGCATCGTCGCTGTGTCC3 '
5'GTTGTGGTCATTCTCTGGAAATAT3 ' DNMT1  - NM_001379.1 5'GCACCTCATTTGCCGAATAC3 '
5'CTCCTGCATCAGCCCAAATA3 ' EGFR  - NM_005228 5'TGCCCGCATTAGCTCTTAGA3 '
5'GTGCCCGAGGTGGAAGTACT3 ' EPHA2  - NM_004431.2 5'GTCCGAGTGGCTGGAGT3 '
5'ACCACCTTCTCGATGGCA3 ' ERa open NM_007956 5'AGAGAAGTATTCAAGGACATAACGACTATAT3 '
5'TCTTCCTCCTGTTTTTATCAATGG3 ' ERb open NM_001437 5'AAGTTGGCCGACAAGGAGTT3 '
5'ACAGGCTGAGCTCCACAAAG3 ' ERBB2
(HER2)  - 5'CGGCAGCAGAAGATCCGG3 '
5'CGCTAGGTGTCAGCGGCT3 ' FLT1  - NM_002019.3 5'TGCGAGCTCCGGCTTT3 '
5'CCTTGTAGAAACCGTCAGAATC3 ' FLT3  - NM_004119.2 5'ACCCCACTTTCCAATCACATC3 '
5'CGAGTCCGGGTGTATCTGAA3 ' FLT4  - NM_002020.3 5'TCCTGGCTTCCCGAAAGT3 '
5'GGCCAAAGTCACAGATCTTCAC3 ' FYN  - NM_002037.3 5'ATCCGCGAGAGTGAAACCA3 '
5'TCATCCCAATCACGGATAGAA3 ' GARFT  - NM_00819.3 5'GCAGCCCGAGTACTTATAATTGG3 '
5'GATGAGACTGTGCAAGTTTCCA3 ' HDAC1  - NM_004964.2 5'TCCGCATGACTCATAATTTGC3 '
5'TGAGGGCGATAGATTTCCATT3 ' HDAC6  - NM_006044.2 5'GGAATGGCATGGCCATCATTAG3 '
5'CGTGGTTGAACATGCAATAGC3 ' KDR  - NM_002253.1 5'TTCTTGGCATCGCGAAAGTG3 '
5'ATTTTAACCACGTTCTTCTCCGATA3 ' LCK  - NM_005356.3 5'TCCTGCTGACGGAAATTGTC3 '
5'ACCTCCGGGTTGGTCATC3 ' mTOR  - NM_004958.2 5'CCGAGCGACGAGAGATCAT3 '
5'CAAGGGACCGCACCATAAG3 ' NK1R
(TARC1)  - NM_001058.2
NM_015727 5'CAACGAATGGTACTACGGCC3 '
5'GGATGTATGATGGCCATGTAC3 ' PDGFRa  - NM_006206.3 5'TGCCCGAGGAATGGAGTT3 '
5'CTTGTGCCAGGAGGACGTT3 ' PDGFRb  - NM_002609.3
NM_177435 5'GCGCTGGCGAAATCG3 '
5'TTCACGCGAACCAGTGTCA3 ' POLA1  - NM_016937.2 5'AGTGAAACAAGAGGCGGATTC3 '
5'CAAGAGACATCCGGGAGAAAA3 ' POLB  - NM_002690.3 5'GAATCACCGACATGCTCACA3 '
5'GGATAGCTTGGCTCACGTTCT3 ' PSMB5  - NM_002797.2 5'CAGAAGAGCCAGGAATCGAA3 '
5'CAACTATGACTCCATGGCGGA3 ' RET  - NM_020975.4 5'TGGAGACCCAAGACATCAACAT3 '
5'TCCCCCAACAATGCTGC3 ' RRM1  - NM_001033.3 5'TGCACTTCTACGGCTGGAA3 '
5'AGCCGCTGGTCTTGTCCTTA3 ' RRM2  - NM_001034.2 5'TCTGGCTTTCTTTGCAGCAA3 '
5'CTTCTTGGCTAAATCGCTCCA3 ' RRM2B  - NM_015713.3 5'AGGCACAGGCTTCCTTCTG3 '
5'GCTTGTTCCAGTGAGGGAGAT3 ' RXRa open NM_002957 5'GAGCCCAAGACCGAGACCTA3 '
5'AGCTGTTTGTCGGCTGCTT3 ' RXRb open NM_021976 5'AGCCCCCAGATTAACTCAACA3 '
5'GATTGCACATAGCCGTTTGC3 ' RXRg open NM_006917 5'GAAGTTTCCCGCAGGCTATG3 '
5'TGATGGGCTCATGGATGTAGA3 ' SRC  - NM_005417.3 5'TTCAGAGGAGCCCATTTACATC3 '
5'CCTTGAGAAAGTCCAGCAAACT3 ' TLR7  - NM_016562.3 5'ACCAGACCTCTACATTCCATTT3 '
5'GATAAGAATTTGTCTCTTCAGTGT3 ' TOP1  - NM_003286.2 5'GCTAAAAGAACTGACAGCCC3 '
5'AAGAATTGCAACAGCTCGATTG3 ' TOP2A  - NM_001067.2 5'CAGTGAAGAAGACAGCAGCAAAAA3 '
5'AGCTGGATCCCTTTTAGTTCCTT3 ' TYMS  - NM_001071.1 5'ATCACATCGAGCCACTGAAAA3 '
5'TCCTGAGCTTTGGGAAAGGT3 ' YES1  - NM_005433.3 5'GGCCGAGTGCCATATCC3 '
5'GAGGGCACGGCATCCT3 '

Cell line application experiment

Cell line application experiments were conducted to confirm the growth of lung cancer cell lines (ATCC and University of Texas Southwestern Medical Center) in the following order for each target evaluation;

1. Selected cell lines (indicated by arrows in FIG. 3) were placed in 6-well cells containing 1 × 10 ⁵ lung cancer cells in phenol-red free RPMI culture containing 5% FBS (heat-inactivated, charcoal-stripped FBS). Dispense the plate by treatment concentration.

2. On the 2nd day of dispensing, the agents, which were agonists or antagonists, were treated for 3 consecutive days at concentrations of 0, 0.1 nM, 10 nM and 1 M, respectively, with each drug dissolved in ethanol. In the case of AR, DHT (Dihydrotestosterone, Sigma), an agent, was used as a treatment drug for evaluation of AR in case of AR, and 17β-estradiol (17β-estradiol, an agent, as treatment agent for evaluation of ERα in case of ERα. , Sigma) and antagonist tamoxifen (ICI 182780, TOCRIS) were used.

3. On the 5th day of dispensing, the number of living cells was counted using the trypan blue staining method, and then the relative cell growth was calculated and converted into percentages based on the control without ligand.

Experiment result

1. Expression profile

Expression patterns of the above-described anticancer therapeutic target genes from 48 lung cancer cell lines were profiled using the QPCR method (FIG. 1). As can be seen in Figure 1, the expression pattern of the anticancer treatment target genes were different depending on the type of lung cancer cell line.

Gene expression patterns for representative carcinogenic genes, FLT4 and KDR, are shown in FIG. 2. In a panel of 44 lung cancer cell lines, the drugs Sorafenib and Sutent, which are used as therapeutic targets by inhibiting angiogenesis of cancer cells, target FLT4 and KDR. As can be seen in Figure 2, FLT4 and KDR can be seen that the expression pattern is significantly different according to the lung cancer cell line.

As can be seen in Figures 1 and 2, specific genes show specific expression patterns for each cancer cell line. Cancer cell lines will be more efficient if they use anti-cancer therapies by targeting genes with high expression levels. In particular, each lung cancer cell line can be considered as one patient because it is derived from different patients.

2. Application of Cell Lines for Profile Evaluation

Based on the expression profile of the present invention obtained as described above, the target genes were evaluated by applying them to actual cell lines, respectively, which may be the basis for suggesting a new patient-specific chemotherapy method for lung cancer.

For the evaluation as described above, as shown in Figure 3, the expression level of mRNA levels for Androgen receptor (AR) and Estrogen receptor alpha (ERα) in the lung cancer cell lines, respectively. AR and ERα are known as representative targets of prostate and breast cancer, respectively, but are not known in lung cancer.

As a result, it was possible to distinguish between cell lines expressed in lung cancer cell lines and non-expressed cell lines, respectively. In the case of AR, expression was confirmed in lung cancer cell lines H1184 and H2122, but not in H2009 and H1299. In the case of ERα, expression was confirmed in lung cancer cell line H2052, but not in H2009 and H1299.

As shown in FIG. 4, based on the profile of FIG. 3, cell lines H1184 and H2122 expressing AR in lung cancer cell lines and cell lines H2009 and H1299 not expressing AR were selected to obtain DHT (Dihydrotestosterone) known as an agonist of AR. Treated. In addition, LnCaP cell line was used as a positive control for DHT treatment as a cell line expressing AR.

As a result, an increase in AR-dependent cell growth was observed in cell lines expressing AR, in contrast to cell lines not expressing AR.

As shown in FIG. 5, 17β-estradiol (17β-) known as an agonist of ERα was selected by selecting cell lines H2052 expressing ERα and cell lines H2009 and H1299 not expressing ERα in lung cancer cell lines based on the profile of FIG. 3. estradiol) and tamoxifen, known as antagonists of ERα, were treated. In addition, MCF cell line was used as a positive control for 17β- estradiol and tamoxifen treatment as a cell line expressing ERα.

As a result, ERα-dependent cell growth increase (at 17β-estradiol treatment) or ERα-dependent cell growth reduction (at tamoxifen treatment) was observed in cell lines expressing AR, unlike cell lines not expressing ERα.

These results indicate that even if the lung cancer is homogeneous, the specificity is different for each lung cancer cell line, and based on this, effective treatment can be achieved only by identifying the specificity through individual profiling of each patient.

Therefore, according to the present invention, the expression patterns of 48 anticancer drug target genes in cancer cells of cancer patients can be analyzed and the individual anticancer drugs or anticancer drugs to be developed on the basis of these expression patterns can be selectively treated to patients. It is presented.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

References

1.Bookout AL, Cummins CL, Mangelsdorf DJ, Pesola JM, Kramer MF. High-throughput real-time quantitative reverse transcription PCR. Curr Protoc Mol Biol 2006 Feb; Chapter 15: Unit 15.8.

2.Bookout AL, Jeong Y, Downes M, Yu RT, Evans RM, Mangelsdorf DJ. Anatomical profiling of nuclear receptor expression reveals a hierarchical transcriptional network. Cell 2006; 126 (4): 789-99.

3.Xie CQ, Jeong Y, Fu M, Bookout AL, Garcia-Barrio MT, Sun T, Kim BH, Xie Y, Root S, Zhang J, Xu RH, Chen YE, Mangelsdorf DJ. Expression profiling of nuclear receptors in human and mouse embryonic stem cells. Mol Endocrinol 2009; 23 (5): 724-33.

4.Yangsik Jeong, Yang Xie, Guanghua Xiao, Carmen Beherns, Luc Girard, Ignacio I. Wituba, John D. Minna, David J. Mangelsdorf. Nuclear Receptor Expression Defines a Set of Prognostic Biomarkers for Lung Cancer. PLoS Medicine 2010; 7 (12): e1000378.

Claims (19)

delete delete delete delete delete delete delete delete delete delete delete (a) primers or probes that specifically hybridize to target genes ERα, ERβ, RXRγ, TARC1 (NK1R) and TLR7 and ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR ( lung), EPHA2, ERBB2 (HER2) (colon tumor), FLT1 (lung), FLT3 (melanoma tumor), FLT4 (melanoma tumor), FYN, GART (GARFT), HDAC1, HDAC6 (melanoma tumor), KDR, c- KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB (tumor), PSMB5 (tumor), RAF1 (c-RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXRβ, BRAF, SRC, Primers or probes that specifically hybridize to each of at least two target genes selected from the group consisting of TOP1, TOP2A, TYMS and YES1; Or (b) an antibody or antigenic determinant thereof that specifically binds to target proteins ERα, ERβ, RXRγ, TARC1 (NK1R) and TLR7 and ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1 , EGFR, EPHA2, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFR β, POLA1, POLB Specific for each of at least two target proteins selected from the group consisting of, PSMB5, RAF1 (c-RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXRβ, B-RAF, SRC, TOP1, TOP2A, TYMS and YES1 A kit for screening a customized medicine for cancer patients comprising an antibody or antigenic determinant thereof that binds to an enemy.
13. The method of claim 12, wherein the target consists essentially of ERα, ERβ, RXRγ, TARC1 (NK1R) and TLR7 and comprises ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c -RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXR β, B-RAF, SRC, TOP1, TOP2A, TYMS, and YES1 at least five targets selected from the group consisting of.
The method of claim 13, wherein the target comprises essentially ERα, ERβ, RXRγ, TARC1 (NK1R) and TLR7 and comprises ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c -RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXR β, B-RAF, SRC, TOP1, TOP2A, TYMS and YES1 at least 10 targets selected from the group consisting of.
15. The method of claim 14, wherein the target essentially comprises ERα, ERβ, RXRγ, TARC1 (NK1R) and TLR7 and comprises ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c -RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXR β, B-RAF, SRC, TOP1, TOP2A, TYMS, and YES1 at least 20 targets selected from the group consisting of.
The method of claim 15, wherein the target essentially comprises ERα, ERβ, RXRγ, TARC1 (NK1R) and TLR7 and ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c -RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXR β, B-RAF, SRC, TOP1, TOP2A, TYMS and YES1 at least 30 targets selected from the group consisting of.
The method of claim 16, wherein the target essentially comprises ERα, ERβ, RXRγ, TARC1 (NK1R) and TLR7 and ABL1, ABL2, ALAD, AR, CD33, CHD1, CSF1R, Cyp19a1, DHFR, DNMT1, EGFR, EPHA2, ERBB2 (HER2), FLT1, FLT3, FLT4, FYN, GART (GARFT), HDAC1, HDAC6, KDR, c-KIT, LCK, MS4A1 (CD20), mTOR, PDGFRα, PDGFRβ, POLA1, POLB, PSMB5, RAF1 (c -RAF), RET, RRM1, RRM2, RRM2B, RXRα, RXR β, B-RAF, SRC, TOP1, TOP2A, TYMS, and YES1 at least 40 targets selected from the group consisting of.
The kit of claim 12, wherein the kit is a kit for gene amplification or an immunoassay kit.
19. The kit of claim 18, wherein the kit is a kit for quantitative real-time PCR.

Images