CN108998384A - Recombinate the engineering bacteria of fish interferon and its preparation method of product - Google Patents
Recombinate the engineering bacteria of fish interferon and its preparation method of product Download PDFInfo
- Publication number
- CN108998384A CN108998384A CN201810658535.6A CN201810658535A CN108998384A CN 108998384 A CN108998384 A CN 108998384A CN 201810658535 A CN201810658535 A CN 201810658535A CN 108998384 A CN108998384 A CN 108998384A
- Authority
- CN
- China
- Prior art keywords
- engineering bacteria
- gcifn
- product
- interferon
- parts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the preparation methods of the engineering bacteria of recombination fish interferon and its product, the construction method of the engineering bacteria are as follows: interferon gene is cloned from grass carp, it is cloned into expression plasmid, obtain recombinant expression plasmid, saccharomyces cerevisiae is imported by electrotransformation again, successful expression goes out grass carp interferon recombinant protein.The preparation method of engineering bacteria product: level-one kind, the culture of second level kind shaking flask, fermentation tank culture are carried out after engineering bacteria is activated, then IPTG Fiber differentiation is added, thallus is collected after culture, pulvis product obtained is engineering bacteria product after clasmatosis, low temperature drying, crushing afterwards wash with distilled water.Have the beneficial effect that engineering bacteria of the present invention can succeed, high efficient expression goes out salmo IFN recombinant protein, engineering bacteria product-recombination fish interferon yield is high, and GcIFN gene is easy to inducing expression and expression stability, does not need purify and can apply.
Description
Technical field
The present invention relates to technical field of molecular biology, more particularly to the engineering bacteria and its product of recombination fish interferon
Preparation method.
Background technique
With the fast development of China's fish production, Aquatic farming animals disease becomes increasingly conspicuous, and disease occurs seriously to make
About aquatic products industry sustainable health development, fish are antiviral to be displayed for the problem of difference, and the test of especially artificial feeding is used
Its resistance of fish is lower compared with wild type, therefore, the fish immunology gradually extensive concern by scholar and raisers.?
(the gland necrosis of infectiousness film is sick, viral for the frequently-occurring disease found in cultivation such as grass carp virosis (hemorrhagic disease of grass carp), rainbow crouching virosis
Bleeding septicemia and infectious haematopoietic necrosis disease), carp virus disease (spring viremia, epithelioma papulosum cyprinorum and the necrosis of the carp gill
Disease etc.), common eel virosis (common eel flowering shrubs disease virus, common eel rhabdovirus and class herpus vivus etc.) be all to be caused by virus.Water
There are a large amount of bacteriums and viruses in environment, and fish rely more on the protection of innate immune defence compared with other vertebrates.In addition,
Long-term next, due to lacking effective pest control method, various antibiotic, insecticide are widely used, and cause breeding environment and water
Product seriously pollutes, and aquatic food is seriously threatened safely, while the drug resistance that antibiotic generates exacerbates aquatic livestock again
The generation of disease.Therefore, natural, safe and efficient disease control of aquatic animal preparation and its related application technology are developed
It is a very urgent task.The development and utilization of the important immune disease-resistance gene of aquaculture kind are fundamentally to solve aquatic products
Animal diseases prevention and treatment, one of the most effective approach for ensureing aquatic food safety represent current development green and environmentally friendly
The Main way of aquaculture mode.
Interferon (Interferon, IFN) is one of the factor crucial in the body innate immunity, is body cell in virus
It infects or under the action of by nucleic acid, bacterial endotoxin, cytokinin etc., there is height by one kind of recipient cell secretion
The glycoprotein of biological activity has the biological functions such as antiviral and antitumor, immunological regulation.Interferon itself without disease-resistant
The not direct inactivation of viruses of toxic action, but by synthesizing a series of antiviral proteins come the genetic transcription or virus of viral interference
The translation of protein.Its mechanism of action are as follows: firstly, interferon relies on this in conjunction with the interferon specific receptor on cell membrane
One signal pathway, the cumulative interference element activated gene factor so that cell membrane signal reaches rapidly nucleus, then are stimulated with interferon
Response element combines, and promotes the expression of interferon activated gene, to inhibit the synthesis of certain virus proteins to reach antiviral
Purpose.Currently, finding 2 interferoids in fish: I type IFN, it is acidproof, heat-resisting, it is similar to mammal IFN-α/β, Ke Yiyou
Virus and double-stranded RNA (dsRNA) induction generate；II type IFN, i.e. IFN-γ, it is not acidproof, thermo-labile, it can be by mitogen etc.
Induction is generated by leucocyte, T cell or macrophage.Important member in mammalian interferon signal path, such as interferon
Receptor, JAK-STAT, IRF and Mx etc. are found in a variety of fishes, prompt fish interferon to have similar with mammal
Mechanism of action.But the application study for fish interferon in fish and disease control of aquatic animal is also rarely reported at present.
It is very inconvenient using the injection system in the mankind and livestock and poultry on lead-in mode since fish live in water body environment.In view of
It is a large amount of both at home and abroad that interferon is produced as eukaryotic expression system with yeast, and yeast itself is good forage protein source,
Therefore passing through Yeast expression fish interferon and being prepared into the bacterium powder feed additive containing interferon is preferably to select.It can be with
Production cost is greatly lowered, and easy to operate, there is practical application.
The prior art such as Authorization Notice No. is the Chinese invention patent of 103243106 B of CN, and it is dry to disclose Epinephelus coioides
The albumen and the albumen for disturbing plain 1 gene of IFN γ and its coding are in the application for preparing a kind of new immunopotentiator.Pass through base
Because of the method for group database screening and design special primer amplification, clone obtains IFN γ from Epinephelus coioides head-kidney total serum IgE
The opening code-reading frame of 1 gene, nucleotide sequence is as shown in SEQIDNO:2, and the amino acid sequence of coded albumen is such as
Shown in SEQIDNO:1.Above-mentioned 1 albumen of Epinephelus coioides interferon IFNgamma can induce related immune gene table through preliminary identification
It reaches, can be developed into native species immunopotentiator or immunologic adjuvant.But the production of the albumen is produced using Escherichia coli fermentation method
It measures lower, and is purified.
Summary of the invention
The purpose of the present invention is to provide the preparation method of a kind of engineering bacteria for recombinating fish interferon and its product, engineerings
Bacterium can succeed, high efficient expression goes out salmo IFN recombinant protein, and engineering bacteria product-recombination fish interferon yield is high, GcIFN base
Because being easy to inducing expression and expression stability, do not need purify and can apply.
The present invention in background technique aiming at the problem that mentioning, the technical solution taken are as follows:
Saccharomyces cerevisiae INVSC1 is purchased from Shanghai North Connaught biological technology CO., LTD..
The engineering bacteria of fish interferon is recombinated, which is the wine with recombination fish interferon gene IFN-pYES2
Brewer yeast bacterial strain INVSc1/pYES2-GcIFN.The engineering bacteria contains the recombinant plasmid of recombination fish interferon gene GcIFN, at
Function gives expression to salmo IFN recombinant protein, and expression quantity reaches 20% or more of yeast cells total protein, while the engineering bacteria is one
Kind stable microorganism, survival ability is stronger, itself does not have pathogenic, does not generate noxious material, is widely used without potential danger
Dangerous, furthermore the engineering bacteria inhereditary feature is highly stable, continuous passage 10 times in laboratory, still through PCR testing goal gene
Inheritance stability remains to stablize expression through SDS detection foreign gene.
Preferably, recombination fish interferon engineering bacteria construction method specifically includes the following steps:
Step 1: 0.5ml poly I:C is subcutaneously injected to grass carp dorsal fin, injects primary, 12hr again after 26 DEG C of water temperature induction 12hr
After take head-kidney, spleen, brain, cardiac muscle, liver, gill etc. to organize 10 grams or so, liquid nitrogen is rapidly frozen, and takes the complete head-kidney of freezing and spleen
Dirty tissue, set liquid nitrogen be milled into it is powdered, with TRizol extract total serum IgE, then total serum IgE is reversed with Reverse Transcriptase kit
Record into cDNA template, then using this cDNA as template, design upstream primer IFN-F1:AAGGAAATGGGTGGAAAATAT and under
Primer I FN-R1:TTGCGATGATGTCCATCCTC is swum, carries out PCR amplification to get salmo IFN gene GcIFN segment, the base
Because the length of GcIFN is 543bp；
Step 2: utilizing restriction endonucleaseHindIII andXhoI double digestion GcIFN segment obtains both ends with identical
The GcIFN segment of cohesive terminus,cohesive termini, and by the GcIFN segment be recombined into throughXhoIn the pYES2 carrier of I digestion, building recombination matter
Grain pYES2-GcIFN, choose positive colony, above-mentioned pYES2 size be 5857bp, wherein comprising ampicillin resistance gene,
For the multiple cloning sites and URA3 gene of foreign gene insertion under the control of GAL1 promoter, wherein grass carp interferon gene is mesh
Segment, be the oligogene that pYES2 plasmid carries out heterogenous expression, above-mentioned foreign gene is inserted in pYES2 plasmidHind III
WithXhoBetween I restriction enzyme site, it is the segment in multiple cloning sites that deletion clip size, which is 82bp, to plasmid amplification, screening and outer
Without influence, obtained pYES2-GcIFN is the DNA plasmid carrier of double-strand closed loop for the expression of source gene, can be numerous in microorganism
It grows, can determine the presence of target gene with PCR and Western-blot, analyze the expression of target gene；
Step 3: the positive colony plasmid electrotransformation after identification being imported in saccharomyces cerevisiae INVSc1 bacterial strain, Yeast engineering bacteria is obtained
INVSc1/pYES2-GcIFN, above-mentioned Yeast engineering bacteria INVSc1/pYES2-GcIFN contain recombination fish interferon gene
The recombinant plasmid of GcIFN, successful expression go out salmo IFN recombinant protein, expression quantity reach the 20% of yeast cells total protein with
On, while the engineering bacteria is a kind of stable microorganism, and survival ability is stronger, itself does not have pathogenic, does not generate Toxic
No potentially danger is widely used in matter, and furthermore the engineering bacteria inhereditary feature is highly stable, continuous passage 10 times, detects mesh through PCR
Gene still inheritance stability, through SDS detection foreign gene remain to stablize expression.
Further preferably, PCR is 10 × Ex Taq Buffer 5ul, dNTP Mixture (each 2.5mM) in step 1
4ul, TaKaRa Ex Taq (5U/ul) 0.25ul, template DNA 2.5ng, IFN-F1 (20uM) 1ul, IFN-R1 (20uM)
1ul, sterile purified water add to 50ul, PCR response parameter are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s,
72 DEG C of extension 30s, 35 circulations, last 72 DEG C extend 8min eventually.
For optimisation technique method, the measure taken further include: promoter and terminator are all from saccharomyces cerevisiae, wherein
GAL1 promoter length is 451bp, can star the transcription of target gene GcIFN, and terminator is the terminator of CYC1 gene,
Length is 239bp, to terminate the transcription of target gene；Marker gene is ampicillin resistance gene, derives from large intestine bar
Bacterium, size 860bp are easy to carry out positive colony and select after the plasmid containing the resistance converts Escherichia coli；Reporter gene is
URA3 gene derives from saccharomyces cerevisiae, size 800bp.
Recombinate the preparation method of the engineering bacteria product of fish interferon, including shaking flask culture, fermentation tank culture, product system
It is standby, the specific steps are that:
Shaking flask culture: the Wine brewing yeast strain INVSc1/pYES2-GcIFN after activation is seeded in YPD seed culture medium,
10-14h is cultivated under conditions of temperature is 28-32 DEG C, revolving speed is 200-300r/min and obtains level-one kind culture, then by level-one kind
Culture is by 8-12%(V/V) inoculum concentration be seeded in fermentation medium, temperature be 28-32 DEG C, revolving speed 200-300r/
10-14h is cultivated under conditions of min to get second level kind, spare, the condition of culture of the step condition of culture and fermenting and producing is close,
In bacterial cell culture, the contact with medium component and the supply of oxygen can be improved, breeding is than more uniform, and efficiency
Height not will form mycoderm, will not form long mycelia and be formed by bead, prepare for fermentation tank culture；
Fermentation tank culture: by second level kind by 8-12%(V/V) inoculum concentration be inoculated into fermentor, trained under conditions of 28-32 DEG C
Support to OD600 and reach 0.55-0.62, the IPTG for inducing final concentration of 0.58-0.62mmol/L is added, then 20-30 DEG C,
Then Fiber differentiation 3-5h under conditions of 200-300rpm is centrifuged 15-25min under conditions of 4000-6000r/min and collects bacterium
Body, distilled water are cleaned to get yeast thallus, and spare, which can provide sufficient nutriment and good existence for strain
Reproduction Conditions guarantee the quick breeding of strain, obtain yeast thallus, while can induce foreign gene salmo IFN recombinant protein
Expression, increases its expression quantity, and product is stablized, easy purification；
Product preparation: by yeast thallus, pulvis product obtained is that engineering bacteria produces after clasmatosis, low temperature drying, crushing
Object, there is no saccharomycete living, no pathogenicities not to generate noxious material for the product, and for environmentally safe property without influence, product is effective
Ingredient is the recombination fish interferon of expression, has significant antiviral activity in vivo and in vitro, disease-resistant in grass carp CIK cell
Malicious (GCHV) activity (Log2CPEI50/ 0.1ml) reach 11.15 ± 0.66 or more, it gives and recombinates with injection or oral route in vivo
Fish interferon reaches 59.42% or more to the immune protective rate of GCHV, and recombination fish interferon passes through induction antiviral protein
Mx express and play antivirus action, while it have significant immunoloregulation function, can activating macrophage Phagocytosis, and
Promote T, B lymphocyte proliferation conversion, can be used as disease-resistant feed additive, in fishery disease control gradually substitute antibiotics,
Guarantee that aquatic food and breeding environment safety etc. are of great significance.
Preferably, fermentation medium components and its parts by weight are as follows: 90-110 parts of sucrose, 25-35 parts of yeast powder, peptone
4-6 parts, 13-16 parts of urea, 2-4 parts of brewer's wort, 0.12-0.2 parts of asparatate, KH2PO43-5 parts, K2HPO4·3H2O 2-
3 parts, MgSO4·7H20.08-0.12 parts of O, ZnSO4·7H20.002-0.003 parts of O, MnSO4·4H20.01-0.015 parts of O,
0.003-0.005 parts of biotin.Dextrorotation asparatate in above-mentioned asparatate containing 0.32-0.42%, above-mentioned lucid asparagus
Propylhomoserin can play synergistic effect with the other compositions of culture medium, and the pH of fermentation medium is controlled, and be engineering
Bacterium INVSc1/pYES2-GcIFN provides optimal living environment, guarantees that engineering bacteria INVSc1/pYES2-GcIFN's is quick numerous
It grows, shortens the duration for entering logarithmic phase, improve the yield of recombination fish interferon, while recombination fish interferon base can be enhanced
Because of the sensibility to inducer IPTG, so that recombination fish interferon gene is easy to inducing expression, reduce the time of inducing expression, keep away
Exempt from GcIFN genetic drift phenomenon, continuous passage 10 more than generation remains to detect target gene and its expression product in engineering bacteria,
The expression stability of GcIFN gene is improved, above-mentioned each ingredient of fermentation medium has mutual synergistic effect, can not only sufficiently provide ferment
Carbon source, nitrogen source and various growth factors needed for female engineering bacteria INVSc1/pYES2-GcIFN fermentation, moreover it is possible to improve yeast engineering
The GcIFN gene expression amount of bacterium INVSc1/pYES2-GcIFN, the final yield for improving product, and product does not need to be purified
It can apply.
Compared with prior art, the invention has the benefit that 1) present invention clones interferon gene from grass carp
GcIFN is cloned into expression plasmid pYES2, obtains recombinant expression plasmid pYES2-GcIFN, then import by electrotransformation
Saccharomyces cerevisiae (Saccharomyces cerevisiae) INVSc1, successful expression goes out grass carp interferon recombinant protein；2) this hair
Bright engineering bacteria is a kind of stable microorganism, and successful expression goes out salmo IFN recombinant protein, and survival ability is stronger, itself does not have
It is pathogenic, noxious material is not generated, no potentially danger is widely used, inhereditary feature is highly stable, 10 external sources of continuous passage
Gene remains to stablize expression；3) engineering bacterium fermentation is easy, and engineering bacteria product-recombination fish interferon yield is high, GcIFN base
The expression stability of cause does not need purify and can apply, and there is no saccharomycete living, no pathogenicities not to have generated for product
Noxious material, environmentally safe property have significant antiviral activity without influence in vivo and in vitro, and energy activating macrophage phagocytosis is killed
Bacterium, and promote T, B lymphocyte proliferation conversion, it can be used as disease-resistant feed additive, to gradually substitution is anti-in fishery disease control
Raw element guarantees that aquatic food and breeding environment safety etc. are of great significance.
Detailed description of the invention
Fig. 1 is the technology path of target gene and construction of genetic engineering；
Fig. 2 is that (top is divided into poly I:C induction group to induction group RT-PCR product electrophoretogram；Lower part is divided into grass carp hemorrhagic disease virus
Induction group)；
Fig. 3 is the structure figures of recombinant plasmid pYES2-GcIFN；
Fig. 4 is the bacterium colony PCR qualification figure of target gene；
Fig. 5 is the SDS-PAGE analysis chart of INVSC1/pYES2-GcIFN inducing expression.
Specific embodiment
The present invention program is described further below by embodiment:
Embodiment 1:
The engineering bacteria of fish interferon is recombinated, which is the wine brewing ferment with recombination fish interferon gene IFN-pYES2
Mother strains INVSc1/pYES2-GcIFN.The technology path of target gene and construction of genetic engineering is as shown in Figure 1, the engineering bacteria
Recombinant plasmid containing recombination fish interferon gene GcIFN, successful expression go out salmo IFN recombinant protein, and expression quantity reaches ferment
20% or more of mother cell total protein, while the engineering bacteria is a kind of stable microorganism, survival ability is stronger, itself does not have
It is pathogenic, noxious material is not generated, no potentially danger is widely used, furthermore the engineering bacteria inhereditary feature is highly stable, through reality
Indoor continuous passage 10 times is tested, through PCR testing goal gene still inheritance stability, remains to stablize expression through SDS detection foreign gene.
The construction method of the engineering bacteria of above-mentioned recombination fish interferon specifically includes the following steps:
Step 1: 0.5ml poly I:C is subcutaneously injected to grass carp dorsal fin, injects primary, 12hr again after 26 DEG C of water temperature induction 12hr
After take head-kidney, spleen, brain, cardiac muscle, liver, gill etc. to organize 10 grams or so, liquid nitrogen is rapidly frozen, and takes the complete head-kidney of freezing and spleen
Dirty tissue, set liquid nitrogen be milled into it is powdered, with TRizol extract total serum IgE, then total serum IgE is reversed with Reverse Transcriptase kit
Record into cDNA template, then using this cDNA as template, design upstream primer IFN-F1:AAGGAAATGGGTGGAAAATAT and under
Primer I FN-R1:TTGCGATGATGTCCATCCTC is swum, carries out PCR amplification to get salmo IFN gene GcIFN segment, to mentioning
The template taken is RT-PCR, includes that brain, cardiac muscle, head-kidney, liver, spleen, intestines mention from 6 adult tissues of grass carp as a result such as Fig. 2
Total serum IgE is taken, the expression by RT-PCR with the interferon homologous gene GcIFN of Primary Study grass carp in these tissues,
GcIFN expression is showed no in the various tissues of control group, in two induction groups, in addition to the spleen of virus group is shown in trace expression,
Remaining has more apparent expression, and is in strongly expressed in brain and cardiac muscular tissue, and after grass carp hemorrhagic disease virus induces, GcIFN is in head
There are grass carp head-kidney, the liver compared with strongly expressed, induced through poly I:C, the gill in kidney and gill tissue, and GcIFN also has compared with strongly expressed, phase
Comparatively, poly I:C is the good inducer of grass carp interferon, and the length of gene GcIFN is 543bp；
Step 2: the building of recombinant plasmid pYES2-NKEF is as shown in figure 3, utilize restriction endonucleaseHindIII andXho
I double digestion GcIFN segment, obtain both ends have identical cohesive terminus,cohesive termini GcIFN segment, and by the GcIFN segment be recombined into throughXhoIn the pYES2 carrier of I digestion, Escherichia coli Top10 is converted, positive bacterium colony is screened in bacterium colony PCR detection, chooses positive gram
It is grand, with alkaline lysis method of extracting recombinant expression plasmid, carry out sequencing identification, with preliminary screening go out recon plasmid as template, into
Row PCR detection, as shown in figure 4, as the result is shown after being inserted into GcIFN gene, plasmid pYES2-GcIFN testing result occurs
The band of 750bp, it was demonstrated that obtain the correct recombinant expression plasmid of direction of insertion, contain complete GcIFN gene, above-mentioned pYES2 is big
Small is 5857bp, wherein polyclonal comprising being inserted under ampicillin resistance gene, the control of GAL1 promoter for foreign gene
Site and URA3 gene, wherein grass carp interferon gene is target fragment, is the main base that pYES2 plasmid carries out heterogenous expression
Cause, above-mentioned foreign gene are inserted in pYES2 plasmidHindIII andXhoBetween I restriction enzyme site, deletion clip size is 82bp, is
Segment in multiple cloning sites, on the expression of plasmid amplification, screening and foreign gene without influence, obtained pYES2-GcIFN is
The DNA plasmid carrier of double-strand closed loop, can breed in microorganism, can determine target gene with PCR and Western-blot
Presence, analyze the expression of target gene；
Step 3: a small amount of recombinant plasmid pYES2-GcIFN of alkaline lysis method of extracting, while preparing Saccharomyces cerevisiae competent cell, electricity consumption
Recombinant plasmid is transferred to saccharomyces cerevisiae by pulse method for transformation, the method is as follows: mixes 40 μ l yeast creams with 5 μ l Plasmid DNA
The ice bath 5min after the electrotransformation cup (0.2cm) of pre-cooling, jog；Pulse parameter: V=1.5kV, 25 μ F, 200 Ohms, 4-5ms；
The 1mol/L sorbierite for adding 1ml pre-cooling after electrotransformation at once is coated in SC-U screening flat board (the 200 every plate of μ l), 30 DEG C of cultures,
Until single bacterium colony occurs, the yeast recon of acquisition is detected through bacterium colony PCR, screens the correct positive clone molecule of length, so
Extract yeast plasmid DNA afterwards, convert Escherichia coli Top10 again, expand after plasmid with EcoRI andXhoI double digestion is examined, and is obtained
Yeast engineering bacteria INVSc1/pYES2-GcIFN is obtained, it is dry that above-mentioned Yeast engineering bacteria INVSc1/pYES2-GcIFN contains recombination fish
The recombinant plasmid of plain gene GcIFN is disturbed, successful expression goes out salmo IFN recombinant protein, and expression quantity reaches yeast cells total protein
20% or more, while the engineering bacteria is a kind of stable microorganism, survival ability is stronger, itself does not have pathogenic, does not generate
No potentially danger is widely used in noxious material, and furthermore the engineering bacteria inhereditary feature is highly stable, and continuous passage 10 times, through PCR
Testing goal gene still inheritance stability remains to stablize expression through SDS detection foreign gene.
In above-mentioned steps 1 PCR be 10 × Ex Taq Buffer 5ul, dNTP Mixture (each 2.5mM) 4ul,
TaKaRa Ex Taq (5U/ul) 0.25ul, template DNA 2.5ng, IFN-F1 (20uM) 1ul, IFN-R1 (20uM) 1ul,
Sterile purified water adds to 50ul, PCR response parameter are as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, and 72 DEG C
Extend 30s, 35 circulations, last 72 DEG C extend 8min eventually.
Above-mentioned promoter and terminator are all from saccharomyces cerevisiae, and wherein GAL1 promoter length is 451bp, can star mesh
Gene GcIFN transcription, and terminator be CYC1 gene terminator, length 239bp, to terminate target gene turn
Record；Marker gene is ampicillin resistance gene, derives from Escherichia coli, size 860bp, and the plasmid containing the resistance turns
After changing Escherichia coli, it is easy to carry out positive colony and selects；Reporter gene is URA3 gene, derives from saccharomyces cerevisiae, and size is
800bp。
Recombinate the preparation method of the engineering bacteria product of fish interferon, including shaking flask culture, fermentation tank culture, product system
It is standby, the specific steps are that:
1) shaking flask culture: the Wine brewing yeast strain INVSc1/pYES2-GcIFN after activation is seeded in YPD seed culture medium,
10h is cultivated under conditions of temperature is 28 DEG C, revolving speed is 300r/min and obtains level-one kind culture, then presses level-one kind culture
Inoculum concentration 12%(V/V) is seeded in fermentation medium, is cultivated under conditions of temperature is 28 DEG C, revolving speed is 300r/min
10h is to get second level kind, and spare, the condition of culture of the step condition of culture and fermenting and producing is close, in bacterial cell culture,
The contact with medium component and the supply of oxygen can be improved, breeding is than more uniform, and efficiency is also high, not will form mycoderm,
It not will form long mycelia and be formed by bead, prepare for fermentation tank culture；
2) fermentation tank culture: by second level kind by 12%(V/V) inoculum concentration be inoculated into fermentor, cultivated under conditions of 28 DEG C
Reach 0.6 to OD600, the IPTG for inducing final concentration of 0.6mmol/L is added, then 25 DEG C, 250rpm Fiber differentiation 8h exist
It is centrifuged 25min under conditions of 4000r/min and collects thallus, distilled water is cleaned to get yeast thallus, and spare, which can be bacterium
Kind provides sufficient nutriment and good survival and reproduction condition, guarantees the quick breeding of strain, obtains yeast thallus, simultaneously
The expression that can induce foreign gene salmo IFN recombinant protein, increases its expression quantity, and product is stablized, easy purification；
3) prepared by product: suspension will be made after yeast thallus wash with distilled water 3 times, is placed in 100 DEG C of water-baths and handles
15min, 4 DEG C of ice baths are cooling, carry out ultrasonication, ultrasonication condition are as follows: and ultrasonication power 450W is crushed time 20min,
Time interval (working time: intermittent time) is 10:8(s/s), the yeast cream after ultrasonication is dry through 25-30 DEG C of air-flow
It is dry, yeast powder is made, is encapsulated into aluminium foil bag, saccharomycete living is not present in refrigeration storing, as engineering bacteria product, the product,
No pathogenicity does not generate noxious material, and for environmentally safe property without influence, product effective component is the recombination fish interference of expression
Element has significant antiviral activity, antiviral (GCHV) activity (Log in grass carp CIK cell in vivo and in vitro2CPEI50/
0.1ml) reach 11.15 ± 0.66 or more, gives recombination fish interferon in vivo with injection or oral route, GCHV is immunized
Protective rate reaches 59.42% or more, and recombination fish interferon plays antivirus action by induction antiviral protein Mx expression,
It has significant immunoloregulation function, energy activating macrophage Phagocytosis simultaneously, and T, B lymphocyte proliferation is promoted to turn
Change, can be used as disease-resistant feed additive, in fishery disease control gradually substitute antibiotics, guarantee aquatic food and breeding environment
Safety etc. is of great significance.
Above-mentioned fermentation medium components and its parts by weight are as follows: 90 parts of sucrose, 35 parts of yeast powder, 4 parts of peptone, urea 16
Part, 2 parts of brewer's wort, 0.2 part of asparatate, KH2PO43 parts, K2HPO4·3H23 parts of O, MgSO4·7H20.08 part of O,
ZnSO4·7H20.003 part of O, MnSO4·4H20.01 part of O, 0.005 part of biotin.Contain 0.32% in above-mentioned asparatate
Dextrorotation asparatate, above-mentioned asparatate can play synergistic effect with the other compositions of culture medium, so that fermentation training
The pH for supporting base can be controlled, and provided optimal living environment for engineering bacteria INVSc1/pYES2-GcIFN, guaranteed engineering bacteria
The duration for entering logarithmic phase is shortened in the quick breeding of INVSc1/pYES2-GcIFN, improves the yield of recombination fish interferon,
Recombination fish interferon gene can be enhanced simultaneously to the sensibility of inducer IPTG, recombination fish interferon gene is made to be easy to induce
Expression, reduces the time of inducing expression, avoids GcIFN genetic drift phenomenon, continuous passage 10 more than generation remains in engineering bacteria
It detects target gene and its expression product, improves the expression stability of GcIFN gene, above-mentioned each ingredient of fermentation medium has phase
Mutually synergistic effect, carbon source needed for Yeast engineering bacteria INVSc1/pYES2-GcIFN fermentation can not only be sufficiently provided, nitrogen source and each
Kind growth factor, moreover it is possible to which the GcIFN gene expression amount for improving Yeast engineering bacteria INVSc1/pYES2-GcIFN finally improves product
Yield, and product does not need to carry out purifying and can apply.
Embodiment 2:
The inducing expression and identification of recombination yeast
Picking single colonie recon is inoculated in the 15mlSC-U culture medium containing 2% galactolipin, and 30 DEG C of shaken cultivations are stayed overnight；With first
Beginning OD value reaches 0.6, calculates the amount that overnight culture is added in 50ml induced medium, 30 DEG C of shaken cultivations.0,4,6,
12, cell, 4 DEG C of 1500g centrifugations are resuspended with 500 μ l lysates (BioDev-Tech, DB001-12) in 18,24,30h collection cell
5min collects cell, and cell is resuspended with lysate, OD600 value is transferred to 50, isometric bead (Sigma G-8772) is added
30s, ice bath 30s are vibrated, lytic cell is repeated 4 times, high speed centrifugation 10min takes supernatant, SDS-PAGE sample buffer is added,
5min is boiled, 20 μ l lysates is taken to be loaded, carries out SDS-PAGE electrophoresis, identification recombinant expression IFN protein band, and with thin layer color
Spectrometer measures recombinant protein band and absorbs peak area in 630nm length scanning, calculates opposite table largely up to 30% or more.Such as figure
Shown in 5.From the point of view of electrophoretogram, INVSC1/pYES2-GcIFN bacterial strain has an apparent albumen one in the position of molecular weight 38kDa
Band, and INVSC1/pYES2 bacterial strain does not have, it is thus determined that the albumen is the expressed grass carp interferon albumen out of yeast.Pass through
Inducing expression experiment, it has been found that fermenting at the beginning, since initial cell density is higher, the expression quantity of grass carp interferon is in 7h
Left and right can reach peak value, hereafter as time increases, no longer dramatically increase as 38h detects discovery expression quantity.In addition, adding
Add 20% glycerol, the expression of grass carp interferon can be significantly improved.
Embodiment 3:
The engineering bacteria of fish interferon is recombinated, which is the wine brewing ferment with recombination fish interferon gene IFN-pYES2
Mother strains INVSc1/pYES2-GcIFN.
The construction method of the engineering bacteria of above-mentioned recombination fish interferon specifically includes the following steps:
Step 1: 0.5ml poly I:C is subcutaneously injected to grass carp dorsal fin, injects primary, 12hr again after 26 DEG C of water temperature induction 12hr
After take head-kidney, spleen, brain, cardiac muscle, liver, gill etc. to organize 10 grams or so, liquid nitrogen is rapidly frozen, and takes the complete head-kidney of freezing and spleen
Dirty tissue, set liquid nitrogen be milled into it is powdered, with TRizol extract total serum IgE, then total serum IgE is reversed with Reverse Transcriptase kit
Record into cDNA template, then using this cDNA as template, design upstream primer IFN-F1:AAGGAAATGGGTGGAAAATAT and under
Primer I FN-R1:TTGCGATGATGTCCATCCTC is swum, carries out PCR amplification to get salmo IFN gene GcIFN segment, the base
Because the length of GcIFN is 543bp；
Step 2: utilizing restriction endonucleaseHindIII andXhoI double digestion GcIFN segment obtains both ends with identical
The GcIFN segment of cohesive terminus,cohesive termini, and by the GcIFN segment be recombined into throughXhoIn the pYES2 carrier of I digestion, building recombination matter
Grain pYES2-GcIFN, choose positive colony, above-mentioned pYES2 size be 5857bp, wherein comprising ampicillin resistance gene,
For the multiple cloning sites and URA3 gene of foreign gene insertion under the control of GAL1 promoter, wherein grass carp interferon gene is mesh
Segment, be the oligogene that pYES2 plasmid carries out heterogenous expression, above-mentioned foreign gene is inserted in pYES2 plasmidHind III
WithXhoBetween I restriction enzyme site, deletion clip size is 82bp；
Step 3: the positive colony plasmid electrotransformation after identification being imported in saccharomyces cerevisiae INVSc1 bacterial strain, Yeast engineering bacteria is obtained
INVSc1/pYES2-GcIFN。
In above-mentioned steps 1 PCR be 10 × Ex Taq Buffer 5ul, dNTP Mixture (each 2.5mM) 4ul,
TaKaRa Ex Taq (5U/ul) 0.25ul, template DNA 2.5ng, IFN-F1 (20uM) 1ul, IFN-R1 (20uM) 1ul,
Sterile purified water adds to 50ul, PCR response parameter are as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, and 72 DEG C
Extend 30s, 35 circulations, last 72 DEG C extend 8min eventually.
Above-mentioned promoter and terminator are all from saccharomyces cerevisiae, and wherein GAL1 promoter length is 451bp, can star mesh
Gene GcIFN transcription, and terminator be CYC1 gene terminator, length 239bp, to terminate target gene turn
Record；Marker gene is ampicillin resistance gene, derives from Escherichia coli, size 860bp, and the plasmid containing the resistance turns
After changing Escherichia coli, it is easy to carry out positive colony and selects；Reporter gene is URA3 gene, derives from saccharomyces cerevisiae, and size is
800bp。
Recombinate the preparation method of the engineering bacteria product of fish interferon, including shaking flask culture, fermentation tank culture, product system
It is standby, the specific steps are that:
1) shaking flask culture: the Wine brewing yeast strain INVSc1/pYES2-GcIFN after activation is seeded in YPD seed culture medium,
12h is cultivated under conditions of temperature is 30 DEG C, revolving speed is 260r/min and obtains level-one kind culture, then presses level-one kind culture
Inoculum concentration 10%(V/V) is seeded in fermentation medium, is cultivated under conditions of temperature is 30 DEG C, revolving speed is 260r/min
12h is spare to get second level kind；
2) fermentation tank culture: by second level kind by 10%(V/V) inoculum concentration be inoculated into fermentor, cultivated under conditions of 30 DEG C
Reach 0.6 to OD600, the IPTG for inducing final concentration of 0.6mmol/L is added, then 25 DEG C, 250rpm Fiber differentiation 7h exist
It is centrifuged 20min under conditions of 5000r/min and collects thallus, distilled water is cleaned to get yeast thallus, spare；
3) prepared by product: by yeast thallus, pulvis product obtained is that engineering bacteria produces after clasmatosis, low temperature drying, crushing
Object.
Above-mentioned fermentation medium components and its parts by weight are as follows: 100 parts of sucrose, 30 parts of yeast powder, 5 parts of peptone, urea 15
Part, 3 parts of brewer's wort, 0.15 part of asparatate, KH2PO44 parts, K2HPO4·3H22.5 parts of O, MgSO4·7H20.1 part of O,
ZnSO4·7H20.0026 part of O, MnSO4·4H20.012 part of O, 0.004 part of biotin.Contain in above-mentioned asparatate
0.38% dextrorotation asparatate.
It recombinates expression quantity of the fish interferon in yeast cells and reaches 27.1%, activity reaches 112U/mg albumen.
Embodiment 4:
The construction method for recombinating the engineering bacteria of fish interferon, advanced optimizes step are as follows:
Step 1: 0.5ml poly I:C is subcutaneously injected to grass carp dorsal fin, injects primary, 12hr again after 26 DEG C of water temperature induction 12hr
After take head-kidney, spleen, brain, cardiac muscle, liver, gill etc. to organize 10 grams or so, liquid nitrogen is rapidly frozen, and takes the complete head-kidney of freezing and spleen
Dirty tissue, set liquid nitrogen be milled into it is powdered, with TRizol extract total serum IgE, then total serum IgE is reversed with Reverse Transcriptase kit
Record into cDNA template, then using this cDNA as template, design upstream primer IFN-F1:AAGGAAATGGGTGGAAAATAT and under
Primer I FN-R1:TTGCGATGATGTCCATCCTC is swum, carries out PCR amplification to get salmo IFN gene GcIFN segment, the base
Because the length of GcIFN is 543bp；
Step 2: utilizing restriction endonucleaseHindIII andXhoI double digestion GcIFN segment obtains both ends with identical
The GcIFN segment of cohesive terminus,cohesive termini, and by the GcIFN segment be recombined into throughXhoIn the pYES2 carrier of I digestion, building recombination matter
Grain pYES2-GcIFN, choose positive colony, above-mentioned pYES2 size be 5857bp, wherein comprising ampicillin resistance gene,
For the multiple cloning sites and URA3 gene of foreign gene insertion under the control of GAL1 promoter, wherein grass carp interferon gene is mesh
Segment, be the oligogene that pYES2 plasmid carries out heterogenous expression, above-mentioned foreign gene is inserted in pYES2 plasmidHind III
WithXhoBetween I restriction enzyme site, deletion clip size is 82bp；
Step 3: the positive colony plasmid electrotransformation after identification being imported in saccharomyces cerevisiae INVSc1 bacterial strain, Yeast engineering bacteria is obtained
INVSc1/pYES2-GcIFN。
In above-mentioned steps 1 PCR be 10 × Ex Taq Buffer 5ul, dNTP Mixture (each 2.5mM) 4ul,
TaKaRa Ex Taq (5U/ul) 0.25ul, template DNA 2.5ng, IFN-F1 (20uM) 1ul, IFN-R1 (20uM) 1ul,
N,N-dimethylacetamide 0.01ul, fatty diglycollic amide 0.003ul, sterile purified water add to 50ul, PCR response parameter
Are as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 15s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 circulations, last 72 DEG C extend eventually
8min.The special presence of DMAC N,N' dimethyl acetamide and fatty diglycollic amide can destroy DNA points in the PCR reaction system
Hydrogen bond in son between base-pair shortens the denaturation time of DNA sequence dna, reduces the damage to enzymatic activity, activates to the maximum extent
The catalytic activity of Taq archaeal dna polymerase, and then the Drawing rate of polymerase is improved, thus effective amplification of DNA fragments, while can
It avoids having longer palindrome in sequence, prevents primer itself from forming hairpin structure, avoid non-specific amplification, improve PCR
The yield and stability of amplified production, and then guarantee that engineering bacteria can succeed, high efficient expression goes out salmo IFN recombinant protein.
Above-mentioned promoter and terminator are all from saccharomyces cerevisiae, and wherein GAL1 promoter length is 451bp, can star mesh
Gene GcIFN transcription, and terminator be CYC1 gene terminator, length 239bp, to terminate target gene turn
Record；Marker gene is ampicillin resistance gene, derives from Escherichia coli, size 860bp, and the plasmid containing the resistance turns
After changing Escherichia coli, it is easy to carry out positive colony and selects；Reporter gene is URA3 gene, derives from saccharomyces cerevisiae, and size is
800bp。
It recombinates expression quantity of the fish interferon in yeast cells and reaches 28.9%, activity reaches 123U/mg albumen.
Embodiment 5:
Recombinate the preparation fermentation medium components and its parts by weight of the engineering bacteria product of fish interferon are as follows: 100 parts of sucrose, ferment
30 parts of female powder, 5 parts of peptone, 15 parts of urea, 3 parts of brewer's wort, KH2PO44 parts, K2HPO4·3H22.5 parts of O, MgSO4·7H2O
0.1 part, ZnSO4·7H20.0026 part of O, MnSO4·4H20.012 part of O, 0.004 part of biotin.Remaining step and method and
Embodiment 3 is consistent.
It recombinates expression quantity of the fish interferon in yeast cells and reaches 20.7%, activity reaches 93U/mg albumen.
It recombinates expression quantity of the fish interferon in yeast cells and reaches 28.9%, activity reaches 93U/mg albumen.
By embodiment 3 and embodiment 5 it is found that the addition of fermentation medium Mid-Heaven Gate aspartic acid can be improved recombination recombination fish
The expression quantity and yield of interferoid；By embodiment 3 and embodiment 4 it is found that in PCR reaction system n,N-dimethylacetamide and
There is the expression quantity and yield that can be improved recombination fish interferon in the special of fatty diglycollic amide.
Embodiment 6:
Grass carp interferon yeast powder is recombinated to the immunoprotection of crucian
Test material
It tests grass carp and is purchased from Zhejiang Institute of Fresh Water Aquatic Products, specification is 12.5 ± 2.8g/ tail；It tests crucian and is purchased from Zhejiang Province lake
State city brocade mountain fish seeding ground, specification 21.2 ± 5.3g/ tail.After material fish is temporarily supported 5 days in 23 ± 1 DEG C of pond, acute poison is carried out
Property test.
Recombination grass carp interferon yeast powder is 3 engineering bacteria product of embodiment.
Test method
The suitable healthy crucian supported two weeks is randomly divided into 4 groups, 3 groups are test group, and 1 group is control group, every group of 80 tails.Test group is pressed
The 2% of weight is fed to tested crucian, and it is crucian total weight 2% that we, which feed quality of the fodder to crucian daily, and makes crucian
The quality for the recombination grass carp interferon yeast powder that every gram of fish body rephotography enters is 3000 mg/kg fish body weights, is fed daily once, even
It is continuous to feed 4 days.Control group feeds the feed of identical weight.
Poly I:C challenge test
After crucian continuously feeds 4 days, every tail grass carp artificial dye of 100 μ l Poly I:C (500 μ g/ml) of row intraperitoneal injection simulation
Poison.Per at least observing for 24 hours three times, death toll is recorded, 96h is carried out and observes and records, calculating relative immunity protective rate, RPS=(1- exempts from
The epidemic disease group death rate/control group death rate) × 100%, the results are shown in Table 1.
Table 1 recombinates fish interferon yeast powder to the immunoprotection result of crucian
Table 1 recombinates fish interferon yeast powder to the immunoprotection result of crucian
As shown in Table 1, for the death rate of test group group crucian well below control group, average survival improves 55.42%, exempts from relatively
Epidemic disease protective rate RPS shows to feed 3 engineering bacteria product of embodiment in enhancing crucian confrontation poly I:C virus really up to 65.20%
Play protective effect.
Embodiment 7:
Application of the engineering bacteria product in grass carp cultivates
Test carries out in 6-9 month, cultivation grass carp net cage is divided into 6 groups, 3 groups of net cages are test group, and 3 groups are control group, test
Group is fed using the feed (per kilogram feed addition product 50mg containing engineering bacteria) of the 3 engineering bacteria product containing embodiment, and control group is thrown
Equivalent blank feed is fed, is continuously fed 8 weeks, the natural occurrence death rate is counted, relative immunity protective rate is calculated, as a result such as 2 institute of table
Show；
Application test result of the 2 engineering bacteria product of table in grass carp cultivates
As shown in Table 2, the disease incidence of test group group grass carp is remarkably decreased, and average survival improves 28.64%, relative immunity
Protective rate RPS shows that the immunity and disease resistance ability of grass carp can be enhanced by feeding 3 engineering bacteria product of embodiment up to 86.28%,
The final survival rate for improving grass carp.
Embodiment 8:
Application of the engineering bacteria product in perch cultivates
Test carries out in 6-9 month, cultivation grass carp net cage is divided into 6 groups, 3 groups of net cages are test group, and 3 groups are control group, test
Group is fed using the feed (per kilogram feed addition product 50mg containing engineering bacteria) of the 3 engineering bacteria product containing embodiment, and control group is thrown
Equivalent blank feed is fed, is continuously fed 8 weeks, the natural occurrence death rate is counted, relative immunity protective rate is calculated, as a result such as 3 institute of table
Show；
Application test result of the 3 engineering bacteria product of table in perch cultivates
As shown in Table 3, the disease incidence of test group group perch is remarkably decreased, and average survival improves 27.33%, relative immunity
Protective rate RPS shows that the immunity and disease resistance ability of perch can be enhanced by feeding 3 engineering bacteria product of embodiment up to 87.33%,
The final survival rate for improving perch.
Embodiment 9:
Application of the engineering bacteria product in shrimp culture
Test carries out in 6-9 month, and Shrimp Culturing net cage is divided into 6 groups, and 3 groups of net cages are test group, and 3 groups are control group,
Test group is fed using the feed (per kilogram feed addition product 35mg containing engineering bacteria) of the 3 engineering bacteria product containing embodiment, is compareed
Group feeds equivalent blank feed, continuously feeds 8 weeks, counts the natural occurrence death rate, calculates relative immunity protective rate, as a result such as table
Shown in 4；
Application test result of the 4 engineering bacteria product of table in Culture of Penaeus Chinensis
As shown in Table 4, the disease incidence of test group group Chinese prawn is remarkably decreased, and average survival improves 12.50%, relatively
Immune protective rate RPS shows that feeding 3 engineering bacteria product of embodiment can enhance the immunity of Chinese prawn and diseases prevention resists up to 39.16%
Sick ability, the final survival rate for improving Chinese prawn.
Routine operation in operating procedure of the invention is well known to those skilled in the art, herein without repeating.
Technical solution of the present invention is described in detail in embodiment described above, it should be understood that the above is only
For specific embodiments of the present invention, it is not intended to restrict the invention, all any modifications made in spirit of the invention,
Supplement or similar fashion substitution etc., should all be included in the protection scope of the present invention.
Claims (8)
1. recombinating the engineering bacteria of fish interferon, it is characterised in that: the engineering bacteria is with recombination fish interferon gene
The Wine brewing yeast strain INVSc1/pYES2-GcIFN of IFN-pYES2.
2. recombinating the construction method of the engineering bacteria of fish interferon, it is characterised in that: the construction method specifically includes following step
It is rapid:
Step 1:poly I:C induces grass carp, extracts total serum IgE, reverse transcription is at cDNA template, and PCR amplification is to get salmo IFN base
Because of GcIFN segment；
Step 2: double digestion GcIFN segment is recombined into the pYES2 carrier of digestion, construction recombination plasmid pYES2-GcIFN, choosing
Take positive colony；
Step 3: the positive colony plasmid electrotransformation after identification being imported in saccharomyces cerevisiae INVSc1 bacterial strain, Yeast engineering bacteria is obtained
INVSc1/pYES2-GcIFN。
3. the construction method of the engineering bacteria of recombination fish interferon according to claim 2, it is characterised in that: the step
PCR reaction system in rapid 1 are as follows: 10 × Ex Taq Buffer 5ul, dNTP Mixture (each 2.5mM) 4ul, TaKaRa Ex
Taq (5U/ul) 0.25ul, template DNA 2.5ng, IFN-F1 (20uM) 1ul, IFN-R1 (20uM) 1ul, sterile purified water
Add to 50ul, PCR response parameter are as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 35
A circulation, last 72 DEG C extend 8min eventually.
4. the construction method of the engineering bacteria of recombination fish interferon according to claim 2, it is characterised in that: the step
Foreign gene is inserted in pYES2 plasmid in rapid 2HindIII andXhoBetween I restriction enzyme site, deletion clip size is 82bp.
5. recombinating the preparation method of the engineering bacteria product of fish interferon, it is characterised in that: the engineering bacteria after activation is carried out one
Grade culture, second level culture and fermentation tank culture obtain yeast thallus, then by yeast thallus through clasmatosis, low temperature drying, crushing
Pulvis product obtained is engineering bacteria product afterwards, contains asparatate in the fermentation tank culture culture medium.
6. the preparation method of the engineering bacteria product of recombination fish interferon according to claim 5, it is characterised in that: institute
State fermentation medium components and its parts by weight are as follows: 90-110 parts of sucrose, 25-35 parts of yeast powder, 4-6 parts of peptone, urea 13-16
Part, 2-4 parts of brewer's wort, 0.12-0.2 parts of asparatate, KH2PO43-5 parts, K2HPO4·3H22-3 parts of O, MgSO4·7H2O
0.08-0.12 parts, ZnSO4·7H20.002-0.003 parts of O, MnSO4·4H20.01-0.015 parts of O, biotin 0.003-
0.005 part.
7. the preparation method of the engineering bacteria product of recombination fish interferon according to claim 5, it is characterised in that: described
Dextrorotation asparatate in asparatate containing 0.32-0.42%.
8. the preparation method of the engineering bacteria product of recombination fish interferon according to claim 5, it is characterised in that: described
Fermentation tank culture step are as follows: by second level kind by 8-12%(V/V) inoculum concentration be inoculated into fermentor, under conditions of 28-32 DEG C
Culture reaches 0.55-0.62 to OD600, and the IPTG for inducing final concentration of 0.58-0.62mmol/L is added, then 20-30 DEG C,
Fiber differentiation 3-5h under conditions of 200-300rpm, is collected after centrifugation thallus, and distilled water is cleaned to get yeast thallus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810658535.6A CN108998384A (en) | 2018-06-25 | 2018-06-25 | Recombinate the engineering bacteria of fish interferon and its preparation method of product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810658535.6A CN108998384A (en) | 2018-06-25 | 2018-06-25 | Recombinate the engineering bacteria of fish interferon and its preparation method of product |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108998384A true CN108998384A (en) | 2018-12-14 |
Family
ID=64602093
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810658535.6A Pending CN108998384A (en) | 2018-06-25 | 2018-06-25 | Recombinate the engineering bacteria of fish interferon and its preparation method of product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108998384A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891087A (en) * | 2022-04-26 | 2022-08-12 | 浙江皇冠科技有限公司 | Grass carp interferon, grass carp interferon mutant and application and product thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1974775A (en) * | 2006-12-08 | 2007-06-06 | 浙江大学 | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application |
| CN104686845A (en) * | 2015-03-10 | 2015-06-10 | 浙江皇冠科技有限公司 | Nature feed additive for microorganism-derived aquatic animals, and application of nature feed additive |
| CN106676151A (en) * | 2016-08-25 | 2017-05-17 | 芜湖英特菲尔生物制品产业研究院有限公司 | Preparation method of recombinant porcine interferon gamma-finished product lyophilized preparation |
-
2018
- 2018-06-25 CN CN201810658535.6A patent/CN108998384A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1974775A (en) * | 2006-12-08 | 2007-06-06 | 浙江大学 | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application |
| CN104686845A (en) * | 2015-03-10 | 2015-06-10 | 浙江皇冠科技有限公司 | Nature feed additive for microorganism-derived aquatic animals, and application of nature feed additive |
| CN106676151A (en) * | 2016-08-25 | 2017-05-17 | 芜湖英特菲尔生物制品产业研究院有限公司 | Preparation method of recombinant porcine interferon gamma-finished product lyophilized preparation |
Non-Patent Citations (3)
| Title |
|---|
| ALTMANN, SM等: "Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio", 《JOURNAL OF VIROLOGY》 * |
| 李华等: "《葡萄酒微生物学》", 30 September 2003 * |
| 林慧芳: "鱼类干扰素和核因子45基因克隆、结构分析及其在酵母中表达的研究", 《中国优秀硕士学位论文全文数据库（电子期刊）基础科学辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891087A (en) * | 2022-04-26 | 2022-08-12 | 浙江皇冠科技有限公司 | Grass carp interferon, grass carp interferon mutant and application and product thereof |
| CN114891087B (en) * | 2022-04-26 | 2023-08-11 | 浙江皇冠科技有限公司 | Grass carp interferon, grass carp interferon mutant, application and product thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105801707B (en) | A kind of hemorrhagic disease of grass carp oral vaccine and its preparation and application | |
| CN100577806C (en) | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application | |
| CN102304484B (en) | New strain of pseudoalteromonas flavipulchra and use thereof | |
| CN104996364A (en) | Artificial culture method of fly larvae | |
| CN105010807A (en) | Living fly maggot liquid protein leech culturing feed and preparation method thereof | |
| CN111549031A (en) | Molecular breeding method for thickening muscle of grass carp and black carp | |
| CN111560401A (en) | Molecular breeding method for thickening interpuscular spurs of erythroculter ilishaeformis and megalobrama amblycephala | |
| CN108998384A (en) | Recombinate the engineering bacteria of fish interferon and its preparation method of product | |
| CN106577371A (en) | Finless eel breeding pilot feeding method employing baits of different gradient proportions | |
| CN102161974A (en) | Preparation method and application of Vibro harveyi outer membrane protein (ompK) antigen as well as strain for expressing the same | |
| CN102776222B (en) | Preparation and application of fused oral interferon for fowl | |
| CN102614509A (en) | Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp | |
| CN102740707B (en) | Endogenous antiviral complex-probiotic-preparation for prawn | |
| CN116548374A (en) | Batch artificial breeding method for rana nigromaculata seedlings | |
| CN108949598A (en) | Recombinate the engineering bacteria of Fish leukocyte interleukin -2 and its preparation method of product | |
| CN102550864B (en) | Preparation method for function feed additive capable of resisting bird flu | |
| CN109006605A (en) | A kind of Penaeus Vannmei fresh water ecological cultivation method | |
| CN107827968B (en) | Polypeptide separated from hexagrammos latiuscus | |
| CN104996777A (en) | Turtle blood attractant leech culture liquid feed and preparation method thereof | |
| CN104996772A (en) | Sour, sweet and delicious liquid feed for young leech cultivation and preparation method of liquid feed | |
| CN101343624B (en) | Recombined human growth hormone gene bacilliform virus, preparation and application thereof | |
| CN104630153A (en) | Porcine pseudorabies virus strain and application thereof | |
| JPH0646763A (en) | Feed for fish and shellfish | |
| CN108949802A (en) | A kind of high yield CpG ISS engineering bacteria construction method and purposes | |
| CN109006603A (en) | The high yield polyculture method of Penaeus Vannmei and Macrobrachium rosenbergii |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |