CN100577806C - Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application - Google Patents

Abstract

The present invention discloses one kind of recombinant plasmid containing grass carp interferon gene with the nucleotide sequence as shown in SEQ ID No. 1. The present invention also discloses engineering bacterium INVSC1-pYES2-IFN as one kind of Saccharomyces cerevisiae in the preservation number of CGMCC1847. The engineering bacterium is used for aquatic animals to resist viruses. The present invention also discloses the application of protein coded by the recombinant plasmid containing grass carp interferon gene with the nucleotide sequence as shown in SEQ ID No. 1 for aquatic animals to resist viruses.

Description

Contain recombinant plasmid, engineering bacteria and the application thereof of grass carp interferon gene

Technical field

The present invention relates to aquatic living things technology and aquiculture disease Prevention Technique field.Be particularly related to a kind of Protocols in Molecular Biology that utilizes, clone's grass carp interferon gene, structure contains the expression of recombinant yeast plasmid of this gene, and in yeast saccharomyces cerevisiae, obtain to efficiently express, utilize the Yeast engineering bacteria of expressing Interferon, rabbit, directly be developed into the disease-resistant feed additive, be applied to disease control of aquatic animal.

Background technology

Along with the fast development of fish production, aquatic animal disease becomes increasingly conspicuous, and has become the global problem that current serious influences the healthy Sustainable development of culture fishery, and is especially outstanding in China.In recent years, the due to illness harmful culture fishery direct economic loss that causes of China is annual to surpass 10,000,000,000 yuan, and soaring year by year.But for a long time, lack effective pest control method always; Various microbiotic, sterilant abuse cause breeding environment and fishery products severe contamination, and aquatic food safety is subjected to serious threat, and the resistance of microbiotic generation has simultaneously been aggravated the generation of aquatic animal disease again, forms vicious cycle.Promulgation along with China joined WTO and food safety method, standard to environment and food safety is more and more higher, current large quantities of microbiotic is forbidden by explicit order, disease control of aquatic animal has faced the predicament that no medicine can be executed, therefore develop natural, safe, the disease control of aquatic animal medicine is extremely urgent efficiently, it is to supporting China's water industry healthy and sustainable development, guarantee food security in China, improve national health quality, lead the innovation of China's fishery economic development and aquatic science all extremely important and very urgent, have great economic society meaning.

The development and use of the important immune disease-resistance factor of aquatic animal are the effective ways that fundamentally solves disease control of aquatic animal, ensures aquatic food safety.Yet because long-term next relatively weaker to the research of the aquatic animal immune disease-resistance factor both at home and abroad, particularly the crucial disease-resistant factor of isolation identification is very limited, and therefore, the Application and Development research in relevant this field also almost is blank.

(Interferon is the non-specific immunity factor of most critical in the body natural immunity IFN) to Interferon, rabbit, is that a kind of that body is subjected to that the secretion of infection such as virus back produces has antiviral and glycoprotein immunoregulatory activity.Yet, its research and development is used mainly be seen in the clinical and part higher animal of physianthropy at present, as livestock and poultry.Research as vertebrate fish interferon such as low is also less, shows also few to the understanding of its biological property and immunologic function, also almost is blank to its Application and Development research in disease control of aquatic animal particularly.Because have bigger ethnic specificity difference between human (comprising higher animal) and fish, existing human interferon preparation is not suitable for aquatic animals such as fish; Be in particular in that human interferon is active low in fish, particularly human interferon is applied to aquatic animal potential food safety hazard, and therefore, the Interferon, rabbit of developing aquatic animal self is a urgent subject.Requiring different with the development of physianthropy Interferon, rabbit is that aquatic animal requires easy to use, with low cost with Interferon, rabbit, actual application value is so just arranged.Medically, can also can prepare recombinant interferon from human leukocyte separating natural Interferon, rabbit by genetically engineered, but because modes such as injection injection are adopted in the use of human interferon, the purity requirement height, cost will improve greatly like this; And the singularity that aquatic products is lived owing to the aquatic animal water body with Interferon, rabbit, should not adopt individual one by one injection injection system, adopt fodder additives to throw something and feed to be desirable and approach easily, simultaneously in order to reduce cost, the natural extract method generally is difficult to realize, therefore adopting recombination and expression techniques is suitable way comparatively.

Summary of the invention

Technical problem to be solved by this invention provides a kind of recombinant plasmid that contains grass carp interferon gene, and contain this plasmid and can efficiently express the proteic saccharomyces cerevisiae engineered yeast of GcIFN, this project bacterium and GcIFN albumen can be used for the antiviral and raising immune disease-resistance ability of aquatic animal.

In order to solve the problems of the technologies described above, the invention provides a kind of recombinant plasmid that contains grass carp interferon gene, this gene has the nucleotide sequence shown in the SEQ ID NO.1.

The present invention also provides a kind of engineering bacteria, this bacterial strain INVSC1-pYES2-IFN is S. cervisiae Saccharomyces cerevisiae, depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center, preservation day: on October 19th, 2006, preserving number: CGMCC1847.

The present invention also provides the application of above-mentioned engineering bacteria in aquatic animal is antiviral.

The present invention also provides the application of a kind of protein in aquatic animal is antiviral, and this protein is that to have a grass carp interferon gene of nucleotide sequence shown in the SEQ ID NO.1 coded.

The inventor system at home and abroad of taking the lead in has carried out the research of GcIFN, successively from grass carp serum and white corpuscle separation and purification ifn protein, systematic study its histocyte source, induce and produce rule, physico-chemical property and immunoloregulation function; And cloned its gene; realized GcIFN albumen efficiently expressing in yeast saccharomyces cerevisiae (expression amount reaches 30%); the GcIFN of having measured yeast expression has the biologic activity identical with natural interferon; and utilize the Yeast engineering bacteria of express interferon in high efficiency; by ultrasonication and air stream drying; be developed into the yeast powder disease-resistant feed additive that contains GcIFN; through disease control of aquatic animal application tests such as fishes and shrimps; obtain good result; showing that GcIFN has generally is applicable to the provide protection of aquatic animal immune disease-resistance; have significant application value, the development and use to this disease-resistant factor at home and abroad still belong to the first time.

The inventor has also taken the lead in the grass carp isolation identification disease-resistant key factor Interferon, rabbit of fish immunity, by systematic study to its biological property and function, the proof fish interferon has the antiviral activity of wide spectrum, simultaneously fish scavenger cell and lymphocyte etc. had tangible activation, function with remarkable adjusting and enhancing body immune level is the aquatic animal disease-resistant factor with important development and application values.

In existing technical field, developed multiple expression system at present, comprised protokaryon and eukaryotic expression system, as bacterium, yeast, animal and plant cells etc.; By comparative analysis, we find that intestinal bacteria and the pichia yeast expression system used always have certain toxicity to aquatic animals such as fish, are not suitable for directly as the disease-resistant feed Application and Development, and the animal and plant cells expression system then needs large scale culturing, the cost height.We adopt the yeast saccharomyces cerevisiae system that GcIFN is developed for this reason, to guarantee its safety non-toxic, because yeast saccharomyces cerevisiae itself can be used as feed, are suitable for throwing something and feeding simultaneously, and the fermentative production cost is low, is the idealized system of aquatic animal active factor Application and Development.

Yeast saccharomyces cerevisiae is mainly used in brewing industry at present, also can be used as yeast feed in addition and is used for fodder industry.Yeast feed is meant and utilizes saccharomycetic metabolism and breeding thalline, by fermentation the high-quality feed of safe, pollution-free, the noresidue that contains thalline and yeast cell meta-bolites made from technology such as drying.Utilize the yeast saccharomyces cerevisiae expression alien gene to have translation post-treatment ability, the exogenous protein of results has to a certain degree folding processing and glycosylation modified, be particularly suitable for expressing eukaryotic gene, in drug developments such as hepatitis B vaccine, insulin human, Filgrastim, people's blood vessel statin, used at present, but the application in the fish drug development seldom, utilize it to express Interferon, rabbit, and directly still belong to the first time as the Application and Development of disease-resistant feed.In addition, yeast saccharomyces cerevisiae is applied to produce advantages such as to have a growth and breeding rapid, and technology is simple, can tolerate higher hydrostatic pressure, can scale operation, effectively reduce production costs, and have very strong practicality.

The application in aquatic animal is antiviral of engineering bacteria of the present invention and protein, being embodied in initiative becomes the disease-resistant preparation of a kind of aquatic animal Interferon, rabbit, and is developed into the application of yeast feed additive form; Purpose is to develop China's economic fish natural immunity disease-resistant factor; protection China fish important gene resource; substitute the harmful medicine of abusing in the present fish production of microbiotic, agrochemical; ensure food safety, solving the viral disease of aquatic animal does not simultaneously still have effectively this global problem of control medicine at present.The fish interferon preparation is with the application of fodder additives form, can overcome in the past the medical science interferon formulation and cost an arm and a leg and inject give defectives such as medicine is difficult to apply in aquaculture of aquatic animal.

Aquatic animal immune disease-resistance preparation mentioned above, for containing the expressed GcIFN albumen of grass carp interferon gene expression plasmid Yeast engineering bacteria, or the Yeast engineering bacteria bacterium powder of expression GcIFN, the ratio of the shared yeast total protein of interferon protein is 20%～30%.Therefore this aquatic animal immune disease-resistance preparation has antiviral function and immunomodulatory biological function, in grass carp ZC7901 kiss terminal cell and the strain of CP80 embryonic cell, has inhibition grass carp hemorrhage virus (GCHV) (GCHV) activity, its titre (Log ₂CPEI ₅₀/ 0.1ml) reach more than 11.29 ± 0.18; Grass carp dorsal fin subcutaneous injection in one age interferon protein (10 μ g/ tail) is after 12 hours, artificial challenge GCHV (500TCID ₅₀)/tail, (Relative Percent Survival RPS) can reach 59.42% to the premunition protection ratio; One feed (10mg GcIFN/Kg feed) that grass carp was fed and contained Interferon, rabbit age was fed for 1 week artificial challenge GCHV (500TCID continuously ₅₀)/tail, the premunition protection ratio can reach 29.58%; The yeast powder of expressing GcIFN is added into mixed bait (Interferon, rabbit content is 10mg GcIFN/Kg in the bait), feed Penaeus vannamei and Chinese prawn, every day 2 times, fed continuously 7 days, artificial challenge's white spot syndrome virus (WSSV), the premunition protection ratio reaches 11.60% and 10.40% respectively; The scavenger cell of handling through Interferon, rabbit has significant enhancing and engulfs germicidal action to saccharomycetic, Interferon, rabbit also has tangible promotion propagation transformation to peripheral blood and head-kidney T, bone-marrow-derived lymphocyte simultaneously, disease-resistant test to cultured fishes shows, use contains the experimental group grass carp and the perch of Interferon, rabbit feed, surviving rate all obviously improves, and immune protective rate reaches 62.39% and 48.61% respectively; Disease-resistant test to shrimps in culture shows, uses the experimental group Penaeus vannamei and the Chinese prawn that contain the Interferon, rabbit feed, and surviving rate obviously improves, and immune protective rate reaches 30.80% and 20.99% respectively, shows that IFN can improve the immune disease-resistance ability of fish and shrimp.

The disease-resistant preparation of aquatic animal Interferon, rabbit provided by the present invention, its advantage mainly shows: the Interferon, rabbit that express with yeast saccharomyces cerevisiae (1) is a kind of immune disease-resistance factor that derives from animal itself, not only has biologic activity, and safety non-toxic, cheap; (2) the bacterium powder of saccharomyces cerevisiae engineered yeast preparation can be fit to throw something and feed directly as feed, has overcome the difficulty that aquatic animal can't drug administration by injection; (3) interferon protein not only has antivirus action, also has immunoloregulation function, can strengthen the resistance against diseases of aquatic animal self; (4) this preparation has the resistant effect of wide spectrum, also can be used for the disease control of multiple aquatic animal such as perch, prawn except that grass carp.

Beneficial effect of the present invention, specific as follows:

The present invention has taken the lead at home and abroad isolation identification GcIFN immune factor, by systematic study to this factor biological property and function, confirm that Interferon, rabbit is the crucial immune disease-resistance factors of fish, on this basis, by clone's grass carp interferon gene and structure GcIFN efficient expression plasmid, realized this factor efficiently expressing in yeast saccharomyces cerevisiae, utilize the Yeast engineering bacteria of expressing Interferon, rabbit, through suitable art breading, be developed into the disease-resistant feed additive, in disease control of aquatic animal such as fish and shrimps, carry out disease-resistant test, obtain good result.

Fish interferon is as a kind of important immune disease-resistance factor, has great development and application values, it is as safe, efficient, the natural disease control of aquatic animal medicine of a kind of alternative microbiotic and agricultural chemicals, can open up new way for the disease control of perplexing China's fishery development for a long time, to promoting the healthy Sustainable development of China's water industry, guarantee food safety, improve national health quality, lead the innovation of China's fishery economic development and aquatic science to have important economical, societal benefits.Achievement in research has the most important theories meaning to molecular composition and mechanism of action, immune factor molecule origin and the evolution rule that discloses the fish immunity system simultaneously.

Description of drawings

Fig. 1 is the structure of the recombinant expression plasmid IFN-pYES2 of an embodiment of the present invention.

Fig. 2 is that the bacterium colony PCR of the goal gene of an embodiment of the present invention identifies figure.

Fig. 3 is that the recombinant plasmid I FN-pYES2 of an embodiment of the present invention identifies figure through Hind III and Xho I double digestion, and it is identical with the expection size that the disconnected size of enzyme section is about 550bp.

Fig. 4 is the SDS-PAGE analysis chart of the pYES2-IFN/INVSC1 abduction delivering of an embodiment of the present invention; The arrow indication is a target protein among Fig. 4, and its molecular weight is 38000Da; The 3rd classifies empty carrier as, and the 4th, 5,6 row are respectively the expression of the interferon protein of inducing 14,38,60 hours, and expression amount is the highest when 14h induces.

Fig. 5 is time gradient and the concentration gradient effect synoptic diagram that the GcIFN of an embodiment of the present invention induces the Mx gene, and the result shows that the amount of inducing of Mx increases along with the increase of the amount of the IFN concentrated solution that adds; And adding under the prerequisite of the amount of inducing equally, behind the highest 24 hours of inducing peak value to appear to add behind the inductor, to beginning to go down in 36 hours.

Embodiment

Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail:

Embodiment 1, grass carp interferon gene clone

From grass carp dorsal fin subcutaneous injection 0.5ml poly I:C (available from the pharmaceutical factory, Tianjin), 26 ℃ of water temperatures are injected once after inducing 12hr again, get after 12 hours about head-kidney 10 grams, and (Gibco BRL USA) extracts total RNA, and the extracting method by specification carries out with TRizol.(TaKaRa USA) carries out reverse transcription and pcr amplification to use reverse transcription test kit RNAPCR kit (AMV) Ver3.0 then.Primer sequence is as shown in table 1.

(use PCR product purification test kit DNA Gel Extraction Kit, V-gene) insert T carrier (TA clone test kit is given birth to the worker available from Shanghai) behind the amplified production purifying.Operation steps all to specifications shown in.Connect product transformed into escherichia coli TOP10, the evaluation of checking order of screening positive recombinant.Conversion and authentication method carry out according to " molecular cloning experiment guide ".Sequences Design 5 ' the RACE and 3 ' the RACE primer (its sequence is as shown in table 1) that obtain according to evaluation, use TaKaRa 5 '-Full RACE Core Set and TaKaRa 3 '-described to specifications step of Full RACE Core Set to carry out 5 ' RACE and 3 ' RACE amplification, carry out the splicing-in of sequence at last, obtain the cDNA sequence of long 1191 bases.Analyze the long 543bp of open reading frame ORF as can be known with NCBI ORFFinder, 180 amino acid of encoding.The long 34bp of all the other 5 ' UTR, the long 614bp of 3 ' UTR.

Table 1. grass carp interferon gene pcr amplification the primer (5 '-3 ')

IFN ORF amplimer	IFN-F1 IFN-R1	AAGGAAATGGGTGGAAAATAT TTGCGATGATGTCCATCCTC
			IFN 3 ' RACE primer	IFN-3-F3 3’Adaptor primer	ACCTTCAGAGGATGGACATGAT CTGATCTAGAGGTACCGGATCC
IFN 5 ' RACE primer	RT A1 A2 S1 S2	(P)-GATGACTGCCTG AGGTGGAAAATATCCTGAGGG AAGGTGTCATTTCCAGGAGC GAGCCATTCGCAAGCAGAGC CGCAAGCAGAGCATTGACCC

Embodiment 2, grass carp interferon gene sequencing and analysis

Analyze the cDNA sequence of gained among the embodiment 1 with NCBI ORF Finder, the long 543bp of open reading frame ORF as can be known, 180 amino acid of encoding.The long 34bp of all the other 5 ' UTR, the long 614bp of 3 ' UTR; Carry out the analysis of potential function site and carry out the analysis of signal attitude with PROSITE database with signal peptide analysis software SignalPprogram (version 3.0), the conclusion that draws is that its albumen iso-electric point is 9.73, and this gene have one long be 22 each amino acid whose signal peptide, indicating that its mature peptide is 159 amino acid; Carry out the site with Prosite and analyze, find that this gene has 2 N-terminal, 14 acidylate site: GqcsAC and GTkvSF simultaneously; 2 protein kinase ii phosphorylation sites: SacE ShkE; N-terminal glycosylation site a: NESL; Protein kinase C phosphorylation site a: ShK; Two karyomit(e)s are examined leader sequence: Kkinrhfkilkknlkkk and Kkeysaqaweqirravk; With software ClastalW gene order of the present invention and other eight kinds of biologies are comprised that the IFN homologous gene sequence of people, mouse, atlantic salmon, chicken, zebra fish, crucian, Fugurubripes and catfish carries out the multisequencing comparison, the result shows that the homogenic aminoacid sequence of IFN homology in the species of different fish is higher.Wherein, grass carp and zebra fish and crucian are all Cyprinidae, and there is very high homology in their aminoacid sequence, reaches more than 90%.

The structure of embodiment 3, GcIFN expression plasmid

According to the interferon gene sequences Design expression vector establishment primer that embodiment 1 obtains, sequence is as follows:

Upstream primer is initial from GcIFN ATG, and 5 ' end contains Hind III restriction enzyme site and Kozak sequence A CC

gc-IFN-F3：5’-CCC AAG CTT GGG ACC ATG GAA ACT CAA ATGTGG-3’

Downstream primer autotermination cipher word TAA begins, and 5 ' end adds Xho I restriction enzyme site

gc-IFN-R3：5’-GGCGAGCTCGCCTTATCGTCTGTTGGCAATGC-3’

Carry out pcr amplification according to method among the embodiment 1, amplified production is carried out double digestion with Hind III and Xho I (TAKARA company), be inserted among the expression vector pYES2, transformed into escherichia coli TOP10, according to the alkaline lysis method of extracting recombinant expression plasmid in " molecular cloning experiment guide ", the evaluation of checking order, the sequencing result proof obtains the correct recombinant expression plasmid of direction of insertion, contain complete GcIFN gene, the about 560bp of length comprises that length is the signal peptide of 22 aa.The gene 5 ' end has Hind III restriction enzyme site, and 3 ' end contains Xho I restriction enzyme site.The construction of recombinant plasmid scheme as shown in Figure 1.

Saccharomyces cerevisiae engineered yeast structure, screening and the abduction delivering thereof of embodiment 4, expression GcIFN

4.1, recombinant plasmid electricity transformed yeast cell

The a small amount of plasmid of alkaline lysis extracting, method is referring to " molecular cloning experiment guide ".Preparation yeast competent cell, method is as follows: a mono-clonal INVSC1 is in 2ml YPD liquid nutrient medium in the picking YPD substratum, and 30 ℃, 250～300rpm shaking culture is spent the night; The SC suspension that takes a morsel is coated with the SC flat board, identifies phenotype; Get 200ul and be seeded to the triangle that 100ml contains the YPD substratum and shake in the bottle, 30 ℃, 250～300rpm shaking culture spend the night to OD600 be 1.3～1.5; Cell ice bath 15min stops growth; 4 ℃ of 3000rpm5min centrifugal collecting cells, resuspended with the sterilized water of 100ml precooling; 4 ℃ of 3000rpm 5min centrifugal collecting cells, resuspended with the sterilized water of 50ml precooling; 4 ℃ of 3000rpm 5min centrifugal collecting cells, resuspended with the 1M sorbyl alcohol of 4ml precooling; 4 ℃ of 2000rpm 5min centrifugal collecting cells, resuspended with the 1M sorbyl alcohol of 100ul precooling, final volume is about 200～300ul, presses the packing of 40ul/ pipe, 4 ℃, preserves a week; After obtaining the yeast competent cell, change recombinant plasmid over to yeast saccharomyces cerevisiae with the electricimpulse method for transformation, method is as follows: with 40ul yeast suspension and the electroporation pipe (0.2cm) that is mixed in precooling less than the 5ul plasmid DNA, at the bottom of the jog pipe, to guarantee sample and aluminum pipe contact both sides, ice bath 5min; Pulse parameter: V=1.5kV, 25uF, 200Ohms, 4-5ms; Add the 1M sorbyl alcohol of 1ml precooling after electricity transforms at once, be transferred to sterile eppendorf tubes with aseptic transfer pipet; Select to cultivate every 200ul coating one flat plate in the coating SC-U substratum; Flat board as for 30 ℃ of cultivations, is occurred until single bacterium colony.

4.2, the screening positive transformant

(sky is the epoch, DP112) to extract yeast plasmid DNA with the little extraction reagent kit of yeast plasmid.With the yeast plasmid that obtains transformed into escherichia coli TOP10 again, alkaline lysis extracting plasmid (method is referring to " molecular cloning experiment guide ") is identified positive transformant with methods such as PCR and Hind III, Xho I double digestions, and qualification result is shown in accompanying drawing 2,3.

4.3, the abduction delivering of recombinant interferon

Choose single bacterium colony recon and contain in the 15ml SC-U substratum of 2% raffinose, 30 ℃ of shaking culture are spent the night; Get overnight culture and survey OD ₆₀₀Be worth, calculate the quantity of the overnight culture of required adding in the 50ml inducing culture thus, the inducing culture initial OD values need reach 0.4; Measure overnight culture, 4 ℃, 1, the centrifugal 5min of 500g, collecting cell according to what calculate gained; With 1～2ml inducing culture re-suspended cell, inoculation and 50ml inducing culture, 30 ℃ of shaking culture; Collecting cell in 0,2,4,6,8,10,12 hour.Each period sampling 5ml surveys OD respectively ₆₀₀Value; 4 ℃, the centrifugal 5min of 1500g, collecting cell; Abandon supernatant, with 500ul aqua sterilisa re-suspended cell; With cell transfer to 1.5ml eppendorf pipe, high speed centrifugation 30sec; Abandon supernatant ,-80 ℃ of preservations.

4.4, the evaluation expressed of interferon protein

With 500ul lysate (BioDev-Tech, DB001-12) re-suspended cell, 4 ℃ of centrifugal 5min of 1500g, collecting cell; Abandon supernatant, use the lysate re-suspended cell, OD ₆₀₀Value is transferred to 50-100, adds isopyknic granulated glass sphere (Sigma G-8772) vibration 30sec, and ice bath 30sec repeats 4 times the cracking cell, gets part microscopy observation of cell crushing effect then; High speed centrifugation 10min; Drawing supernatant liquor is transferred in another clean centrifuge tube; Add SDS-PAGE sample buffer to final concentration and be 1 *, boil 5min; Get 20ul lysate application of sample, carry out the SDS-PAGE electrophoresis,, identify the band of expressing protein through coomassie brilliant blue staining.The result as shown in Figure 4.

The biological function of embodiment 5, interferon protein is identified

5.1 the extraction of interferon protein

Adopt non-denatured gradient PAGE (6%～20%) electrophoretic separation interferon protein (method is referring to " molecular cloning experiment guide "), electrode solution is 0.025mol/L Tris-0.192mol/Lgly (pH8.3), behind the 100V electrophoresis 6 hours, cut the dyeing of Partial Protein band, cut the gel band that contains ifn protein according to coloration result then, pack in the dialysis tubing of handling, add appropriate amount of buffer solution, put into the electrophoresis elution groove, 25mA4 ℃ of low temperature electrophoresis 2-3 hour, collect interferon protein liquid, frost drying concentrates, and uses high performance liquid chromatography (HPLC) purifying again, with Tianjin, island Shim-Pack DIOL-150 gel separation post (column length 25cm, diameter 0.79cm), elutriant is for containing 0.2mol/L Na ₂SO ₄10mmol/L PB damping fluid (pH7.2), flow velocity 1mL/min detects wavelength 280nm, the Interferon, rabbit sample concentrates through frost drying, is stored in-20 ℃, is used for mensuration such as active and function.Suppress (CPEI with the half cytopathy before using ₅₀) method records it and active be 105U/ml, is mixed with 5000U/ml, 500U/ml, 250U/ml, 50U/ml and 5U/ml with L-15 or TC-199 nutrient solution during use.

5.2 inducing the Mx expressive function identifies

Mx albumen is the important factor of Interferon, rabbit signal path downstream performance antivirus action, and inducing the proteic expression of Mx is the important indicator of identifying the Interferon, rabbit function.The interferon protein that extracts is joined in the grass carp ZC7901 cell, carry RNA (method is with embodiment 1) respectively at sampling in 12 hours, 24 hours, 36 hours, with RT-PCR method identification of M x expression of gene (accompanying drawing 5).

Primer sequence is as follows:

Upstream primer (Mx-F): 5 '-ACATGTCTCCAAGCACTTCTT-3 '

Downstream primer (Mx-R): 5 '-TATTGACTGTTCTGACCACCG-3

5.3 the antiviral activity of interferon protein is measured

5.3.1 the antiviral activity in the fish cell level is measured

Adopt the half cytopathy to suppress (CPEI ₅₀) method carries out, grass carp ZC7901 and the strain of CP80 embryonic cell after the dilution interferon protein effect of difference, add 100TCID respectively ₅₀Grass carp hemorrhage virus (GCHV) GCHV and grass carp picornavirus (GCPV) are attacked, and are an interferon activity unit can suppress 50% cytopathic high dilution, use Log ₂CPEI ₅₀/ 0.1ml represents.The result is as shown in table 2.

The determination of activity of table 2.GcIFN in ZC7901 and CP80 cell

* use 100TCID ₅₀GCHV (TCID ₅₀=10 ^5.8/ 0.1ml) and GCPV (TCID ₅₀=10 ^5.2/ 0.1ml) infect

* IFN titre: Log ₂CPEI ₅₀/ 0.1ml, (X ± SD), n=5

5.3.2 the antiviral activity of fish body level is measured

5.3.2.1 give the disease-resistant test of Interferon, rabbit by injecting pathway

One grass carp in age (10～12cm is long), dorsal fin subcutaneous injection IFN albumen, 0.1ml (10 μ g)/tail, artificial challenge GCHV (500TCID after 12 hours ₅₀)/tail, 28 ℃ of water temperatures raised for 2 weeks, the statistics death rate of the onset, calculating premunition protection ratio (Relative Percent Survival, RPS), RPS=(1-immune group mortality ratio/control group mortality ratio) * 100%, control group is injected blank PBS liquid.The result is as shown in table 3, and IFN has tangible disease resisting effect by injection system, and the surviving rate of its injection group improves 47.68% than control group, and immune protective rate reaches 59.42%.

The disease-resistant test-results of table 3. fish body injection GcIFN

5.3.2.2 give the disease-resistant test of Interferon, rabbit by the approach of feeding

One feed (the per kilogram feed adds GcIFN engineering bacteria powder 33mg, the expression amount 30% of interferon protein in yeast, i.e. 10mg GcIFN/Kg feed) that grass carp was fed and contained Interferon, rabbit age was fed for 1 week artificial challenge GCHV 0.1ml (500TCID continuously ₅₀)/tail, 28 ℃ of water temperatures raised for 2 weeks, and the statistics death rate of the onset calculates the premunition protection ratio.Control group fed does not contain the normal feed of Interferon, rabbit.The result is as shown in table 4, by the mode of feeding, tangible disease resisting effect is arranged also, and the surviving rate of its test group improves 23.92% than control group, and immune protective rate reaches 29.58%.

Table 4. fish body is fed and is contained the disease-resistant test-results of GcIFN feed

5.3.3 the shrimps antiviral activity of GcIFN test

Adopt the bait addition manner to test, the yeast powder of expressing GcIFN is added into mixed bait, Interferon, rabbit content is 10mg GcIFN/Kg bait in the bait, and the experiment prawn is adopted Chinese prawn and Penaeus vannamei respectively.Experiment divides 5 groups, and every group 100 tail, control group fed do not contain the normal bait of Interferon, rabbit.Feed every day 2 times, fed continuously 7 days, then artificial challenge's white spot syndrome virus (WSSV).Virus infection adopts the method for the poison bait of throwing something and feeding to carry out, and every day, each was was once thrown something and fed 3 days continuously sooner or later, kept 20～25 ℃ of water temperatures, and statistics death rate of the onset after 1 week calculates premunition protection ratio RPS.The result is as shown in table 5, and grass carp IFN has tangible immune disease-resistance effect to two kinds of shrimps, and the immune protective rate of test group reaches 11.60% and 10.40% respectively.

Table 5. GcIFN is to the disease-resistant test of Penaeus vannamei and Chinese prawn

Group death toll (tail)	Penaeus vannamei (control group)	Penaeus vannamei (test group)	Chinese prawn (control group)	Chinese prawn (test group)
					Test 1 group	100	90	100	92
Test 2 groups	100	86	100	89
					Test 3 groups	100	89	100	88
Test 4 groups	100	92	100	90
					Test 5 groups	100	85	100	89
On average	100	88.40	100	89.60

RPS(％)

11.60

10.40

5.4 the immunoloregulation function of Interferon, rabbit is measured

5.4.1 GcIFN is to the immunoregulation effect of scavenger cell

Adopt the 34%-51%Percoll density gradient centrifugation to separate grass carp head-kidney scavenger cell, in L-15 nutrient solution (containing 5%FCS, 10% penicillin/streptomycin), cultivated 12 hours for 27 ℃, PBS cleans, expect blue sampling dyeing for 2%, when amount of viable cell reaches 98% when above, add 500U/ml Interferon, rabbit effect 24 hours, adding final concentration respectively after PBS cleans 3 times is 10 ⁵Individual/ml, 10 ⁴Individual/ml, 10 ³Individual/ml and 10 ²Individual/the ml yeast, cultivated 0,3 and 5 hour for 27 ℃, measure saccharomycetic MTT color reaction and scavenger cell bactericidal index (KI), establish simultaneously and do not add the Interferon, rabbit treatment group in contrast.

The result shows that the scavenger cell after Interferon, rabbit activates needs a suitable action time to saccharomycetic engulfing with killing action, and also needing simultaneously has a proper proportion between scavenger cell and yeast.In 105 left and right sides scavenger cells, insert 10 ⁵Or 10 ⁴Individual yeast, and after acting on 5 hours, remaining viable yeast amount with compare obvious minimizing without Interferon, rabbit activated scavenger cell, the sterilizing power utmost point strengthens (seeing Table 6) significantly.

Table 6. Interferon, rabbit is to the regulating effect of grass carp scavenger cell sterilizing power

P＜0.01 t check, with the control group that does not add GcIFN relatively, in the bracket for the KI value (X ± SE, n=5)

5.4.2 the regulating effect that Interferon, rabbit transforms T, bone-marrow-derived lymphocyte

5.4.2.1 Interferon, rabbit is to the lymphocytic regulating effect of T of mitogen PHA and ConA conversion

Adopt the ficoll density gradient centrifugation to separate peripheral blood and head-kidney white corpuscle, adding final concentration respectively after Interferon, rabbit is handled is 0.64mg/ml PHA and 25mg/ml ConA, cultivate after 24 hours for 27 ℃ and carry out the 3H-TdR mark (than degree 20Ci/mmol, concentration 1mCi/ml, mark final concentration 2 μ Ci/ml) labeled cell is used the per minute umber of pulse (CPM) of TRI-CARB 2050 CA type liquid glimmer instrument working samples then.

The result shows that Interferon, rabbit is to PHA and ConA transforms peripheral blood and head-kidney T lymphocyte has tangible regulating effect, shows when lower concentration is handled that significant promoter action is arranged, and high density then has significant inhibitory effect when handling.Interferon, rabbit promotes PHA and the lymphocytic dosage of ConA conversion T to be respectively 500U/ml and 250～500U/ml, and suppressing the LT dosage of T is 5000U/ml, and promotion or the time of suppressing to transform are more than 12 hours and (see Table 7).

Table 7. Interferon, rabbit is to the lymphocytic regulating effect of T of PHA and ConA stimulation

^*0.01＜P＜0.05, ^*P＜0.01 t check (X ± SE, n=5)

5.4.2.2 Interferon, rabbit is to the regulating effect of mitogen LPS and SPA transformed B lymphocytes

Peripheral blood and head-kidney white corpuscle add final concentration respectively after Interferon, rabbit is handled be 125mg/ml LPS and 250mg/ml SPA, cultivates after 24 hours for 27 ℃ and carry out ³H-TdR mark (than degree 20Ci/mmol, dense useless 1mCi/ml, mark final concentration 2 μ Ci/ml) labeled cell is used the per minute umber of pulse (CPM) of TRI-CARB 2050CA type liquid glimmer instrument working sample then.

The result shows that Interferon, rabbit is regulated the rule of SPA and LPS conversion peripheral blood and head-kidney bone-marrow-derived lymphocyte and regulate the T lymphocyte similar, also show as lower concentration and produce promoter action, and high density produces restraining effect.The dosage that produces promoter action is 50～500U/ml, and the time is more than the 12h, to be 5000U/ml and produce inhibiting dosage, and the time is (to see Table 8) more than 24 hours.

Table 8. Interferon, rabbit is to the regulating effect of the bone-marrow-derived lymphocyte conversion of LPS and SPA stimulation

^*0.01＜P＜0.05, ^*P＜0.01 t check (X ± SE, n=5)

The fermentative production of the Yeast engineering bacteria of embodiment 6, expression GcIFN and the development of disease-resistant feed additive

Engineering bacteria carries out the small-scale fermentation with the 10L fermentor tank, and picking list bacterium colony seed engineering bacterium adds 200ml and contains in the SC-U substratum of 2% raffinose, and 30 ℃ of shaking culture are spent the night; Get culture and survey OD ₆₀₀Value is calculated the culture amount of required inoculation in the 10L fermention medium, need reach 0.4 dosage by fermentation inducement substratum initial OD values, 4 ℃ of 1500g centrifugal collecting cells, after suspending with an amount of fermentation inducement substratum, inoculation is gone in the fermentor tank, 30 ℃ of fermentation culture 12～14 hours.Fermentation back yeast cell employing centrifuging (5000rpm, 20min) precipitation is collected, 15～25kHz ultrasonication, 25～30 ℃ of air stream dryings are made the yeast powder.Get an amount of bacterium powder, add the SDS-PAGE sample buffer, with the interferon protein in the SDS-PAGE electrophoretic method separated yeast bacterium powder, method is the same.With the relative expression quantity of tlc scanning determination Interferon, rabbit in yeast cell, the dosage that contains 10mg GcIFN by per kilogram fish (shrimp) artifical compound feed, add the Yeast engineering bacteria powder (expression amount of interferon protein in yeast generally can reach 30%, then adds 33mg yeast powder in per kilogram fish (shrimp) artifical compound feed) that contains GcIFN.

The disease-resistant test in aquaculture production of embodiment 7, GcIFN

1, to the disease-resistant test of cultured fishes

Test was carried out in 6～September; the net cage of culturing grass carp and perch is divided into 8 groups respectively; wherein 5 networking casees are test group; 3 groups is control group, and (the per kilogram feed adds the GcIFN engineering bacteria powder 33mg of preparation among the embodiment 5, the expression amount 30% of interferon protein in yeast to use the feed that contains Interferon, rabbit; the 10mgGcIFN/Kg feed) throws something and feeds; threw something and fed continuously for 4 weeks, statistics natural occurrence mortality ratio is calculated immune protective rate RPS.The result uses the experimental group that contains the Interferon, rabbit feed shown in table 9 and 10, surviving rate all obviously improves, and immune protective rate reaches 62.39% and 48.61% respectively, shows that IFN can obviously improve the immune disease-resistance ability of different fish.

Table 9 is cultured the disease-resistant test effect table of grass carp

Table 10 is cultured the disease-resistant test effect table of perch

2, to the disease-resistant test of shrimps in culture

Test was carried out in 6～September.The net cage of culturing Penaeus vannamei and Chinese prawn is divided into 8 groups respectively; wherein 5 networking casees are test group; 3 groups is control group; use contains bait (the engineering bacteria powder 33mg of preparation among the per kilogram feed interpolation embodiment 5 of Interferon, rabbit; the expression amount 30% of interferon protein in yeast, the 10mgGcIFN/Kg feed) throw something and feed, threw something and fed continuously for 4 weeks; statistics natural occurrence mortality ratio is calculated immune protective rate RPS.The result uses the experimental group that contains the Interferon, rabbit feed shown in table 11 and 12, surviving rate all obviously improves, and immune protective rate reaches 30.80% and 20.99% respectively, shows that IFN can improve the immune disease-resistance ability of different shrimps.

Table 11 is cultured the disease-resistant test effect table of Penaeus vannamei

Table 12 is cultured the disease-resistant test effect table of Chinese prawn

At last, it is also to be noted that what more than enumerate only is several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.

Sequence table

SEQ ID NO.1

cagtgtagaa agctactact acctgaatac aaagatgaaa actcaaatgt ggacgtatat 60

gtttgtaatg tttttaactc tgcagggtca atgctctgct tgcgaatggc tcggccgata 120

caggatgata agcaacgagt ctttgagcct cctgaaggaa atgggtggaa aatatcctga 180

gggtaccaag gtgtcatttc caggacgcct gtacaacatg atagacaatg ccaaggtgga 240

ggaccaggtg aagtttcttg tcctgacctt agatcatatc atccgcctca tggatgccag 300

agagcacatg aattcagtgc agtggaacct acagactgta gagcattttc taactgtcct 360

gaacaggcag tcatctgatc ttaaagaatg tgtggcccga taccagccat cacataagga 420

gtcctacgag aaaaagataa acagacactt caagatttta aagaagaatc taaagaaaaa 480

agaatatagt gctcaagcat gggagcagat ccggagagct gtgaaacatc accttcagag 540

gatggacatc atcgcaagca ttgccaacag acgataagac ataatgacgg atgaatgact 600

tgtgacacat tccatggagt gaagaaaagt taatgtaaac aatgccttaa aagctaaaac 660

tgaatgtaac aaatatttat ttacatgact gtattttatt tcaactagag ttgaaagttt 720

tgcctaatgt ctggtgttgt aatatagagt ttaccttatg tgtttcctat gaaaacttga 780

agtaatctga tcaagcaagc taattatgtt tcttacaaaa acctgagaaa ccttgtattt 840

attttatttt ggtgcaaata ggcctatgtg cctaaactat acccagattt tttgctgaat 900

gtgaaaaaaa tgtttaaaaa aacaagcatg ccatgtattt caagtcatgt atttattaac 960

ggtcaatcaa ttatgttgtg atgcacatgg atatgatgta tgttttgtga ttgtttcaga 1020

tatttattat acttaattta cttcatacat tgttgtgcac aatttttgta tctctgaata 1080

ttttattctt tttatatgta ctgaatgctt gcgataatga tttgctctat ttgcttgcaa 1140

aatatttttg tacttttaaa taagaaattg attgaaaaaa aacaaaaaaa agtcgtgact 1200

gaaaaaacaa 1210

Claims (2)

1, a kind of engineering bacteria, it is characterized in that: this bacterial strain INVSC1-pYES2-IFN is S. cervisiae (Saccharomyces cerevisiae), preserving number: CGMCC1847, depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center, preservation day: on October 19th, 2006.

2, the application of engineering bacteria as claimed in claim 1 in preparation aquatic animal anti-virus feed additive.

Images