CN108977450B - A kind of phosphate transport protein LcPHT4 relevant to plant setting percentage；3 and its application - Google Patents
A kind of phosphate transport protein LcPHT4 relevant to plant setting percentage；3 and its application Download PDFInfo
- Publication number
- CN108977450B CN108977450B CN201810885902.6A CN201810885902A CN108977450B CN 108977450 B CN108977450 B CN 108977450B CN 201810885902 A CN201810885902 A CN 201810885902A CN 108977450 B CN108977450 B CN 108977450B
- Authority
- CN
- China
- Prior art keywords
- leu
- ala
- lcpht4
- gly
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A kind of phosphate transport protein LcPHT4 relevant to plant setting percentage；3 and its application.The present invention provides a kind of phosphate transport protein gene and its albumen, cDNA sequence, which utilizes be cloned into cDNA sequence in pasture herbage plant sheep's hay, constructs plant expression vector, convert wildtype Arabidopsis thaliana, obtain genetically modified plants.The discovery of transgenic arabidopsis Phenotypic Observation, the phosphate transport protein gene take part in the signal path of phosphorus response, while influencing the setting percentage of plant.
Description
Technical field
The present invention relates to a kind of phosphate transport proteins.Specifically, the present invention relates to one kind to derive from Steppe
The gene of the coding phosphate transport protein of forage grass --- sheep's hay, is named as LcPHT4;3.The invention further relates to the genes
The amino acid sequence of coding, and the application containing the carrier of this genoid and this genoid in setting percentage genetic engineering.
Background technique
Sheep's hay is King of Pasture, full of nutrition, and palatability is good, is known as domestic animal " flour and rice ".Simultaneously as the root of sheep's hay has
Have it is extremely strong penetrate the ability of occupying, and intensive root web frame can be formed, can conserve water and soil well, be conducive to grassland " three
The improvement of change " has important value to ecological protection.But China grassland productivity is compared with the eighties in last century
Decline 40% or so, 90% or more grassland is degenerated.Overgraze is to lead to one of principal element of grass-land deterioration.For a long time
It herds under interference, the morphological feature generation of sheep's hay changes significantly, and it shows as sheep's hay Stem and leaf characters and significantly minimizes, including
The reduction of plant height and individual ground biomass.Sheep's hay vegetative propagation has comparative advantage in natural habitat, sexual propagation ability compared with
Weak, be mainly manifested in three low problems: i.e. setting percentage is low, heading rate is low, seed germination rate is low.The low practical life to sheep's hay of setting percentage
It produces and application brings very big difficulty, also seriously limit the recovery improvement of China's natural meadow.
Sheep's hay phosphate transport protein gene is studied using biotechnology, finds LcPHT4;3 take part in sheep's hay pair
The signal path of the response of grazing stress and phosphorus response, while influencing the setting percentage of plant.
Summary of the invention
The object of the present invention is to provide a kind of albumen LcPHT4s relevant to plant setting percentage;3 and its encoding gene with answer
With.
LcPHT4 provided by the present invention;3 derive from sheep's hay (Leymus chinensis (Trin.) Tzvel.), are phosphorus
A member in hydrochlorate transport protein family, nucleotide sequence and amino acid sequence are shown in SEQ ID NO:1 and SEQ ID NO:2；
Either SEQ ID NO:2 amino acid sequence by substitution, missing or the addition of one or several amino acid and is had
The active protein sequence as derived from sequence identical as the protein in sequence table.Amino acid residue sequence is by 516 in table
The protein of a amino acid residue composition, molecular weight about 55.68KD, isoelectric point 10.20, full length gene 2197bp possess SEQ
Full length cDNA sequence shown in ID NO:1, the 3 ' areas UTR of the 5 ' and 605bp including complete reading frame 1548bp and 45bp.
The present invention also provides a kind of isolated polynucleotides to promote the application in plant setting percentage genetic engineering, wherein
The sequence of the polynucleotides is as shown in SEQ ID No:1.Wherein, plant is preferably arabidopsis.
Detailed description of the invention
Fig. 1: lower LcPHT4 is overgrazed;The detection of 3 gene expression amounts；
Fig. 2: different abiotic stress handle lower LcPHT4;The detection of 3 gene expression amounts；
Fig. 3: LcPHT4 under P deficiency treatment conditions;Compared with arabidopsis (Col-0) grain weight, OE represents different 3-OE
Transgenic line.
Specific embodiment
Experimental procedure of the invention is described in detail below in conjunction with specific embodiment:
1. sheep's hay LcPHT4 of embodiment;The clone of 3 genes
Take one month seedling age plant of sheep's hay for testing, clip aerial part tissue is placed in 1.5mL centrifuge tube, liquid nitrogen speed
Freeze, is stored in spare in -80 DEG C of ultra low temperature freezers.Utilize plant RNA extraction kit (TaKaRa, Cat#9769) and reverse transcription
Kit (TaKaRa, Cat#RR047A) carries out the extraction of RNA to plant sample and reverse transcription synthesizes cDNA.With overall length primer
LcPHT4;3-F/R is primer, carries out PCR amplification by template of cDNA.
LcPHT4;3-F:CGCCTCCCTCGTCGACAGACGGCGGAGAAAACA；
LcPHT4;3-R:ATTCGAGCTCACTAGTCATATGTCCTCTTTGGCG.
PCR reaction system (50 μ L):
PCR amplification condition: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 100s, 30
Circulation；72 DEG C of supplements extend 10min；16 DEG C of preservations.
1% Ago-Gel, 100V, 60mA electrophoresis 30-45min testing goal band.
Embodiment 2.LcPHT4;3 genes overgraze and Abiotic stress conditions under expression pattern
The sheep's hay on sample ground is collected with overgrazing sample and sealed in the Chinese Academy of Sciences, Xilinguole League localizer station (sampling position)
Upper portion of tissue (Fig. 1), is put into cryopreservation tube, is put into liquid nitrogen freezes rapidly, and it is spare to put -80 DEG C of ultra low temperature freezer cold storage.
One month seedling age plant of sheep's hay is subjected to 4 DEG C of cold treatments, 100 μm of ol/L MeJA, high pH (pH10), mechanical damage
(Wounding), the Different stress such as 100 μm of ol/L ABA, arid, 42 DEG C of heat treatment, 300mmol/L sodium chloride processing (Fig. 2),
In 0,0.5,1,3,6,12,24,48h point in time sampling, liquid nitrogen cryopreservation, -80 DEG C of refrigerators are saved backup.
Utilize plant RNA extraction kit (TaKaRa, Cat#9769) and reverse transcription reagent box (TaKaRa, Cat#
RR047A the extraction of RNA) is carried out to plant sample and reverse transcription synthesizes cDNA.According to real-time fluorescence quantitative PCR (qRT-PCR)
The design principle of primer, using software Primer 5.0 to LcPHT4;3 design qRT-PCR primers,
LcPHT4;3-qF:TGGTTTGAAGTCCTTTGGTCAC；
LcPHT4;3-qR:CGTGTTTGCCATTCCGTGTAGC.
Expression quantity detection is carried out using Roche LightCycler 480Real-Time PCR System.QRT-PCR is anti-
Answer system (20 μ L) are as follows:
QRT-PCR amplification program are as follows: 95 DEG C of initial denaturation 30s；95 DEG C of denaturation 5s, 60 DEG C of annealing 30s, 72 DEG C of extension 15s, 40
A circulation.
Using LcEF1 α as internal reference, experimental data utilizes 2-ΔΔCTMethod calculates relative expression quantity.
3. turns of LcPHT4 of embodiment;The acquisition of 3 gene arabidopsis and setting percentage compare
By the cDNA that extraction reverse transcription obtains in above-described embodiment 1, primer plus the primer of 15bp carrier sequence are utilized, is used
The LcPHT4 that Quan Shijin HiFi archaeal dna polymerase expands;The In-Fusion kit of 3, Clontech companies passes through gene
Target gene is connected into the plant expression vector pCanG of the strong promoter with 35S by recombination, obtains binary expression vector.Through
After digestion verification is errorless, it is transferred to Agrobacterium tumefaciems, upgrading grain is transferred to quasi- south after PCR, digestion identification are correct, using colored method is dipped in
Mustard (Col-0) passes through kanamycin resistance screening transgenic homozygous plant.
It will turn LcPHT4;The phosphorus concentration that 3 gene arabidopsis homozygous plants and arabidopsis (Col-0) carry out 25mmol/L is handled
(Fig. 3), and to transgenic line LcPHT4 under P deficiency treatment conditions;3-OE and arabidopsis (Col-0) WT grain weight carry out
Compare (referring to table 1), statistics setting percentage discovery: the setting percentage for the different strain seeds normally cultivated is similar, but in phosphorus concentration
Transgenic line is than about one times of wild type increase after processing.
Under 1. P deficiency treatment conditions of table compared with the weight of alms bowl seed single under normal condition
The above, only presently preferred embodiments of the present invention, are not intended to limit the present invention in any form, all to be familiar with
Professional and technical personnel, without departing from the scope of the present invention, when using disclosed above technology contents, and
The equivalent variations of few modifications, modification and the differentiation made is equivalent example of the invention；Meanwhile it is all according to the present invention
The variation, modification and evolution of substantial technological any equivalent variations to the above embodiments, still fall within technology of the invention
In the range of scheme.
SEQUENCE LISTING
<110>applicant
<120>a kind of phosphate transport protein LcPHT4 relevant to plant setting percentage;3 and its application
<130>a kind of phosphate transport protein LcPHT4 relevant to plant setting percentage;3 and its application
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 2197
<212> cDNA
<213>sheep's hay (Leymus chinensis (Trin.) Tzvel.)
<400> 1
cttccactcc ggcagagcgc acccagacgg cggagaaaac aaaccatggc ccctcccggc 60
caactgctcc ccttgacccg ctcgcttctg cctccctccg ctcccccctt cctctccggc 120
cgccgtcgcc tgcctcctcc cgcccgcgct caaacctcgc ctccgcttcc atggcagccc 180
caccgcctcc agtgtccttc tcccctccag ccgctccgcc ctctcgccag gaacaggacc 240
cttcccgttg ctgcgcctcc tggggcctcc gccgccggcg gaggcgatac gcaggctctg 300
gcggcggagt tcatgacgtc tgagagggtg aaggtggcgg cgatgctggg gctggccctc 360
gcgctctgca acgccgaccg cgtggtcatg tccgtggcca tcgtcccgct ctcccaggcg 420
tatggatgga ccccgtcctt cgccggcgtc gtgcagtcat ccttcctttg gggatatctg 480
atatcaccta taatcggtgg agcgcttgtt gactactacg gtgggaagcg agtcatggcg 540
tatggtgtgg ctttatggtc cttcgctaca ttcctttccc cttgggcagc tgctcgctca 600
ctgtggttgt tcatctcaac tagaattctg ctcggtgttg cagaaggagt ggcattgcca 660
tgtatgaaca atatggtgct gaggtggttt cctcgtactg aacgatctag tgctgtgggg 720
atcgcgatgg ctggctttca gcttggaaat acgatcggct tacttctttc ccctattatc 780
atgtcacgaa ctggaacatt tggacccttt gtgatttttg gtttgtttgg atttctgtgg 840
gtgctggtgt ggatatctgc tataacagga actcctggtg aacatcctca aatatcagca 900
tatgaactag agtatataac aaagggtcag aaattggtga aacctcaagt tcaaggtgaa 960
aaactaagaa agatccctcc gtttagaaac ctactttcta aatggccgac ctgggcttta 1020
atatctgcaa atgctatgca tagctggggc tatttcgtca tcctttcatg gatgccagtg 1080
tatttcaaaa ctatatttca tgtcaatctg agagaagctg catggtttag tgcaattccc 1140
tgggtcatga tggcagtttt aggctatgtg gctggtgttg tatcagacgc acttatccga 1200
aatggcacaa gcattacttt aactcggaag ataatgcaga caattggctt tgtgggtcct 1260
ggtattgctc ttattggttt aaatgcagca aagagtccag ccattgcttc agcttggcta 1320
actattgctg ttggtttgaa gtcctttggt cactcaggat tccttgtaaa ttttcaggag 1380
atcgccccac aatatgccgg agtgctacac ggaatggcaa acacggccgg aacatttgct 1440
gccatcttag gaactattgg agcaggattc tttgttgatc ggatgggttc tttccgtgga 1500
tttttaacat taacatcact tctatatttc agcagtgctc tgttctggga tatctttgct 1560
actggagagc gtgttgattt tgatggcact aactagcgcc aaagaggaca tatgcaatgc 1620
atatcctaga acataaaacc tcatgatttg atgattcacg ggagaatact gtgccatcat 1680
catttgggat agtacccaaa agttccatga agcagagatg agcagtagag ttctgacaca 1740
tccagactac aagattgtgt gcttcaagaa gtatgtggtg agttgtctta ttgtggaagc 1800
agagtacccg acatggataa tggatttagc tacttggatc acgtgagttc ttctgcacaa 1860
gttcgaaatg tgaatgtaaa gagtcaagga tacctgaagt atatcagaga ataaatagca 1920
gtgcaggatc cctactttag gggtggcaaa ctggcaatgg cagtggtaga gactgaaaat 1980
aattgccagg gtagttgaaa gcttgatcta gcatagtttg gtgaggcaag agttgacctt 2040
gtttaaaatg gctagtagat gtactgccat ttactgtcat gattagtgaa aaggtgagac 2100
caggaactca aacaaagagg ggggcctgtt gggggtgtaa agatacagaa ttctctgttg 2160
gtttcacaat gtttgttcac tttagcttga gccggcg 2197
<210> 2
<211> 516
<212> PRT
<213>sheep's hay (Leymus chinensis (Trin.) Tzvel.)
<400> 2
Met Ala Pro Pro Gly Gln Leu Leu Pro Leu Thr Arg Ser Leu Leu Pro
1 5 10 15
Pro Ser Ala Pro Pro Phe Leu Ser Gly Arg Arg Arg Leu Pro Pro Pro
20 25 30
Ala Arg Ala Gln Thr Ser Pro Pro Leu Pro Trp Gln Pro His Arg Leu
35 40 45
Gln Cys Pro Ser Pro Leu Gln Pro Leu Arg Pro Leu Ala Arg Asn Arg
50 55 60
Thr Leu Pro Val Ala Ala Pro Pro Gly Ala Ser Ala Ala Gly Gly Gly
65 70 75 80
Asp Thr Gln Ala Leu Ala Ala Glu Phe Met Thr Ser Glu Arg Val Lys
85 90 95
Val Ala Ala Met Leu Gly Leu Ala Leu Ala Leu Cys Asn Ala Asp Arg
100 105 110
Val Val Met Ser Val Ala Ile Val Pro Leu Ser Gln Ala Tyr Gly Trp
115 120 125
Thr Pro Ser Phe Ala Gly Val Val Gln Ser Ser Phe Leu Trp Gly Tyr
130 135 140
Leu Ile Ser Pro Ile Ile Gly Gly Ala Leu Val Asp Tyr Tyr Gly Gly
145 150 155 160
Lys Arg Val Met Ala Tyr Gly Val Ala Leu Trp Ser Phe Ala Thr Phe
165 170 175
Leu Ser Pro Trp Ala Ala Ala Arg Ser Leu Trp Leu Phe Ile Ser Thr
180 185 190
Arg Ile Leu Leu Gly Val Ala Glu Gly Val Ala Leu Pro Cys Met Asn
195 200 205
Asn Met Val Leu Arg Trp Phe Pro Arg Thr Glu Arg Ser Ser Ala Val
210 215 220
Gly Ile Ala Met Ala Gly Phe Gln Leu Gly Asn Thr Ile Gly Leu Leu
225 230 235 240
Leu Ser Pro Ile Ile Met Ser Arg Thr Gly Thr Phe Gly Pro Phe Val
245 250 255
Ile Phe Gly Leu Phe Gly Phe Leu Trp Val Leu Val Trp Ile Ser Ala
260 265 270
Ile Thr Gly Thr Pro Gly Glu His Pro Gln Ile Ser Ala Tyr Glu Leu
275 280 285
Glu Tyr Ile Thr Lys Gly Gln Lys Leu Val Lys Pro Gln Val Gln Gly
290 295 300
Glu Lys Leu Arg Lys Ile Pro Pro Phe Arg Asn Leu Leu Ser Lys Trp
305 310 315 320
Pro Thr Trp Ala Leu Ile Ser Ala Asn Ala Met His Ser Trp Gly Tyr
325 330 335
Phe Val Ile Leu Ser Trp Met Pro Val Tyr Phe Lys Thr Ile Phe His
340 345 350
Val Asn Leu Arg Glu Ala Ala Trp Phe Ser Ala Ile Pro Trp Val Met
355 360 365
Met Ala Val Leu Gly Tyr Val Ala Gly Val Val Ser Asp Ala Leu Ile
370 375 380
Arg Asn Gly Thr Ser Ile Thr Leu Thr Arg Lys Ile Met Gln Thr Ile
385 390 395 400
Gly Phe Val Gly Pro Gly Ile Ala Leu Ile Gly Leu Asn Ala Ala Lys
405 410 415
Ser Pro Ala Ile Ala Ser Ala Trp Leu Thr Ile Ala Val Gly Leu Lys
420 425 430
Ser Phe Gly His Ser Gly Phe Leu Val Asn Phe Gln Glu Ile Ala Pro
435 440 445
Gln Tyr Ala Gly Val Leu His Gly Met Ala Asn Thr Ala Gly Thr Phe
450 455 460
Ala Ala Ile Leu Gly Thr Ile Gly Ala Gly Phe Phe Val Asp Arg Met
465 470 475 480
Gly Ser Phe Arg Gly Phe Leu Thr Leu Thr Ser Leu Leu Tyr Phe Ser
485 490 495
Ser Ala Leu Phe Trp Asp Ile Phe Ala Thr Gly Glu Arg Val Asp Phe
500 505 510
Asp Gly Thr Asn
515
Claims (4)
1. a kind of sheep's hay phosphate transport protein LcPHT4；3 genes, nucleotide sequence is as shown in SEQ ID No.1.
2. a kind of sheep's hay phosphate transport protein LcPHT4；3, amino acid sequence is as shown in SEQ ID No.2.
3. containing the expression vector of gene described in claim 1.
4. a kind of sheep's hay phosphate transport protein LcPHT4 described in claim 1；3 genes are increasing answering for plant setting percentage
With the plant is arabidopsis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810885902.6A CN108977450B (en) | 2018-08-06 | 2018-08-06 | A kind of phosphate transport protein LcPHT4 relevant to plant setting percentage；3 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810885902.6A CN108977450B (en) | 2018-08-06 | 2018-08-06 | A kind of phosphate transport protein LcPHT4 relevant to plant setting percentage；3 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108977450A CN108977450A (en) | 2018-12-11 |
| CN108977450B true CN108977450B (en) | 2019-08-02 |
Family
ID=64555915
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810885902.6A Active CN108977450B (en) | 2018-08-06 | 2018-08-06 | A kind of phosphate transport protein LcPHT4 relevant to plant setting percentage；3 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108977450B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102115754A (en) * | 2010-12-16 | 2011-07-06 | 南京农业大学 | Application of rice phosphate transport protein gene ORYsa;Pht1;4 |
-
2018
- 2018-08-06 CN CN201810885902.6A patent/CN108977450B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102115754A (en) * | 2010-12-16 | 2011-07-06 | 南京农业大学 | Application of rice phosphate transport protein gene ORYsa;Pht1;4 |
Non-Patent Citations (5)
| Title |
|---|
| 1,influences allocation of phosphate within the plant and phosphate-starvation responses.《The Plant Cell》.2002,1751-1766. * |
| NM_001339292;Salanoubat M et al;《GenBank》;20170520;全文 * |
| Salanoubat M et al.NM_001339292.《GenBank》.2017,全文. * |
| Wayne K Versaw and Maria J Harrison.A chloroplast phosphate transporter,PHT2 * |
| 水稻高亲和磷转运蛋白基因OsPht1；8的功能研究;贾宏昉;《中国优秀博士论文全文数据库农业科技辑》;20131215;摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108977450A (en) | 2018-12-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110845590B (en) | Wild grape VyPPR gene and application of encoding protein thereof in drought stress | |
| CN110157718B (en) | Nitrate nitrogen regulation gene ZmNRG2.7 from corn and application thereof | |
| CN112322630B (en) | MsSPL13 gene and application thereof | |
| CN105367644A (en) | Plant stress tolerance associated transcription factor, encoding gene of plant stress tolerance associated transcription factor, and application of encoding gene | |
| CN110950943A (en) | Alfalfa 'WL525' embryonic development late protein MsLEA-D34 and coding gene thereof | |
| CN110804090B (en) | Protein CkWRKY33 and coding gene and application thereof | |
| CN101809155A (en) | Transgenic plants with increased stress tolerance and yield | |
| CN112481270B (en) | DaMT3b gene and application thereof | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN110475471A (en) | Show the rotaring gene corn plant of increased yield and drought tolerance | |
| CN110408627B (en) | Stress resistance related protein and coding gene and application thereof | |
| CN106749577A (en) | Stress tolerance correlation transcription factor albumen NAC and its application | |
| CN108977450B (en) | A kind of phosphate transport protein LcPHT4 relevant to plant setting percentage；3 and its application | |
| CN112458097B (en) | Metallothionein DaMT2a and application of encoding gene thereof | |
| CN104498514A (en) | Nitraria tangutorum CBL-interacting protein kinase 9 (NtCIPK9) gene, expressed protein thereof and application thereof | |
| CN104109192A (en) | Wheat draught-resistant gene and use thereof | |
| CN109371036B (en) | An alfalfa salt tolerance gene MsPIP 2; 2 and uses thereof | |
| CN114540373A (en) | Gene for reducing cadmium content in rice grains and application thereof | |
| CN114369616A (en) | Application of tomato SISPS gene in improving high temperature resistance of plants | |
| CN110592101B (en) | Rape transcription factor BnWRKY184, cloning method, vector, host cell and application | |
| CN107760709B (en) | Gene for regulating and controlling heat resistance of plant and application of gene in plant improvement | |
| CN107353330B (en) | Application of PTRE1 gene in regulation and control of plant heat resistance | |
| CN116497038B (en) | Alfalfa low temperature resistant gene MfJAZ1 and application thereof | |
| CN105754965A (en) | Wlofberry phytochelatin synthetase as well as coding gene and application thereof | |
| CN105777881B (en) | It is a kind of promote crucifer heat resistance gene and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |