CN108893554B - SSR marker and method for identifying Huangzhou radishes - Google Patents
SSR marker and method for identifying Huangzhou radishes Download PDFInfo
- Publication number
- CN108893554B CN108893554B CN201810798731.3A CN201810798731A CN108893554B CN 108893554 B CN108893554 B CN 108893554B CN 201810798731 A CN201810798731 A CN 201810798731A CN 108893554 B CN108893554 B CN 108893554B
- Authority
- CN
- China
- Prior art keywords
- radish
- huangzhou
- identifying
- radishes
- marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SSR marker and a method for identifying radish in Huangzhou province, belonging to the field of plant molecular biology. The sequence of the SSR marker is shown in SEQ ID NO.1, and the sequence of the primer for amplifying the SSR marker is shown in SEQ ID NO. 2-3. The method comprises the following steps: extracting DNA of a sample to be detected, carrying out PCR amplification by using a primer with a sequence shown as SEQ ID NO.2-3, and judging that the identified sample is yellow radish if a specific band of 227bp is amplified. The invention develops the SSR molecular marker suitable for detecting the characteristics and the purity of the Huangzhou radish for the first time, and greatly improves the speed and the accuracy of identifying the Huangzhou radish.
Description
Technical Field
The invention belongs to the field of plant molecular biology, and particularly relates to an SSR marker and a method for identifying radish in Huangzhou province.
Background
The Huangzhou radish is a farmyard variety with local characteristics in the Huangzhou region of Huanggang city in Hubei province of China and has a long planting history. Huangzhou radish is distinguished by good quality and high yield, especially quality: the meat is compact, tender and crisp, has moderate moisture, slightly sweet raw taste, delicious cooked taste, no softness after long-time cooking and no rot after being cooked. The vegetable is a beautiful name of 'raw eating sweet, cooked eating fragrant, pickled food crisp and eating more delicious in winter, storage and spring'. According to the determination of the Liouabang quality of the university of agriculture in Huazhong, every 100g of the edible parts of the radish in Huangzhou contains 23mg of vitamin C, and the content of lysine is 2.5 times of that of the common white radish.
In 1959, "Huangzhou radish" was selected to Beijing to participate in the exhibition in the national celebration 10-year agricultural exhibition hall and win the prize, and in 1992 it was selected to Hubei province famous, special, excellent and new agricultural product development project library, becoming one of the famous and excellent agricultural product resources with development prospect in Hubei province. In 2008, 8 months, "Huangzhou radish" formally became a national geographic sign protection product. The Huanggang active series develops the Huangzhou radish, the seed purification and rejuvenation effect is obvious, the planting area is continuously enlarged, and under the drive of the Karreda food Co., Ltd, Huangzhou radish production enterprises and farmers increase the deep processing of products so as to improve the added value of the Huangzhou radish and achieve the aims of increasing the economic output and improving the economic benefit.
The Huangzhou radish is widely popularized as an excellent Huanggang local variety, and the market influence is increasingly strengthened. In recent years, the traditional variety has the bad phenomena of purity reduction, even self-degeneration of the variety and the like, so that the tasks of improving and strengthening the purity and the vitality of the Huangzhou radish are urgent, and the work of purification and strengthening the radish is particularly urgent. At present, an SSR molecular marker for identifying the variety of the Huangzhou radish does not exist, and the SSR molecular marker can analyze and discuss the genetic diversity of a test material and screen a specific molecular marker of the Huangzhou radish, so that a favorable tool can be provided for the purification and strengthening work of the Huangzhou radish.
Disclosure of Invention
The invention aims to solve the problems in the prior art and provides an SSR marker and a method for identifying radish in Huangzhou province.
The purpose of the invention is realized by the following technical scheme:
an SSR marker for identifying radish in Huangzhou province is an R102 marker, and the nucleotide sequence of the SSR marker is shown in SEQ ID NO. 1.
The sequences of primers amplifying the above markers are shown below:
R102-F：gggaggaaaccggttaagaa，
R102-R：gtcccgtccatgtcgaatac；
the SSR marker or the primer is applied to the identification of the yellow radish.
A method for identifying radish in Huangzhou province comprises the following steps: extracting DNA of a sample to be detected, carrying out PCR amplification by using the primer, and judging that the identified sample is the radish in Huangzhou if a specific band of 227bp is amplified.
Compared with the prior art, the invention has the following advantages and effects:
(1) the SSR molecular marker suitable for detecting the characteristics and the purity of the yellow radish is developed for the first time;
(2) at present, Huangzhou radish can be quickly detected from summer radish, Hongbao radish, Huangzhou radish, other red peel radish, white peel radish and the like;
(3) compared with a morphological identification method, the accuracy is greatly improved.
Detailed Description
The following examples are intended to further illustrate the invention but should not be construed as limiting it. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1
(1) Extraction of DNA: the seeds of the radish of Huangzhou province are placed in a constant temperature incubator at 25 ℃ for 3 days, 100mg leaves of the radish cotyledons are taken after the cotyledons of the seeds grow out, the total genomic DNA of the radish cotyledons is extracted, and then the purity and the content of the total DNA are respectively detected by using 1% agarose gel electrophoresis and an ultraviolet spectrophotometer.
(2) Primary screening of primers: designing primers according to the SSR repeated fragments of the radish, and respectively carrying out PCR amplification by using the extracted genome DNA as a template.
The PCR system is as follows: 12.5 μ L PCR Master mix (Thermo Scientific)TM) 0.5. mu.L of DNA, 1. mu.L of each of the upstream and downstream primers, and 10. mu.L of double distilled water.
The reaction procedure is as follows: pre-denaturing the template at 94 ℃ for 5 min; pre-denaturation at 94 ℃ for 30s, annealing at 55-60 ℃ for 30s, extension at 72 ℃ for 30s, and 40 cycles; finally, extension is carried out for 10min at 72 ℃.
And carrying out agarose gel electrophoresis on the PCR amplification product, and screening a primer with a clear and obvious band between 100bp and 300bp by taking a 600bp DNA Marker (containing 100, 200, 300, 400, 500 and 600bp) as a control during electrophoresis. A total of 25 primers were selected, and the primers selected are shown in Table 1.
TABLE 1 primer sequences
(3) Screening of primers for identifying radish in Huangzhou province
Genomic DNAs of different varieties of radishes (including Huangzhou radishes, Nandinai radishes, Nanxiang radishes, summer radishes for 40 days, double red radishes, Hongbao radishes, Brevibacterium-13, Qiyehong, Honggao radishes, Chunbaiyi radishes, Maidiwan radishes, Wuqingyi radishes and the like) are extracted, the 25 pairs of primers are respectively used for carrying out PCR amplification, and the amplified products are subjected to polyacrylamide gel electrophoresis (PAGE), so that the results show that the R102 and R112 primers can specifically identify whether the detected sample is the Huangzhou radishes. The specific situation is as follows:
amplification results of the R102 primer: the difference of the PCR amplification band between the Huangzhou radish and other radishes is detected by PAGE, the specific band of 227bp is amplified by only the Huangzhou radish, and no band is amplified by the other radishes at the 227bp, so that the R102 marker can be used as the specific marker for identifying the Huangzhou radish. Further sequencing, and the result shows that the 227bp specific band sequence is shown in SEQ ID NO. 1.
R112 primer amplification results: the difference of PCR amplification bands between the Huangzhou radish and other radishes is detected through PAGE, the radishes can amplify the 251bp band, but only the Huangzhou radish amplifies a specific band different from the other radishes at 400bp, and the other radishes do not amplify any band at 400bp, so that the R112 marker can be used as a specific marker for identifying the Huangzhou radish.
The above contents show that the R102 and R112 markers can be developed into SSR molecular markers for identifying the characteristics and the purity of the Huangzhou radish, and the R102 and R112 primer pairs can be used for identifying the Huangzhou radish.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> Huanggang college of teachers and schools
<120> SSR marker and method for identifying radish in Huangzhou province
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 227
<212> DNA
<213> Raphanus sativus
<400> 1
gggaggaaac cggttaagaa gaggaagaaa ataagaagag aagaaaaagc agaagcacaa 60
ccattatcat tcctttccct caaactcaga ccttcacctt cttcttcttc ttcttcttct 120
tcttcttctt cttcttctta tcgttcttcg atctccatgg cgaatctaac aacaacgaag 180
aacgcgaaag ctcgcctgag aggcgtcgta ttcgacatgg acgggac 227
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggaggaaac cggttaagaa 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtcccgtcca tgtcgaatac 20
Claims (3)
1. The application of the SSR marker in identifying the radish in Huangzhou province is characterized in that: the nucleotide sequence of the SSR marker is shown in SEQ ID NO. 1.
2. Use of primers for amplifying the SSR marker of claim 1 for the identification of daikon radish, characterized in that: the sequences of the primers are shown as follows:
F：gggaggaaaccggttaagaa，
R：gtcccgtccatgtcgaatac。
3. the method for identifying the Huangzhou radish is characterized by comprising the following steps: the method comprises the following steps: extracting DNA of a sample to be detected, carrying out PCR amplification by using the primer in claim 2, and judging that the identified sample is radish in Huangzhou if a specific band of 227bp is amplified.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810798731.3A CN108893554B (en) | 2018-07-19 | 2018-07-19 | SSR marker and method for identifying Huangzhou radishes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810798731.3A CN108893554B (en) | 2018-07-19 | 2018-07-19 | SSR marker and method for identifying Huangzhou radishes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108893554A CN108893554A (en) | 2018-11-27 |
| CN108893554B true CN108893554B (en) | 2021-12-17 |
Family
ID=64351212
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810798731.3A Active CN108893554B (en) | 2018-07-19 | 2018-07-19 | SSR marker and method for identifying Huangzhou radishes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108893554B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636403A (en) * | 2016-12-22 | 2017-05-10 | 黄冈师范学院 | EST-SSR (expressed sequence tag-simple sequence repeats) molecular markers for heat-resistant radish, primers of molecular markers and application thereof |
-
2018
- 2018-07-19 CN CN201810798731.3A patent/CN108893554B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636403A (en) * | 2016-12-22 | 2017-05-10 | 黄冈师范学院 | EST-SSR (expressed sequence tag-simple sequence repeats) molecular markers for heat-resistant radish, primers of molecular markers and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 萝卜EST资源的SSR信息分析及EST-SSRs标记开发;崔娜等;《园艺学报》;20121231;第39卷(第7期);摘要、材料与方法1.1-1.8、结果与分析2.2.2 * |
| 萝卜和甘蓝远缘杂交研究;程雨贵等;《中国油料作物学报》;20061231;第28卷(第1期);第1-6页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108893554A (en) | 2018-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105368935B (en) | SSR primer sets and method for the Purity Identification of capsicum variety Huifeng 2 | |
| Holz et al. | Initial studies on cucumber transcriptome analysis under silicon treatment | |
| CN110106271B (en) | SSR marker primer pair for assisting in selecting large-grain broad beans and application thereof | |
| CN108893554B (en) | SSR marker and method for identifying Huangzhou radishes | |
| CN105385768B (en) | Method for identifying millet variety by adopting SSR molecular marker technology and application | |
| CN108977573B (en) | Method for identifying purity of seven-star radish hybrid by using SSR molecular marker | |
| CN108559788B (en) | Primer and method for identifying Huangzhou radish based on SSR marker | |
| CN115786559B (en) | Indel marker of maize drought response gene miR528b promoter and application thereof | |
| CN106676175B (en) | For the Rapid identification oil tea breeding Cen specificity labeled primers pair and authentication method of soft No. 2 | |
| CN116555470A (en) | SSR (simple sequence repeat) marker for identifying authenticity of 'Tiny double you' and lily lan and application thereof | |
| CN107354150B (en) | Differential sequence for identifying tomato fruit dry juice character, molecular marker and identification method thereof | |
| CN107338246B (en) | Specific sequence of tomato fruit dry juice character and its molecular marker and identification method | |
| CN113462813B (en) | Site linked with pear peel red character, molecular marker and application thereof | |
| CN113403417B (en) | SSR molecular marker AerM01 for sex identification of actinidia arguta and application thereof | |
| CN106434906B (en) | A kind of and cauliflower bouquet hair floral formation chain SNP site and its detection method and primer sets | |
| Farahani et al. | Population genetic studies in Ziziphus jujuba Mill.: multiple molecular markers (ISSR, SRAP, ITS, Cp-DNA) | |
| CN111270002A (en) | SCAR marking method for sex early identification of male and female ginkgo plants | |
| CN116334269B (en) | Molecular marker for sex identification of actinidia arguta and specific primer pair M3 thereof | |
| CN115838790B (en) | Molecular marker for sex identification of actinidia arguta and application of specific primer pair M4 | |
| CN114438239B (en) | Molecular marker for identifying large 10 of mulberry variety Yuehong, identification primer group, kit and application | |
| CN116334299B (en) | Molecular marker of brassica 'U triangle' B genome specific sequence and application thereof | |
| CN117512203B (en) | Molecular marker related to papaya fruit width, method and application | |
| CN114525361B (en) | cDNA molecular marker for distinguishing purple skin and yellow skin onion and application thereof | |
| CN107523644B (en) | Identification method of bletilla ochracea | |
| Tsai | Identification and characterization of 16 polymorphic microsatellite markers from Mangifera indica L.(anacardiaceae) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |