CN114438239B

CN114438239B - Molecular marker for identifying large 10 of mulberry variety Yuehong, identification primer group, kit and application

Info

Publication number: CN114438239B
Application number: CN202111645789.2A
Authority: CN
Inventors: 王振江; 罗国庆; 唐翠明; 陈莲; 钟建武; 林森
Original assignee: Sericulture and Agri Food Research Institute GAAS
Current assignee: Sericulture and Agri Food Research Institute GAAS
Priority date: 2021-12-30
Filing date: 2021-12-30
Publication date: 2022-07-29
Anticipated expiration: 2041-12-30
Also published as: CN114438239A

Abstract

The invention discloses a molecular marker for identifying a mulberry variety 'Yuehaoda 10', an identification primer group, a kit and application. The invention utilizes fluorescence SSR technology, 300 pairs of SSR primers developed by mulberry genome sequence design are screened, core primers marked with M8179 and M10360 are confirmed to be capable of amplifying two specific bands for a new variety of mulberry, namely Guangdong mulberry 10 ', and the new variety of mulberry, namely Guangdong mulberry 10 ', can be identified from Guangdong mulberry germplasm, popularization and application varieties and strains, and can be used for rapid identification and detection of the new variety of mulberry, namely Guangdong mulberry 10 '. The method disclosed by the invention identifies the Mylabris maximus 10 ' by directly detecting the M8179 marker and/or the M10360 marker of the Mylabris maximus 10 ', overcomes the uncertainty of identifying the Mylabris maximus by external morphological characteristics, is simple to operate, high in detection efficiency and reliable and intuitive in result, provides scientific technical support for protecting the Mylabris maximus 10 ', and is beneficial to popularization, utilization and protection of the Mylabris maximus.

Description

Molecular marker for identifying large 10 of mulberry variety Yuehong, identification primer group, kit and application

Technical Field

The invention relates to the technical field of variety resource identification and germplasm innovation, in particular to a molecular marker for identifying a mulberry variety 'Yuehaoda 10', an identification primer set, a kit and application.

Background

The mulberry is a fruit resource with excellent characteristics, is a representative of fruits of the third generation, is listed as a list of 'food and medicine' by the national ministry of health at present, has increasingly attracted social attention along with the improvement of living standard and the enhancement of health care consciousness of people in recent years, is increasingly popular with people as a new fruit variety due to unique taste, rich nutrition and higher active substances, has gradually gone into families of common people, and is accepted by citizens. Except fresh food, the mulberry is processed and developed into various products such as mulberry juice, mulberry wine, mulberry jam, mulberry haematochrome, mulberry vinegar and the like, the mulberry industry is initially large-scale, and the mulberry presents good diversified development momentum.

'Guangdong sang Da 10' is prepared by selecting and extracting Guangdong mulberry seedling excellent single plants from the field by the silkworm industry and agricultural product processing research institute of Guangdong province academy of agricultural sciences, belongs to Guangdong mulberry seeds, and is approved by Guangdong crop variety approval committee in 2006 (Guangdong Mulberry examination 2006001). The tree form of the variety is slightly developed, branches are thin and long, the number of main branches is large, and the lateral branch germination capacity is weak; pale-grey, straight internodes, two lines of phyllotaxis, medium, dense, round or oval skin pore size; the winter buds are triangular, sharp and brown, and the auxiliary buds are large and many; the color development of young leaf anthocyanin is medium, the shape of plant leaves is full-leaf, heart-shaped, emerald green, long-tail-shaped leaf tips, sharp teeth at the edge of the leaves, heart-shaped leaf bases, smooth and slightly wrinkled leaf surfaces, weak luster, slightly drooping leaves and thick and short leaf stalks. The fruit setting rate of cultivation is 92-96%, the average number of single buds is 5, the fruits are cylindrical, the weight of single fruits is 2.5-8.2 g, the fruits are seedless, purple black and good in flavor, the juice yield of fresh fruits is 70.0-84.0%, the soluble solid content is 9.0-13.0%, and the acidity is 2.13-5.69 g/L. The fruit yield per mu of the variety in the full-bearing period is more than 1600kg, and the leaf yield per mu is about 1800kg, so that the variety has extremely high popularization and application values.

'Yuehaoda 10' has the characteristics of high yield and high quality, and other varieties are continuously emerged to counterfeit the variety in various places in recent years, but the authenticity of the variety is difficult to distinguish and distinguish due to the external morphological characteristics in the seedling stage, and effective supervision and arbitration are difficult to realize, so that great influence is brought to the development and utilization of the variety. Therefore, there is a need for a simple, fast and effective identification technique that is true, effective, not affected by the environment, and capable of accurately distinguishing the variety.

The traditional identification of new varieties of mulberry is mainly based on phenotypic characters, is greatly influenced by environment, has poor stability and long test period, and seriously influences the effectiveness and authority of new variety identification. The molecular marker technology is a future development direction for variety identification and protection due to the characteristics of high polymorphism, short test period, no environmental influence and the like. The Simple Sequence Repeat (SSR) has the advantages of co-dominance, good repeatability, easy detection, Simple operation and the like, so the SSR molecular marker has good application prospect in the variety specificity evaluation and protection of the mulberry.

Disclosure of Invention

The purpose of the invention is: the SSR molecular marker of the new variety of the mulberry, namely Guangdong mulberry 10 ', as well as the core primer group, the kit and the application thereof are provided, the operation is simple, the SSR molecular marker can be used for identifying the authenticity of the new variety of the mulberry, namely Guangdong mulberry 10', and the SSR molecular marker can be effectively supervised and arbitrated when variety counterfeiting or disputes occur.

The first purpose of the invention is to provide a SSR molecular marker for identifying a mulberry variety 'Guangdong mulberry large 10', which comprises an SSR molecular marker M8179 and/or M10360; the repetitive motif of the SSR molecular marker M8179 is (GA) n, wherein n is more than or equal to 7, the right sequence of the SSR molecular marker is shown as SEQ ID NO.6, and the left sequence of the SSR molecular marker M8179 is shown as SEQ ID NO. 5; the repetitive motif of the SSR molecular marker M10360 is (AT) n, wherein n is more than or equal to 6, the right sequence of the SSR molecular marker is shown as SEQ ID NO.8, and the left sequence of the SSR molecular marker is shown as SEQ ID NO. 7.

The second purpose of the invention is to provide a core primer group of SSR molecular markers for identifying the variety of fruit mulberry, namely Guangdong mulberry 10', which comprises a primer aiming at the SSR molecular marker M8179 and/or a primer aiming at the SSR molecular marker M10360:

the primer aiming at the SSR molecular marker M8179 is as follows:

M8179-F: 5'-AGCTCAAGGAGAATGTTATGCTG-3' (shown in SEQ ID NO. 1);

M8179-R: 5'-TGCCAGGGCTTCTTTATTAATTT-3' (shown in SEQ ID NO. 2);

the primer aiming at the SSR molecular marker M10360 comprises the following components:

the 5' end of the primer M8179-F is marked with a fluorescent reporter group;

M10360-F: 5'-GAGTTCTTGAGGGGAAAGAGAAA-3' (shown in SEQ ID NO. 3);

M10360-R: 5'-AATTCCTGTGATCATCTGCCTTA-3' (shown in SEQ ID NO. 4);

the 5' end of the primer M10360-F is marked with a fluorescent reporter group.

Preferably, the fluorescent reporter group is FAM, HEX, TAMRA or ROX.

The third purpose of the invention is to provide a rapid detection kit for the variety of mulberry, namely Guangdong 10', which comprises the core primer group marked by the SSR molecules.

Preferably, the rapid detection kit further comprises dNTPs, Taq DNA polymerase and ddH ₂ O。

The fourth purpose of the invention is to provide a method for identifying a mulberry variety 'Yuehong10' by utilizing SSR molecular markers, which comprises the following steps:

(1) extracting the genome DNA of a mulberry fruit sample to be detected;

(2) performing PCR amplification on the genomic DNA extracted in the step (1) as a template by respectively using the primer pairs M8179-F/M8179-R and M10360-F/M10360-R;

(3) typing the PCR amplification product in the step (2), and judging the bands of the typing result; if the PCR amplification product obtained by using the primer pair M8179-F/M8179-R as the primers has only two specific bands of 128bp and 136bp, and the PCR amplification product obtained by using the primer pair M10360-F/M10360-R as the primers has only two specific bands of 168bp and 170bp, the mulberry sample to be detected is 'Yuehao 10', otherwise, the mulberry sample to be detected is 'Yuehao 10'.

Preferably, the reaction system of the PCR amplification in step (2) is 20 μ L, and includes: 50 ng/. mu.LDNA template 0.5. mu.L, 10 XPCRbuffer 2. mu.L, 25mM MgCl ₂ mu.L, 0.5. mu.L of 10mM dNTPs, 0.2. mu.L of 5U/. mu.L Taq DNA polymerase, 0.5. mu.L of 10. mu.M upstream primer, 0.5. mu.L of 10. mu.M downstream primer and ddH ₂ O 13.8μL。

Preferably, the PCR amplification in step (2) comprises the following reaction procedures: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, cooling to 1 ℃ in each cycle, extension at 72 ℃ for 30s, and circulating for 10 times; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 30 times; finally, extension is carried out for 5min at 72 ℃.

The fifth purpose of the invention is to provide the application of the SSR molecular marker or the core primer group of the SSR molecular marker or the rapid detection kit in identifying the variety of the fruit mulberry, namely Guangdong mulberry 10.

The invention utilizes fluorescence SSR technology, 300 pairs of SSR primers developed by mulberry transcriptome sequence design are screened, the core primer M8179-F/M8179-R of SSR molecular marker M8179 can amplify two specific strips of 128bp and 136bp for the 'Guangdong mulberry 10' of new variety of mulberry, the core primer M10360-F/M10360-R of SSR molecular marker M10360 can amplify two specific strips of 168bp and 170bp for the 'Guangdong mulberry 10' of new variety of mulberry, and the 'Guangdong mulberry 10' of new variety of mulberry can be respectively identified from Guangdong mulberry germplasm and can be used for rapid identification and detection of the 'Guangdong mulberry 10' of new variety of mulberry. According to the invention, a specific primer for amplifying a specific strip of 'YuehaoDa10' is obtained through a large amount of experimental data, and the specific primer is identified by directly detecting the M8179 marker and/or the M10360 marker of 'YuehaoDa10', so that the uncertainty of the identification of external morphological characteristics is overcome, the operation is simple, the detection efficiency is high, the result is reliable and intuitive, a scientific technical support is provided for the protection of 'YuehaoDa10' of a new variety of mulberry, and the invention is favorable for the popularization, utilization and protection of the variety.

Drawings

FIG. 1 is an SSR typing chart of SSR molecular marker M8179 core primer amplified Guangdong mulberry seed genome DNA with phenotype similar to those of Guangdong mulberry at seedling stage and 54 vigorous growth stage; wherein S is Guangdong 10, S is Lun109, S is Lun408, S is Lun439, S is Lun518, S is Lun540, S is Lun602, S is Miao, S is Xuan, S is 6301, S is Hongxuan, S is Guang, S is Xnza, S is Xinza, S is Bei, S is Zaa, S is Za, S is Shanng, S is Yang, S is Nanjian, S is Shanjian jian, S is Shi 2, S is Shi, S is Shanjian, S is Za, S is Shanjian, S is Za, S is Shi, S is S, S is Shanjian 2, S is S, S is 201, S is S, S is S, S is S, S is S, S is S, S is S, S is 201, S is S, S is 201, S is S, S is S, S is S, S is S, S is S.

FIG. 2 is an SSR typing chart of SSR molecular marker M10360 core primer amplified 'Guangdong mulberry 10' and 54 Guangdong mulberry species genome DNAs with similar phenotypes in seedling stage and vigorous growth stage; wherein S is Guangdong 10, S is Lun109, S is Lun408, S is Lun439, S is Lun518, S is Lun540, S is Lun602, S is Miao, S is Xuan, S is 6301, S is Hongxuan, S is Guang, S is Xnza, S is Xinza, S is Bei, S is Zaa, S is Za, S is Shanng, S is Yang, S is Nanjian, S is Shanjian jian, S is Shi 2, S is Shi, S is Shanjian, S is Za, S is Shanjian, S is Za, S is Shi, S is S, S is Shanjian 2, S is S, S is 201, S is S, S is S, S is S, S is S, S is S, S is S, S is 201, S is S, S is 201, S is S, S is S, S is S, S is S, S is S.

FIG. 3 is an SSR typing chart of genome DNA of 20 bred new varieties of fruit mulberry and new strains for production, popularization and application by SSR molecular marker M8179 core primer amplification; wherein S1 is Guangdong 10, S2 is Guangdong 74, S3 is Guangdong 28, S4 is Guangdong 123, S5 is Guangdong 143, S6 is Guangdong 145, S7 is Guangdong 33, S8 is Guangdong 201, S9 is Red Mulberry No. 2, S10 is Yunshen No. 1, S11 is Yunshen No. 2, S12 is Taiwan Changtong Mulberry, S13 is 46C019, S14 is 72C002, S15 is white pearl, S16 is white jade, S17 is black pearl, S18 is sweet osmanthus honey, S19 is Xinbai mulberry, and S20 is white mulberry No. 2.

FIG. 4 is SSR typing chart of genome DNA of 20 bred new varieties of fruit mulberry and new strains for production, popularization and application by SSR molecular marker M10360 core primer amplification; wherein S1 is Guangdong 10, S2 is Guangdong 74, S3 is Guangdong 28, S4 is Guangdong 123, S5 is Guangdong 143, S6 is Guangdong 145, S7 is Guangdong 33, S8 is Guangdong 201, S9 is Red Mulberry No. 2, S10 is Yunshen No. 1, S11 is Yunshen No. 2, S12 is Taiwan Changtong Mulberry, S13 is 46C019, S14 is 72C 019, S15 is white pearl, S16 is white jade, S17 is black pearl, S18 is sweet osmanthus honey, S19 is Xinbai mulberry, and S20 is white mulberry No. 2.

Detailed Description

To further illustrate the technical means and effects of the present invention adopted to achieve the predetermined objects, the present invention will be further described with reference to specific embodiments.

Example 1 screening of novel Mulberry variety 'Yuehong10' specific primer sequences

1. SSR primer selection

Searching a genome sequence in a mulberry genome database by using MISA software, searching SSR loci in the genome sequence, setting the length of a searched SSR motif repeating unit to be 2-6 nucleotides, setting the minimum search repetition times of 2, 3, 4, 5 and 6 nucleotides to be 6, 5, 4 and 4, setting the length of a flanking sequence of the SSR loci to be more than or equal to 150 bp, and designing SSR primers by using Primer3v2.3.4(http:// Primer3. sourcego-large.net) software according to the searched SSR loci, wherein the design standard is as follows: the length of the primer is 18-25bp, the annealing temperature is 57-63 ℃, the GC content is 40-70%, the length of the PCR product is 100-300bp, 300 pairs of primers are synthesized by randomly selecting SSR sites which can be compared with an NCBI non-redundant protein database, and each pair of primers consists of an upstream primer A and a downstream primer B. The primer sequence is synthesized by Shenzhen Hua Dagen science and technology Limited.

2. Extraction of DNA of mulberry variety

Preliminary screening is carried out by 55 varieties (serial numbers 1-55) of Guangdong mulberry seeds with similar phenotype in seedling stage and vigorous growth stage, and 'Yuexingda 10' of new mulberry varieties. The quality of the Guangdong mulberry used for the preliminary screening is shown in Table 1 (obtained from national mulberry quality resource nursery-south China Branch).

TABLE 1 preliminary screening of 55 Guangdong Morus alba germplasm

The specific screening steps are as follows:

the DNA of a new variety of mulberry, namely Guangdong mulberry 10 and other germplasms of other 54 Guangdong mulberry (shown in table 1) which are the Guangdong mulberry are extracted by an improved CTAB method, and the DNA extraction comprises the following specific steps:

(1) the formula for preparing CTAB extracting solution (Hexadecyl trimethyl ammonium bromide ) is as follows: 2% CTAB, 0.1M Tris-HCl, 20mM EDTA, 1.4M NaCl, TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0);

(2) putting 1g of material (tender material is selected as much as possible) into a mortar, and grinding the material into powder by liquid nitrogen;

(3) adding the ground material into a 10mL centrifuge tube, adding 4mL CTAB extracting solution and 80 μ L beta-mercaptoethanol (preheated at 65 ℃) and uniformly mixing, then carrying out water bath at 65 ℃ for 45min, and uniformly mixing for 3-4 times;

(4) adding 1mL of 5M KAc, and carrying out ice bath for 20 min;

(5) 4mL of chloroform was added: isoamyl alcohol (24:1), and emulsifying for 10 min;

(6) Centrifuging at 12000rpm for 10min at room temperature, and transferring the supernatant into a new 10mL centrifuge tube;

(7) taking the supernatant, adding 3M NaAc (pH 5.2) with the volume of 1/10-1/5, turning and uniformly mixing, adding isopropanol with the same volume, and uniformly mixing until DNA precipitation occurs;

(8) adding 1mL of 75% ethanol into the precipitate, rinsing for 3-4 times, and rinsing for 1 time by using absolute ethanol; precipitating DNA and drying;

(9) adding 100 μ L TE buffer solution containing 10 μ g/ml RNaseA to dissolve the precipitate, and performing water bath at 37 ℃ for 1h to degrade RNA;

(10) detecting quality by electrophoresis, detecting DNA concentration by spectrophotometer, adjusting DNA concentration to 50 ng/. mu.L, and storing at-20 deg.C.

3. PCR amplification

Taking the mulberry genome DNA extracted in the step 2 as a template, and performing PCR amplification by using an SSR fluorescence labeling detection technology, wherein the primers comprise an upstream primer and a downstream primer, the 5' end of the upstream primer is labeled with a fluorescence reporter group (FAM, HEX, TAMRA or ROX, and the HEX fluorescence labeling is used in the invention), the upstream primer is designed and synthesized in the step 1, and the downstream primer is designed and synthesized in the step 1. Upstream primer-directed PCR amplification with a fluorescent reporter group labeled at the 5' end produces a PCR product with fluorescence.

The total PCR reaction was 20. mu.L, wherein, 50 ng/. mu.LDNA template was 0.5. mu.L, 10 XPCRBBuffer was 2.0. mu.L, and 25mM MgCl was used ₂ 2.0. mu.L, 10mM dNTPs 0.5. mu.L, 5U/. mu.L DNA polymerase 0.2. mu.L, 10. mu.M forward primer 0.5. mu.L, 10. mu.M reverse primer 0.5. mu.L, ddH ₂ O 13.8μL。

The PCR reaction condition is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ (1 ℃ per cycle) for 30s, extension at 72 ℃ for 30s, and 10 cycles; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 30 times; finally, extension is carried out for 5min at 72 ℃ to obtain an amplification product.

4. Screening for polymorphic primers

And 3, taking 2.5 mu L of the amplification product in the step 3, adding 1.5 mu L of Loading Buffer, uniformly mixing and Loading, carrying out band detection after 2% agarose gel electrophoresis for 25min, and screening the product with the amplification band for sequencing and typing. The products with amplified product bands screened in the above steps were diluted to within 0.5ng, 0.5. mu.L of the product was put into Hidi containing liz500, and typing was carried out using a 3730XL DNA sequencer (ABI, USA), and the typing results were band-discriminated using GeneMarker (soft Genetics LLC, USA).

5. Data analysis

The screening results showed that 169 polymorphic primers were screened out of the 300 primers synthesized in step 1; further selecting a core primer with good repeatability and stability and capable of amplifying specific allelic sites for a new variety of mulberry ' Yuehao 10 ', and finally obtaining a primer pair M8179-F/M8179-R (M8179-F: 5'-AGCTCAAGGAGAATGTTATGCTG-3', shown as SEQ ID NO.1, M8179-R: 5'-TGCCAGGGCTTCTTTATTAATTT-3', shown as SEQ ID NO. 2) and a primer pair M10360-F/M10360-R (M10360-F: 5'-GAGTTCTTGAGGGGAAAGAGAAA-3', shown as SEQ ID NO.3, M10360-R: 5'-AATTCCTGTGATCATCTGCCTTA-3' -3 ', shown as SEQ ID NO. 4) which can be used as a specific core primer for identifying the ' Yuehao 10 '. The SSR molecule mark corresponding to the core primer M8179-F/M8179-R is M8179 mark, the repetitive motif is (GA) n, n is more than or equal to 7, the right sequence of the M8179 mark is shown as SEQ ID NO.6, and the left sequence is shown as SEQ ID NO. 5. The SSR molecule corresponding to the core primer M10360-F/M10360-R is marked as M10360, the repetitive motif is (AT) n, n is more than or equal to 6, the right sequence of the M10360 mark is shown as SEQ ID NO.8, and the left sequence is shown as SEQ ID NO. 7.

The fluorescent labeling primer M8179-F/M8179-R is used as a primer, the amplification product of the new variety of mulberry 'Yue Dao 10' marked at M8179 is two specific strips of 128bp (shown as SEQ ID NO. 9) and 136bp (shown as SEQ ID NO. 10), the fluorescent labeling primer M10360-F/M10360-R is used as a primer, the amplification product of the new variety of mulberry 'Yue Dao 10' marked at M10360 is two specific strips of 168bp (shown as SEQ ID NO. 11) and 170bp (shown as SEQ ID NO. 12), and the fluorescent labeling primer M10360-F/M10360-R or M8179-F/M8179-R can be used for identifying the new variety of mulberry 'Yue Guangdong variety' from the germplasm of the Guangdong variety with the same phenotype at the 54 seedling stage and the similar growth stage of the big mulberry 'only by using the fluorescent labeling primer M10360-F/M10360-R or the fluorescent labeling primer M8179-F/M8179-R (shown as a picture 1 and 2'), the fingerprint data are shown in table 2.

TABLE 2 statistics of capillary electrophoresis bands of 55 Guangdong mulberry seeds with primers

6. Further validation of the primers

Further verifying 2 pairs of specific core primers M8179-F/M8179-R, M10360-F/M10360-R for identifying the Mysorethorn 10 'obtained by screening, selecting 19 new varieties of Morus yunnanensis bred nationwide at present, carrying out amplification detection on the Morus yunnanensis strains and the Mysorethorn 10' with certain popularization and application in production, and carrying out amplification detection on the two varieties simultaneously, wherein the DNA extraction, amplification and detection methods are as above, and the results show that the 2 pairs of specific core primers can distinguish the Mysorethorn 10 'from other varieties (figures 3 and 4), and the amplification specific allelic sites of the Mysorethorn 10' and the other varieties are shown in Table 3.

Table 3 shows the statistics of capillary electrophoresis bands of new varieties of cultivated mulberries and new varieties for production, popularization and application

As can be seen from the results in tables 2 and 3, the SSR molecular markers M8179 and M10360 have high polymorphism, and can rapidly identify the Guangdong mulberry large 10' from 55 phenotypically similar Guangdong mulberry germplasms, 20 new mulberry varieties, and new production, popularization and application strains. However, considering that more new varieties may appear in the future, in order to identify the scientificity, the invention suggests that the core primers of the 2 SSR molecular markers are adopted for simultaneous detection, and if the result obtained by amplifying the SSR fluorescent marker primers by 2 is consistent with the invention, the variety can be identified as a new mulberry variety 'Yuandao 10'.

In the process of obtaining and identifying the specific molecular marker 'Guangdong Sanger 10', the invention firstly attaches importance to the acquisition of primers, and 300 pairs of SSR primers are randomly designed and acquired from a mulberry genome database so as to objectively evaluate the variety characteristics. The Guangdong mulberry germplasm is properly selected during primer screening, 55 Guangdong mulberry germplasms with similar phenotypes are firstly used for preliminary screening, the germplasms are similar to 'Guangdong mulberry 10' in phenotypic characters, and certain difficulty exists in phenotypic identification, so that the screening of specific core primers capable of amplifying specific bands of the 'Guangdong mulberry 10' of new variety of fruit mulberry has very important significance. On the basis of obtaining the specific core primer by preliminary screening, 20 bred new mulberry varieties and new production, popularization and application varieties are selected for verification, the banding result is consistent with the previous performance, and the Guangdong mulberry 10' can be quickly and accurately identified from the new varieties, so that the pair of primers is good in specificity and stability.

The specific core primers M8179-F/M8179-R and M10360-F/M10360-R adopted in the method provide better guarantee for the rapid and accurate detection and identification of 'Yuehao10'.

The specific core primers M8179-F/M8179-R and M10360-F/M10360-R can also be directly used as a part of a rapid detection kit for rapidly identifying a new mulberry variety 'Yueshuangdao 10'.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

It should be noted that the above-mentioned examples only represent some embodiments of the present invention, but should not be construed as limiting the scope of the invention. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Bombycis of Guangdong province academy of agricultural sciences and institute of agricultural product processing

<120> molecular marker, identification primer group, kit and application for identifying variety' Yuesheng 10

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

agctcaagga gaatgttatg ctg 23

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgccagggct tctttattaa ttt 23

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gagttcttga ggggaaagag aaa 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aattcctgtg atcatctgcc tta 23

<210> 5

<211> 22

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 5

agctcaagga gaatgttatg ct 22

<210> 6

<211> 92

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 6

aaggacaaat caaatcgtcg aacagtgaag gatgatcgtg ataagatcga agcgcaaaat 60

gtcgaatcga aattaataaa gaagccctgg ca 92

<210> 7

<211> 46

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 7

gagttcttga ggggaaagag aaaagcccaa ccagttcatg gaagcc 46

<210> 8

<211> 96

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 8

gttgttgaga gacctttcta agagtgagta gtgctaaata ttgatattaa tggaatctaa 60

taatattagc ctataaggca gatgatcaca ggaatt 96

<210> 9

<211> 128

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 9

agctcaagga gaatgttatg ctgagagaga gagagaaagg acaaatcaaa tcgtcgaaca 60

gtgaaggatg atcgtgataa gatcgaagcg caaaatgtcg aatcgaaatt aataaagaag 120

ccctggca 128

<210> 10

<211> 136

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 10

agctcaagga gaatgttatg ctgagagaga gagagagaga gagaaaggac aaatcaaatc 60

gtcgaacagt gaaggatgat cgtgataaga tcgaagcgca aaatgtcgaa tcgaaattaa 120

taaagaagcc ctggca 136

<210> 11

<211> 168

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 11

gagttcttga ggggaaagag aaaagcccaa ccagttcatg gaagccatat atatatatat 60

atatatatat atgttgttga gagacctttc taagagtgag tagtgctaaa tattgatatt 120

aatggaatct aataatatta gcctataagg cagatgatca caggaatt 168

<210> 12

<211> 170

<212> DNA

<213> Mulberry (Morus atropurpeuea)

<400> 12

gagttcttga ggggaaagag aaaagcccaa ccagttcatg gaagccatat atatatatat 60

atatatatat atatgttgtt gagagacctt tctaagagtg agtagtgcta aatattgata 120

ttaatggaat ctaataatat tagcctataa ggcagatgat cacaggaatt 170

Claims

1. An SSR molecular marker for identifying a variety of fruit mulberry, Guangdong mulberry and large 10', which is characterized by comprising an SSR molecular marker M8179 and/or M10360; the repetitive motif of the SSR molecular marker M8179 is (GA) n, wherein n is more than or equal to 7, the right sequence of the SSR molecular marker is shown as SEQ ID NO.6, and the left sequence of the SSR molecular marker M8179 is shown as SEQ ID NO. 5; the repetitive motif of the SSR molecular marker M10360 is (AT) n, wherein n is more than or equal to 6, the right sequence of the SSR molecular marker is shown as SEQ ID NO.8, and the left sequence of the SSR molecular marker is shown as SEQ ID NO. 7.

2. A core primer group of SSR molecular markers for identifying a fruit mulberry variety 'Yuehong10' is characterized by comprising primers aiming at an SSR molecular marker M8179 and/or primers aiming at an SSR molecular marker M10360:

the primer aiming at the SSR molecular marker M8179 is as follows:

M8179-F：5’- AGCTCAAGGAGAATGTTATGCTG -3’；

M8179-R：5’- TGCCAGGGCTTCTTTATTAATTT -3’；

The 5' end of the primer M8179-F is marked with a fluorescent reporter group;

the primer aiming at the SSR molecular marker M10360 is as follows:

M10360-F：5’-GAGTTCTTGAGGGGAAAGAGAAA-3’；

M10360-R：5’-AATTCCTGTGATCATCTGCCTTA-3’；

the 5' end of the primer M10360-F is marked with a fluorescent reporter group.

3. A core primer set of SSR molecular markers for the identification of the variety of fruit mulberry, Guangdong mulberry 10, according to claim 2, wherein said fluorescence reporter group is FAM, HEX, TAMRA or ROX.

4. A rapid detection kit for identifying the variety of Morus yuehensis 10' comprising the SSR molecular marker core primer set of claim 2 or 3.

5. A method for identifying a mulberry variety 'Yuehaodan 10' by utilizing SSR molecular markers is characterized by comprising the following steps:

(1) extracting the genome DNA of a mulberry fruit sample to be detected;

(2) performing PCR amplification by using the genomic DNA extracted in the step (1) as a template and using the primer pairs M8179-F/M8179-R and M10360-F/M10360-R according to claim 2 or 3 respectively;

(3) typing the PCR amplification product in the step (2), and judging the bands of the typing result; if the PCR amplification product obtained by using the primer pair M8179-F/M8179-R as the primers has only two specific bands of 128 bp and 136 bp, and the PCR amplification product obtained by using the primer pair M10360-F/M10360-R as the primers has only two specific bands of 168 bp and 170 bp, the mulberry sample to be detected is 'Yuehao 10', otherwise, the mulberry sample to be detected is 'Yuehao 10'.

6. The method for identifying the variety of fruit mulberry, Guangdong mulberry 10', by using SSR molecular markers according to claim 5, wherein the PCR amplification in step (2) is performed in 20 μ L reaction system, and comprises: 0.5. mu.L of 50 ng/. mu.L DNA template, 2. mu.L of 10 XPCR buffer,25 mM MgCl ₂ mu.L, 0.5. mu.L of 10 mM dNTPs, 0.2. mu.L of 5U/. mu.L Taq DNA polymerase, 0.5. mu.L of 10. mu.M upstream primer, 0.5. mu.L of 10. mu.M downstream primer and ddH ₂ O13.8 mu L; the PCR amplification of the step (2) comprises the following reaction procedures: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s, annealing at 60 ℃ for 30 s, cooling to 1 ℃ in each cycle, extension at 72 ℃ for 30 s, and circulating for 10 times; denaturation at 94 ℃ for 30 s, annealing at 50 ℃ for 30 s, and extension at 72 ℃ for 30 s, and circulating for 30 times; finally, extension is carried out for 5 min at 72 ℃.

7. Use of the core primer set of claim 2 or 3 or the rapid test kit of claim 4 for identifying the variety morus yuehensis 10'.