CN108841740A - A kind of Pichi strain of high yield alpha-galactosidase - Google Patents
A kind of Pichi strain of high yield alpha-galactosidase Download PDFInfo
- Publication number
- CN108841740A CN108841740A CN201810753711.4A CN201810753711A CN108841740A CN 108841740 A CN108841740 A CN 108841740A CN 201810753711 A CN201810753711 A CN 201810753711A CN 108841740 A CN108841740 A CN 108841740A
- Authority
- CN
- China
- Prior art keywords
- alpha
- galactosidase
- pichia pastoris
- gly
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2465—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on alpha-galactose-glycoside bonds, e.g. alpha-galactosidase (3.2.1.22)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01022—Alpha-galactosidase (3.2.1.22)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of Pichia pastoris mutant strain, deposit number is CCTCC NO:M2018376.The mutant strain can high efficiency recombinant expressed alpha-galactosidase, alpha -galactosidase enzyme is living in shake flask fermentation supernatant is up to 109U/ml, improves 137% than going out bacterium germination；Alpha -galactosidase enzyme is living in 20L tank fermented supernatant fluid is up to 7576U/mL, improves 69% than going out bacterium germination, unexpected technical results have been achieved.Moreover, the zymologic property of the alpha-galactosidase of mutant strain Pichia pastoris AG2 recombinant expression does not change, and most suitable action pH is 3-7, and optimum temperature is 60 DEG C compared with bacterium germination out.The mutant strain Pichia pastoris AG2 can be widely applied to the production of alpha-galactosidase.
Description
Technical field
The invention belongs to gene engineering technology fields, and in particular to the Pichia pastoris engineering of plant height production alpha-galactosidase
Bacterial strain and its application.
Background technique
Alpha-galactosidase (α-galactosidase) is a kind of exoglycosidase for being catalyzed the hydrolysis of alpha-galactoside key,
Because that can decompose melibiose, also known as melibiase, it can be catalyzed the hydrolysis of alpha-galactoside key.The catalytic action of alpha-galactosidase
Be remove bottom end α-connection irreducibility D- galactolipin, or by transglycosylation by galactolipin group with α -1,6
Glycosidic bond is transferred on receptor C6 hydroxyls.Substrate and receptor containing this kind of glycosidic bonds are widely distributed in nature,
Therefore, alpha-galactosidase has a wide range of applications in industry, food, medical treatment and scientific research, it is considered to be most has application
One of enzyme preparation of potentiality.
Alpha-galactosidase is widely present in plant, microorganism and animal, belongs to glycoside hydrolase the 26th and 37 families.
Wherein, the alpha-galactosidase of the 26th family is only derived from eucaryote, and the alpha-galactosidase of the 37th family then mainly comes
Derived from prokaryotes.According to enzyme activity and optimal pH, alpha-galactosidase is divided into acid and alkalinity.For the α-half of plant origin
The research of lactoside enzyme is relatively more, has had been found that the enzyme in vegetable seeds, fruit, leaf and stem tuber, and from seed and
The mostly of leaf are acid alpha-galactosidases, belong to the 37th family of glycoside hydrolase.Alkaline alpha-galactosidase has synthesis more
Enzyme effect, and belong to the 26th family of glycoside hydrolase.
Corn-soybean meal feed is because having high gross protein value, amino acid content balance and being rich in the nutrition such as lysine
Feature is good protein feed source.But alpha-galactoside contents of saccharide is relatively high in dregs of beans and miscellaneous dregs of rice class feed,
It is a kind of anti-nutritional factors in feed, simple processing method is difficult to be decomposed, and nonruminant cannot be secreted and digest such
The enzyme of substance, only by that could utilize oligosaccharide after microbial fermentation, and the volatile fatty acid and various gases that generate are equal
It can make animal ventosity, abdominal pain, diarrhea, nausea and anorexia etc..In addition, these oligosaccharide can also stimulate intestines peristalsis, improve
Feed by gastral speed, reduce chyme in alimentary canal residence time, to influence the digestion and absorption of nutriment.
Alpha-galactoside is considered as therefore the principal element that animal intake feed causes enteron aisle abdominal distension later is decomposed in removal feed
Anti-nutritional factors alpha-galactoside be particularly important.External source alpha-galactoside enzyme preparation is added in feed, it can specificity
Catalytically hydrolyzing alpha -1,6 glycosidic bond, make alpha-galactoside decompose to obtain oligosaccharide and monosaccharide.Alpha-galactosidase can effectively drop
The anti-nutritional factors such as alpha-galactoside present in feed are solved, chymeviscosity is reduced, reduce young animal diarrhea disease percentage；Enhancing
The immune function and disease resistance of animal reduce the dosage of antibiotic in feed；Digestive organs compensatory hypertrophy is alleviated or avoided
And hypertrophy, it reduces animal and maintains requirement, improve fodder energy potency；Expand raw material in feed formula and use type, reduces and support
Grow cost etc..
Currently, commercially available alpha-galactosidase product category is fewer, and because production producing strain is lower, lead to the enzyme
Hold at high price, seriously limit extensive use of the enzyme in feed.Therefore, the life of high yield alpha-galactosidase is developed
It is extremely urgent to produce bacterial strain.
Summary of the invention
The present invention is to solve prior art problem, provides a kind of Pichia pastoris mutant strain.The Pichia pastoris mutation
Bacterial strain is that the Pichia yeast engineering obtained by building is obtained through ultraviolet mutagenesis, can increase substantially the table of alpha-galactosidase
Up to amount, and the zymologic property and application effect of alpha-galactosidase are not influenced to recombinate.
One aspect of the present invention provides a kind of pichia pastoris engineered strain, and the bacterial strain is carried for recombinantly expressing α-half
The recombinant plasmid of lactose glycoside enzyme gene.
The amino acid sequence of the alpha-galactosidase is SEQ ID NO:1, coding nucleotide sequence is SEQ ID
NO:2。
One aspect of the present invention provides a kind of Pichia pastoris mutant strain Pichia pastoris AG2 (Pichia pastoris
AG2), the China typical culture collection administrative center of Wuhan, China Wuhan University, preservation are preserved on June 15th, 2018
Number is CCTCC NO:M2018376.
The present invention also provides application of the Pichia pastoris mutant strain in production alpha-galactosidase.
The present invention obtains the high efficiency recombinant expressed alpha-galactosidase of mutant strain Pichia pastoris AG2 energy by ultraviolet screening,
Alpha -galactosidase enzyme is living in its shake flask fermentation supernatant is up to 109U/ml, improves 137% than going out bacterium germination；In the fermentation of 20L tank
Alpha -galactosidase enzyme is living in clear liquid is up to 7576U/mL, improves 69% than going out bacterium germination, achieves unexpected technology effect
Fruit.Moreover, the zymologic property of the alpha-galactosidase of mutant strain Pichia pastoris AG2 recombinant expression is not compared with bacterium germination out
It changes, most suitable action pH is 3-7, and optimum temperature is 60 DEG C.The mutant strain Pichia pastoris AG2 can be extensive
Applied to the production of alpha-galactosidase, be conducive to the production cost for significantly reducing the enzyme, and then promote the enzyme in field of fodder
In promotion and application.
Detailed description of the invention
Fig. 1：Bacterium germination and mutant bacteria Pichia pastoris AG2 fermented supernatant fluid pH- are with respect to enzyme activity curve out；
Fig. 2：Bacterium germination and mutant bacteria Pichia pastoris AG2 fermented supernatant fluid temperature-are with respect to enzyme activity curve out；
Fig. 3：Bacterium germination and mutant bacteria Pichia pastoris AG2 course of fermentation curve graph out.
Specific embodiment
Method of the invention is described further below with reference to example.The reality of actual conditions is not specified in the following example
Proved recipe method, usually can routinely condition, as J. Pehanorm Brooker (Sambrook) etc. is write《Molecular Cloning:A Laboratory guide》In
The condition, or run according to the normal condition proposed by manufacturer.Those skill in the art related can be by embodiment
More fully understand and grasp the present invention.But protection and scope of the claims of the invention is not limited only to provided specific case
Example, and should include those skilled in the art on the basis of this specification, it is not required to the protection model that can be extended by creative work
It encloses.
The building of 1 recombinant plasmid of embodiment
Using aspergillus niger (Aspergillus niger) Su genome as template, α-half is amplified using primer 1 and primer 2
Lactose glycoside enzyme gene segment, nucleotide sequence (removal introne) is SEQ ID NO：2, coding amino acid sequence be
SEQ ID NO：1.
PCR primer and reaction condition are as follows：
Primer 1 (F)：GCTCCCGCAGTTGGGGCTTCA
Primer 2 (R)：TTATTGCCGCTCCAGAAAGAC
Reaction condition is：94 DEG C of denaturation 5min；Then 94 DEG C of denaturation 30s, 56 DEG C of renaturation 30s, 72 DEG C of extension 120s, 30
After circulation, 72 DEG C of heat preservation 10min.Agarose electrophoresis is the results show that the alpha-galactosidase gene size that amplification obtains is
2178bp。
Digestion is carried out to alpha-galactosidase gene with restriction enzyme EcoR I and Not I (Fermentas)；Together
When, digestion is carried out to plasmid pPIC9K with restriction enzyme EcoR I and Not I.Digestion is produced using gel purification kit
Object purifying, and connected above-mentioned two digestion products with T4DNA ligase (Fermentas).Connection product is transformed into
Trans5 α-Escherichia coli (Transgen), is selected with ampicillin.It is accurate to ensure, several clones are sequenced
(Invitrogen)。
Using Plasmid Miniprep Kit (Axygen) from sequencing result correct escherichia coli cloning plasmid purification.
1 recombinant plasmid is obtained, the DNA sequence dna that sequencing result display obtains is SEQ ID NO:2, the protein sequence of coding is SEQ
ID NO:1.To illustrate construction of recombinant plasmid success, it is named as pPIC9K-AG.
The building of 2 pichia pastoris engineered strain of embodiment
Recombinant plasmid pPIC9K-AG is linearized with Sal I, plasmid linearization segment converts place by electroporation
Chief cell Pichia pastoris (Pichia pastoris) GS115, screening obtains Pichia pastoris recombinant bacterial strain GS115/ on MD plate
PPIC9K-AG, then on the YPD plate of the Geneticin containing various concentration screen multicopy transformant.
The single transformant switching of picking after 30 DEG C of 250rpm shaken cultivation 1d, then is transferred to BMM culture in BMGY culture medium
30 DEG C of 250rpm shaken cultivations in base add 0.5% methanol daily；After inducing expression 4d, centrifugation removal thallus is obtained containing α-
The fermented supernatant fluid of galactosidase；Fermented supernatant fluid is subjected to SDS-PAGE electrophoresis detection and Enzyme activity assay respectively.As a result it shows
Show, the molecular size range of alpha-galactosidase is 80kDa or so in fermented supernatant fluid, and the enzyme activity of alpha-galactosidase reaches 46U/
ml.To illustrate, the pichia pastoris engineered strain for recombinantly expressing the alpha-galactosidase is constructed successfully, and applicant is named
For Pichia pastoris AG (Pichia pastoris AG).
(1) definition of alpha -galactosidase enzyme unit living
Under conditions of 37 DEG C, pH value are 5.0, the p-nitrophenol-α-D- pyrans for being per minute 1.5mg/ml from concentration
It is an enzyme activity unit U that enzyme amount required for 1 μm of ol p-nitrophenol is discharged in galactoside solution.
(2) enzyme activity determination method
Taking 0.5ml concentration is the p-nitrophenol-α-D- galactopyranoside solution of 3mg/ml, is added in colorimetric cylinder,
37 DEG C of balance 5min add 0.5ml and suitably dilute through pH5.0 disodium hydrogen phosphate-citrate buffer solution and balance through 37 DEG C
Alpha -galactosidase enzyme liquid, mix in 37 DEG C of accurate insulation reaction 10min.After reaction, 4ml concentration is added is
The Na of 0.5mol/L2CO3Reagent is mixed to terminate reaction.It then cools to room temperature, using standard blank sample as blank control,
Light absorption value A is measured at 400nmE, corresponding p-nitrophenol is gone out according to p-nitrophenol standard curve regression equation calculation
Ug number R=(AE-b)/K。
Enzyme activity calculation formula：
In formula：XDFor the vigor of alpha-galactosidase in enzyme solution, U/ml；R is the p-nitrophenol ug number being calculated；10
For reaction time 10min；0.5 is addition enzyme solution volume 0.5ml；N is enzyme solution extension rate；139.11 for rubbing for p-nitrophenol
That quality, 139.11g/mol.
The mutagenesis screening of 3 pichia pastoris engineered strain AG of embodiment
Mutation randomness caused by ultraviolet mutagenesis is very strong, and it is also random for being mutated the effect of generation, it is difficult to be predicted.Therefore,
In order to obtain effective direct mutation, technical staff usually requires to carry out more wheel ultraviolet mutagenesis, the larger workload of screening, Er Qiecun
A possibility that can not obtain effective direct mutation.But because equipment needed for ultraviolet mutagenesis is simple, expense is few, and can be in the short time
Interior acquisition mass mutation body, therefore, it is still a kind of common mutagenic breeding method now.
Applicant carries out science of heredity transformation to it using Pichia pastoris AG as starting strain, by ultraviolet mutagenesis method, into one
Step improves the yield of its alpha-galactosidase.
Starting strain Pichia pastoris AG is inoculated in YPD plate, 30 DEG C of culture 2-3d are made using sterile washing thallus
Suspension is diluted to 1 × 106A/mL, ultraviolet lamp (40W) irradiate 2-10min, distance about 22cm, lethality reach 90% with
On, spread plate.30 DEG C of culture 48h.
First round ultraviolet mutagenesis obtains about 300 mutant bacteria single colonies altogether, and each single colonie is inoculated in respectively and is equipped with
In 96 orifice plates of 200ul BMGY fluid nutrient medium, 30 DEG C, after 250rpm shaken cultivation 1d, upper layer culture medium is removed in centrifugation, then
200ul BMM culture medium is added, 30 DEG C, 250rpm shaken cultivation 2d, adds 0.5% methanol daily.After inducing expression 2d, from
The heart removes thallus, obtains the fermented supernatant fluid containing alpha-galactosidase, measures the enzyme activity of alpha-galactosidase.Finished with going out bacterium germination
Red yeast AG filters out the mutant strain that fermentation enzyme activity is significantly improved as control.
The results show that in the mutant bacteria that first round Uv-induced screening obtains, without in a plant mutant bacterium fermented supernatant fluid
The enzyme activity of alpha-galactosidase is higher than bacterium germination.Applicant has continued 10 wheel mutagenesis screenings according to the method described above again, finally
The mutant strain that 6 plants of alpha-galactoside production of enzyme are significantly higher than bacterium germination out is obtained, names Pichia pastoris AG1, AG2, AG3 respectively,
AG4, AG5, AG6.
The 6 plant mutant bacterium (AG1, AG2, AG3, AG4, AG5, AG6) that above-mentioned screening is obtained are transferred respectively to be cultivated in BMGY
In base, 30 DEG C, after 250rpm shaken cultivation 1d, then it is transferred in BMM culture medium, 30 DEG C, 250rpm shaken cultivation, adds daily
0.5% methanol；After inducing expression 4d, centrifugation removal thallus obtains fermented supernatant fluid；Fermented supernatant fluid is subjected to α-galactolipin
Glycosides enzyme Enzyme activity assay.The results show that Pichia pastoris AG2 fermented supernatant fluid enzyme activity highest in above-mentioned mutant strain, reaches 109U/
Ml improves 137% than going out bacterium germination Pichia pastoris AG, and unexpected technical results have been achieved.
Applicant is on June 15th, 2018 by mutant strain Pichia pastoris AG2 (Pichia pastoris AG2) preservation
In the China typical culture collection administrative center of Wuhan, China Wuhan University, deposit number is CCTCC NO:M2018376.
The characterization analysis of 4 alpha-galactosidase of embodiment
1, Optimun pH
It is respectively 2.0,2.5,3.0,4.0,5.0,5.5,6.0,6.5,7.0,8.0 buffer using pH value, it will be above-mentioned
The fermented supernatant fluid of bacterium germination Pichia pastoris AG and mutant bacteria Pichia pastoris AG2 are diluted measurement, p-nitrophenol-α-respectively out
D- galactopyranoside substrate also respectively with the buffer of corresponding pH value, carries out alpha-galactoside enzyme activity under the conditions of 37 DEG C
Power measurement, calculates enzyme activity, with highest enzyme activity for 100%, calculates opposite enzyme activity, is pH- with respect to enzyme activity curve.As a result such as Fig. 1 institute
Show, the alpha-galactosidase pH- of bacterium germination Pichia pastoris AG and mutant bacteria Pichia pastoris AG2 recombinant expression is with respect to enzyme activity curve base out
This is identical, and most suitable action pH is 3-7.
2, optimum temperature
Respectively in 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, 70 DEG C, under the conditions of pH5.0, in measurement
Alpha-galactoside enzyme activity in bacterium germination Pichia pastoris AG and mutant bacteria Pichia pastoris AG2 fermented supernatant fluid is stated out, with highest enzyme activity
It is 100%, calculates opposite enzyme activity, does temperature-with respect to enzyme activity curve.As a result as shown in Fig. 2, bacterium germination Pichia pastoris AG and mutation out
The alpha-galactosidase temperature-of bacterium Pichia pastoris AG2 recombinant expression is essentially identical with respect to enzyme activity curve, and optimum temperature is
60℃。
In conclusion the alpha-galactosidase for the mutant strain AG2 recombinant expression that the present invention is obtained by ultraviolet screening,
Zymologic property is identical as before mutation, and most suitable action pH is 3-7, and optimum temperature is 60 DEG C.
5 fermentation scale-up of embodiment
Carry out setting out on 20L fermentor the fermentation of bacterium Pichia pastoris AG and mutant bacteria Pichia pastoris AG2, and fermenting uses
Culture medium prescription is：Calcium sulfate 1.1g/L, potassium dihydrogen phosphate 5.5g/L, ammonium dihydrogen phosphate 55g/L, potassium sulfate 20.3g/L, sulfuric acid
Magnesium 16.4g/L, potassium hydroxide 1.65g/L, defoaming agent 0.05%.
Fermentation manufacturing technique：PH value 5.0,25 DEG C of temperature, stirring rate 300rpm, ventilation quantity 1.0-1.5 (v/v), dissolved oxygen
Control is 20% or more.
Entire fermentation process is divided into three phases：First stage be thallus cultivation stage, by 7% ratio access seed, 30
DEG C culture 24-26h, with mended glucose for mark；Second stage is the hungry stage, after glucose has been mended, does not flow plus appoints
What carbon source, terminates, by a definite date about 30-60min when dissolved oxygen rose to for 80% stage indicated above；Phase III is inducing expression rank
Section, stream plus methanol induction, and keep dissolved oxygen 20% or more, incubation time is in 160h or so.After fermentation, fermentation liquid is logical
Crude enzyme liquid is obtained after crossing flame filter press processing.
By alpha-galactoside enzyme activity in different time points fermentation liquid in measurement fermentation process, course of fermentation song can be obtained
Line.As a result as shown in figure 3, the fermentation liquid enzyme activity of mutant bacteria Pichia pastoris AG2 of the present invention starts significantly high after fermentation 85h
In bacterium germination out；When fermentation ends, the final fermentation enzyme activity of bacterium germination Pichia pastoris AG is 4491U/ml out, and mutant bacteria Pichia pastoris
The final fermentation enzyme activity of AG2 is up to 7576U/ml, improves 69% than going out bacterium germination, unexpected technical results have been achieved.
Sequence table
<110>Qingdao Weilan Biology Group Co., Ltd.
<120>A kind of Pichi strain of high yield alpha-galactosidase
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 725
<212> PRT
<213>Aspergillus niger (Aspergillus niger)
<400> 1
Ala Pro Ala Val Gly Ala Ser Asn Ser Gln Ala Ile Ile Ala Asn Gly
1 5 10 15
Thr Asp Phe Ala Leu Asn Gly Asp Asn Val Ser Tyr Arg Phe His Val
20 25 30
Asn Ser Thr Thr Gly Asp Leu Ile Ser Asp His Phe Gly Gly Val Val
35 40 45
Thr Gly Thr Ile Pro Ser Pro Val Glu Pro Ala Val Asn Gly Trp Val
50 55 60
Gly Met Pro Gly Arg Ile Arg Arg Glu Phe Pro Asp Gln Gly Arg Gly
65 70 75 80
Asp Phe Arg Ile Pro Ala Val Arg Ile Arg Glu Ser Ala Gly Tyr Thr
85 90 95
Ile Ser Asp Leu Gln Tyr Val Ser His Glu Val Ile Ala Gly Lys Asn
100 105 110
Ala Leu Pro Gly Leu Pro Ala Thr Phe Gly Asp Ala Gln Asp Ala Thr
115 120 125
Thr Leu Val Val His Leu Tyr Asp Asn Tyr Ser Ser Val Ala Ala Asp
130 135 140
Leu Ser Tyr Ser Ile Phe Pro Lys Tyr Asp Ala Ile Val Arg Ser Val
145 150 155 160
Asn Val Thr Asn Gln Gly Pro Gly Asn Ile Thr Ile Glu Ala Leu Ala
165 170 175
Ser Ile Ser Ile Asp Phe Pro Tyr Glu Asp Leu Asp Leu Val Ser Leu
180 185 190
Arg Gly Asp Trp Ala Arg Glu Ala Asn Val Gln Arg Ser Lys Val Gln
195 200 205
Tyr Gly Ile Gln Gly Phe Gly Ser Ser Thr Gly Tyr Ser Ser His Leu
210 215 220
His Asn Pro Phe Phe Ala Ile Val Asp Pro Ala Thr Thr Glu Ser Gln
225 230 235 240
Gly Glu Ala Trp Gly Phe Asn Leu Ile Tyr Thr Gly Ser Phe Ser Ala
245 250 255
Gln Ile Glu Lys Gly Ser Gln Gly Phe Thr Arg Ala Leu Leu Gly Leu
260 265 270
Asn Pro Asp Gln Leu Ser Trp Asn Leu Gly Pro Gly Glu Thr Leu Thr
275 280 285
Ser Pro Glu Cys Val Ala Val Tyr Ser Asn Gln Gly Leu Gly Ser Val
290 295 300
Ser Arg Lys Phe His Arg Leu Tyr Arg Asn His Leu Met Lys Ser Lys
305 310 315 320
Phe Ala Thr Ser Asp Arg Pro Val Leu Leu Asn Ser Trp Glu Gly Val
325 330 335
Tyr Phe Asp Tyr Asn Gln Ser Ser Ile Glu Thr Leu Ala Glu Glu Ser
340 345 350
Ala Ala Leu Gly Val His Leu Phe Val Met Asp Asp Gly Trp Phe Gly
355 360 365
Asp Lys Tyr Pro Arg Val Ser Asp Asp Ala Gly Leu Gly Asp Trp Met
370 375 380
Pro Asn Pro Ala Arg Phe Pro Asp Gly Leu Thr Pro Val Val Gln Asp
385 390 395 400
Ile Thr Asn Met Thr Val Asn Gly Thr Asp Ser Thr Lys Leu Arg Phe
405 410 415
Gly Ile Trp Val Glu Pro Glu Met Val Asn Pro Asn Ser Thr Leu Tyr
420 425 430
His Glu His Pro Asp Trp Ala Leu His Ala Gly Pro Tyr Pro Arg Thr
435 440 445
Glu Arg Arg Asn Gln Leu Val Leu Asn Leu Ala Leu Pro Ala Val Gln
450 455 460
Asp Phe Ile Ile Gly Phe Met Thr Asn Leu Leu Gln Thr Pro Gly Ile
465 470 475 480
Ser Tyr Val Lys Trp Asp Asn Asn Arg Gly Ile His Glu Thr Pro Ser
485 490 495
Pro Ser Thr Asp His Gln Tyr Met Leu Gly Leu Tyr Arg Val Phe Asp
500 505 510
Thr Leu Thr Thr Arg Phe Pro Asp Val Leu Trp Glu Gly Cys Ala Ser
515 520 525
Gly Gly Gly Arg Phe Asp Ala Gly Val Leu Gln Tyr Phe Pro Gln Ile
530 535 540
Trp Ala Ser Asp Asn Thr Asp Ala Ile Asp Arg Ile Thr Ile Gln Phe
545 550 555 560
Gly Thr Ser Leu Ala Tyr Pro Pro Ser Ala Met Gly Ala His Leu Ser
565 570 575
Ala Val Pro Asn Ala Gln Thr Gly Arg Thr Val Pro Ile Thr Phe Arg
580 585 590
Ala His Val Ala Met Met Gly Gly Ser Phe Gly Leu Glu Leu Asp Pro
595 600 605
Ala Thr Val Glu Gly Asp Ala Ile Val Pro Glu Leu Leu Ala Leu Ala
610 615 620
Glu Lys Val Asn Pro Ile Val Leu Asn Gly Asp Leu Tyr Arg Leu Arg
625 630 635 640
Leu Pro Gln Asp Ser Gln Trp Pro Ala Ala Leu Phe Val Ser Glu Asp
645 650 655
Gly Ala Gln Ala Val Leu Phe Tyr Phe Gln Val Gln Pro Asn Val Asn
660 665 670
His Ala Val Pro Trp Val Arg Leu Gln Gly Leu Asp Pro Glu Ala Gln
675 680 685
Tyr Thr Val Asp Gly Asp Gln Thr Tyr Ser Gly Ala Thr Leu Met Asn
690 695 700
Leu Gly Leu Gln Tyr Ser Phe Asp Thr Glu Tyr Gly Ser Lys Val Val
705 710 715 720
Phe Leu Glu Arg Gln
725
<210> 2
<211> 2178
<212> DNA
<213>Aspergillus niger (Aspergillus niger)
<400> 2
gctcccgcag ttggggcttc aaattcacag gcgatcattg cgaatggcac tgatttcgcg 60
ttgaacggcg acaatgtctc atatcggttc catgttaaca gcaccaccgg agacttgatc 120
tctgatcact tcggtggtgt cgtcaccggc acaatcccat cgccagtgga acccgctgtc 180
aatggctggg ttggcatgcc tggtcgaatt cgtcgggagt tccccgacca aggccgtggt 240
gattttcgca ttcccgccgt tcgtatccgg gaatcggcag gttatactat tagcgatctt 300
caatatgtgt cgcacgaggt gattgcgggt aagaatgctt tgcctggcct gcctgccaca 360
tttggagatg cacaagacgc tacgactttg gtagtccacc tctatgacaa ctatagctcc 420
gtcgccgccg acttgtcata ctccatattt ccaaaatatg atgccatcgt gaggagtgtc 480
aatgtgacta accagggccc gggtaatatc accatcgagg cccttgcaag cataagcatc 540
gatttccctt acgaagacct tgacttggtc agcctccgtg gtgactgggc cagagaggcc 600
aatgttcaga gaagcaaagt gcagtatggc atccaggggt tcggaagcag cactggatat 660
tcctctcacc ttcacaatcc tttctttgcc attgtagatc cagctactac cgagtcgcaa 720
ggcgaggcat ggggctttaa ccttatctat acgggttctt tctctgccca gatagagaaa 780
ggatcgcaag gtttcacccg ggcactgttg ggtctcaacc cagatcaatt gtcatggaac 840
cttggtcctg gcgagaccct aacctccccg gagtgtgttg cagtatactc gaaccaagga 900
ctcggctcag tgtctcgcaa attccaccga ctatatcgaa accacctcat gaagagcaag 960
ttcgccactt ccgaccgtcc cgttctcctg aatagctggg aaggagttta tttcgactat 1020
aaccaaagca gcattgagac tctggccgaa gagtccgctg ccctgggtgt ccacctcttt 1080
gtcatggacg acggctggtt tggtgacaag taccctcgcg tgtccgatga tgccgggctg 1140
ggagactgga tgcccaaccc agcacgcttc ccagacgggt tgaccccagt cgtgcaagac 1200
attacgaata tgaccgtcaa tggaacagac tccacaaagc ttcgttttgg tatttgggtg 1260
gagcccgaga tggtcaaccc caattccact ctctaccacg aacatccgga ctgggcgctt 1320
catgctgggc cctacccccg taccgagcgt cggaaccagc tcgttctgaa cctggcgctt 1380
ccggctgtgc aggatttcat tataggcttc atgaccaacc tcttgcaaac tccaggcatc 1440
tcttatgtta aatgggacaa caaccgggga atacacgaga ctccgtcccc gtccactgac 1500
caccagtaca tgctagggct ctaccgggtg ttcgacacgc tgaccacccg cttcccagat 1560
gtactgtggg aaggatgtgc ctcaggcggc ggccgctttg atgccggtgt gctgcagtat 1620
ttcccccaga tttgggcttc tgacaacacc gacgcgattg accgaatcac cattcaattc 1680
gggacctcac ttgcctaccc gccatcagca atgggagccc acctgtccgc ggttcctaat 1740
gcacaaactg gtcgcactgt gcctattact ttccgcgctc acgttgctat gatgggtggc 1800
tctttcggct tggagctcga cccagccacg gtggaaggtg acgccatagt ccccgagctc 1860
cttgcgctgg cggagaaagt gaaccccatc gtcttgaacg gagatctgta ccggttacgc 1920
ctgcctcaag actcccagtg gcctgccgca cttttcgtgt ccgaggatgg cgcccaagct 1980
gttctgtttt acttccaggt ccagccaaat gtcaaccatg ccgtgccgtg ggttcggcta 2040
caggggttgg accctgaggc gcaatatact gttgatggtg accagactta ctccggtgca 2100
acgctgatga atctggggtt gcagtatagc tttgatacgg agtatggtag caaggtagtc 2160
tttctggagc ggcaataa 2178
Claims (5)
1. a kind of pichia pastoris engineered strain, which is characterized in that the pichia pastoris engineered strain is carried for recombinating table
Up to the recombinant plasmid of alpha-galactosidase.
2. pichia pastoris engineered strain as described in claim 1, which is characterized in that the amino acid of the alpha-galactosidase
Sequence is SEQ ID NO:1.
3. pichia pastoris engineered strain as claimed in claim 2, which is characterized in that the alpha-galactosidase, coding
Nucleotides sequence is classified as SEQ ID NO:2.
4. a kind of Pichia pastoris mutant strain, which is characterized in that the deposit number of the Pichia pastoris mutant strain is CCTCC
NO:M2018376。
5. application of the Pichia pastoris mutant strain as claimed in claim 4 in production alpha-galactosidase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810753711.4A CN108841740B (en) | 2018-07-10 | 2018-07-10 | Pichia pastoris strain for high yield of alpha-galactosidase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810753711.4A CN108841740B (en) | 2018-07-10 | 2018-07-10 | Pichia pastoris strain for high yield of alpha-galactosidase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108841740A true CN108841740A (en) | 2018-11-20 |
| CN108841740B CN108841740B (en) | 2021-07-09 |
Family
ID=64196146
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810753711.4A Active CN108841740B (en) | 2018-07-10 | 2018-07-10 | Pichia pastoris strain for high yield of alpha-galactosidase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108841740B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113234743A (en) * | 2021-06-07 | 2021-08-10 | 广东溢多利生物科技股份有限公司 | Heat-resistant alpha-galactosidase gene and application thereof |
| CN114606151A (en) * | 2022-04-27 | 2022-06-10 | 南京工业大学 | Recombinant pichia pastoris with surface displaying beta-galactosidase and construction method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001036586A2 (en) * | 1999-11-19 | 2001-05-25 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Aspegillus niger beta-glucosidase gene, protein and uses thereof |
| PL374767A1 (en) * | 2005-04-29 | 2006-10-30 | Politechnika Gdanska | Oligonucleotide starters, DNA sequence, plasmide vector, expression vector, recombinant Pichia pastoris strain and method for its obtaining as well as the method for the manufacture of thermostable ß-D-galactosidase Pyrococcus woesei |
| CN101074435A (en) * | 2006-05-16 | 2007-11-21 | 中国农业科学院饲料研究所 | Alpha-galactosidase gene, its coding protein, production and use |
| CN105219791A (en) * | 2015-10-27 | 2016-01-06 | 中国科学院青岛生物能源与过程研究所 | The engineering bacteria of efficient secretory expression aspergillus niger alpha-galactosidase A GA and structure thereof and application |
-
2018
- 2018-07-10 CN CN201810753711.4A patent/CN108841740B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001036586A2 (en) * | 1999-11-19 | 2001-05-25 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Aspegillus niger beta-glucosidase gene, protein and uses thereof |
| PL374767A1 (en) * | 2005-04-29 | 2006-10-30 | Politechnika Gdanska | Oligonucleotide starters, DNA sequence, plasmide vector, expression vector, recombinant Pichia pastoris strain and method for its obtaining as well as the method for the manufacture of thermostable ß-D-galactosidase Pyrococcus woesei |
| PL209469B1 (en) * | 2005-04-29 | 2011-09-30 | Politechnika Gdańska | Oligonucleotide starters, DNA sequence, plasmide vector, expression vector, recombinant Pichia pastoris strain and method for its obtaining as well as the method for the manufacture of thermostable ß-D-galactosidase Pyrococcus woesei |
| CN101074435A (en) * | 2006-05-16 | 2007-11-21 | 中国农业科学院饲料研究所 | Alpha-galactosidase gene, its coding protein, production and use |
| CN105219791A (en) * | 2015-10-27 | 2016-01-06 | 中国科学院青岛生物能源与过程研究所 | The engineering bacteria of efficient secretory expression aspergillus niger alpha-galactosidase A GA and structure thereof and application |
Non-Patent Citations (1)
| Title |
|---|
| FUTAGAMI,T.等: "alpha-galactosidase C [Aspergillus luchuensis IFO 4308], GenBank: GAA90293.1", 《GENBANK数据库》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113234743A (en) * | 2021-06-07 | 2021-08-10 | 广东溢多利生物科技股份有限公司 | Heat-resistant alpha-galactosidase gene and application thereof |
| CN113234743B (en) * | 2021-06-07 | 2022-12-13 | 广东溢多利生物科技股份有限公司 | Heat-resistant alpha-galactosidase gene and application thereof |
| CN114606151A (en) * | 2022-04-27 | 2022-06-10 | 南京工业大学 | Recombinant pichia pastoris with surface displaying beta-galactosidase and construction method and application thereof |
| CN114606151B (en) * | 2022-04-27 | 2023-05-19 | 南京工业大学 | Recombinant pichia pastoris with beta-galactosidase displayed on surface, construction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108841740B (en) | 2021-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104130988B (en) | 1,3-1,4-Beta-glucanase mutant | |
| CN103261409A (en) | Mannanase, coding gene and production thereof | |
| CN102191291B (en) | Method for producing L-ornithine hydrochloride by genetic engineering bacteria | |
| CN109321552A (en) | A kind of novel Pullulanase and its gene, engineering bacteria and preparation method | |
| JP2022535648A (en) | Use of thermostable β-glucosidase in the production of gentiooligosaccharides | |
| CN104388411A (en) | Agarase as well as gene and application thereof | |
| CN108841740A (en) | A kind of Pichi strain of high yield alpha-galactosidase | |
| CN101619298B (en) | Preparation method of raw powder of each gram of bacillus subtillis with five hundred billion of live germs | |
| CN107227284A (en) | A kind of restructuring streptococcus zooepidemicus for the micromolecule hyaluronic acid that ferments | |
| CN106939315A (en) | A kind of preparation method and application of oxalate decarboxylase | |
| CN110157688A (en) | A kind of linear maltooligosacchaeides generation enzyme mutant for producing maltopentaose ability and improving | |
| CN109371004A (en) | The acid protease Bs2688 mutant K203E and its gene and application that thermal stability improves | |
| CN103695383B (en) | Aspergillus niger strain for efficiently expressing alpha-transglucosidase | |
| CN104099311A (en) | Pichia yeast engineering bacterium for recombination expression of xylanase gene and application thereof | |
| CN109355274A (en) | The beta-glucosidase that a kind of pair of trypsase stomach function regulating protease resistant improves | |
| CN112159828B (en) | Refractory branched glucan and processing method thereof | |
| CN108949731A (en) | A kind of production method improving alkali protease fermentative activity | |
| CN108611339A (en) | Glucoamylase TlGa15 and its gene and application | |
| CN114774396A (en) | Keratinase mutant, compound preparation of keratinase mutant and bile acid and application of compound preparation in additive | |
| CN111378583B (en) | Trichoderma reesei and application thereof | |
| CN101824401B (en) | Glucanase and coding nucleic acid and expression thereof | |
| KR20000058843A (en) | The method for manufacturing of health drink | |
| CN109371003A (en) | The beta-glucosidase that a kind of pair of pepsin resistance improves | |
| CN106085887A (en) | Aspergillus niger strain that a kind of α alpha-glucosidase gene knocks out and application thereof | |
| CN111100853A (en) | Xylanase xyn11A, and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Ding Qinghua Inventor after: Xu Xiaodong Inventor after: Zhao Kai Inventor after: Huang Yijun Inventor before: Xu Xiaodong Inventor before: Zhao Kai Inventor before: Huang Yijun |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210707 Address after: 261500 south of Xianghe Road, east of Yi'an Avenue, Gaomi City, Weifang City, Shandong Province (in Xiazhuang Industrial Park) Patentee after: WEIFANG KDN BIOTECH Co.,Ltd. Patentee after: QINGDAO VLAND BIOTECH GROUP Co.,Ltd. Address before: 266061 Shandong 12A07 Shandong High Speed Building, 29 Miaoling Road, Laoshan District, Qingdao City, Shandong Province Patentee before: QINGDAO VLAND BIOTECH GROUP Co.,Ltd. |
|
| TR01 | Transfer of patent right |