CN114606151B - Recombinant pichia pastoris with beta-galactosidase displayed on surface, construction method and application - Google Patents

Abstract

The invention discloses recombinant pichia pastoris with beta-galactosidase displayed on the surface, which is obtained by heterologously expressing a beta-galactosidase gene lacA from aspergillus oryzae BK03 and a cell wall protein pir1p from saccharomyces cerevisiae in original pichia pastoris. The obtained recombinant strain GS115-pir1p-lacA anchors the beta-galactosidase gene lacA on the surface of cells through an anchor protein, the immobilized enzyme can be used as a whole-cell catalyst, and the recombinant surface display strain can always keep higher enzyme activity, can keep longer enzyme activity, and always stably exist along with the survival of bacteria.

Description

Recombinant pichia pastoris with beta-galactosidase displayed on surface, construction method and application

Technical Field

Relates to the field of genetic engineering of enzymes, in particular to a construction method and application of a recombinant pichia pastoris strain for displaying beta-galactosidase lacA from aspergillus oryzae on the cell surface.

Background

Microbial surface display technology is one of important biotechnology that has been developed with the development of genetic engineering, and yeast surface display system is a foreign protein expression system that develops rapidly following phage display system and bacterial surface display system. The basic principle of the yeast surface display technology is that protein on the surface of a cell (usually mannoprotein on the outer layer of the cell wall) is taken as an anchor protein, and a gene sequence for encoding an exogenous protein or polypeptide is fused with a gene sequence for encoding a specific anchor protein by a genetic engineering means and then is introduced into the yeast, so that the exogenous protein or polypeptide and the anchor protein are displayed on the surface of a yeast cell in the form of fusion protein, the displayed exogenous protein or polypeptide can keep relatively independent spatial structure and biological activity, and can be expressed, purified and fixed into a whole, thereby omitting the complicated procedures of extraction and purification. The yeast surface display system has unique advantages, mainly expressed in the following aspects:

(1) Cell wall proteins, which are typically anchor proteins, can be covalently linked to the inner glucan backbone of the cell wall, allowing the firm display of the exogenous protein on the surface of the yeast cell;

(2) Yeast, as eukaryotes, possess relatively perfect protein folding and secretion mechanisms and are therefore useful for expressing proteins from eukaryotes that require post-translational modification;

(3) Yeast is a single-cell organism with relatively large particles, and cells displaying the target exogenous proteins can be conveniently screened and separated by flow cytometry.

Yeast cell surface display systems have been widely used in many fields of biological research and industrial production. The pichia pastoris cell surface display system is a eukaryotic expression system which is rapidly developed and widely applied in recent years, and the pichia pastoris cell surface display system is used for displaying various enzymes as a whole-cell catalyst, so that the pichia pastoris cell surface display system has the characteristics and advantages of immobilized enzymes, is simple in preparation method, and is easy to recycle and reuse, and therefore has a wide application prospect. There is no report in the prior art on the construction of recombinant pichia strains displaying on the cell surface the beta-galactosidase lacA derived from aspergillus oryzae.

Disclosure of Invention

The invention aims to: aiming at the defects of the prior art, the invention provides the pichia pastoris surface display strain, improves the repeated utilization times of enzyme, integrates expression, purification and immobilization, and omits complicated extraction and purification steps.

The invention also solves the technical problem of providing a construction method of the recombinant pichia pastoris strain with the surface displaying the beta-galactosidase lacA.

The invention further aims to provide an application of the recombinant pichia pastoris strain with the surface displaying the beta-galactosidase lacA.

The invention aims to display and express a beta-galactosidase gene lacA from aspergillus oryzae Aspergillus oryzae BK03 on the surface of pichia pastoris Pichia pastoris GS cells by adopting a pichia pastoris surface display technology to obtain a recombinant strain capable of synthesizing galactooligosaccharides, and further researching the strain. The cell wall anchoring protein genes Pir1p and beta-galactosidase gene lacA are subjected to overlap firstly by a molecular biological method, then cloned into pPIC9k plasmid (wherein FLAG tag is arranged before lacA gene stop codon, a Linker is added between Pir1p and lacA genes, and meanwhile, signal peptides of Pir1p and lacA are removed), and then the linearization plasmid is transferred into the genome of pichia pastoris by electric transformation. And (3) measuring the enzyme activity and the yield change through research of immobilized cell immobilized enzyme of the recombinant strain, and obtaining the surface display strain of the high-yield galactooligosaccharide.

In order to achieve the aim, the invention discloses recombinant pichia pastoris with the surface displaying beta-galactosidase, which is obtained by heterologously expressing a beta-galactosidase gene lacA from aspergillus oryzae BK03 and a cell wall protein gene pir1p from saccharomyces cerevisiae in original pichia pastoris.

Wherein the original pichia pastoris is Pichia pastoris GS115,115.

The nucleotide sequence of the beta-galactosidase gene lacA from aspergillus oryzae BK03 is shown in SEQ ID NO:1 is shown in the specification; the nucleotide sequence of the cell wall protein gene pir1p from saccharomyces cerevisiae is shown as SEQ ID NO:2, the saccharomyces cerevisiae is derived from saccharomyces cerevisiae Saccharomyces cerevisiae S288c.

Wherein, the nucleotide sequence of the overlap (overlap) of the genes Pir1p and lacA is shown in SEQ ID NO: 3.

The nucleotide sequence of the original plasmid pPIC9k is shown in SEQ ID NO: 4.

The nucleotide sequence of the recombinant plasmid pPIC9k-pir1p-lacA is shown as SEQ ID NO: shown at 5.

The invention further provides a construction method of the recombinant pichia pastoris, which comprises the steps of overlapping (overlapping) cell wall protein pir1p from saccharomyces cerevisiae and beta-galactosidase gene lacA from aspergillus oryzae BK03, cloning the overlapped cell wall protein acr 1p into pPIC9k plasmid to obtain linearization plasmid, and introducing the linearization plasmid into genome of pichia pastoris through electrotransformation.

Specifically, the construction method is as follows:

(1) Constructing a beta-galactosidase lacA expression cassette from aspergillus oryzae by molecular biology;

(2) Constructing a surface display expression original of an anchor protein Pir1p by taking a genome of saccharomyces cerevisiae Saccharomyces cerevisiae S288c as a template;

(3) The genes obtained in the steps (1) and (2) are firstly subjected to overlap, and then inserted into pPIC9k plasmid, wherein a FLAG tag is added in front of a stop codon of the lacA gene, and a Linker is added between pir1p and the lacA gene, so that pPIC9k recombinant plasmid carrying pir1p and the lacA gene is obtained;

(4) The recombinant plasmid is electrically transferred to the genome of Pichia pastoris (Pichia pastoris GS 115) to obtain recombinant expression strain.

After completion of the construction, whether β -galactosidase lacA was anchored on the cell surface was detected by immunofluorescence microscopy; and performing an enzymatic activity assay of the surface-displayed beta-galactosidase.

The invention also provides the induced expression of the recombinant pichia pastorisThe method comprises inoculating the recombinant Pichia pastoris into YPD liquid culture medium, culturing overnight to obtain seed solution, inoculating the seed solution into BMGY culture medium, and culturing until OD ₆₀₀ To 2-6, the BMGY medium was centrifuged to remove the supernatant, the resulting bacterial pellet was washed with sterile water, and the pellet was transferred to BMMY medium containing methanol for further culture.

Wherein the YPD liquid culture medium comprises 10g/L yeast powder, 20g/L peptone and 20g/L glucose; the BMGY culture medium comprises 10g/L yeast powder, 20g/L peptone, 2ml/L biotin mother liquor, 100 ml/L10% glycerol, 100ml/L potassium phosphate mother liquor and 100ml/L YNB mother liquor.

Wherein the YNB mother liquor consists of 20.1g YNB and 150ml H ₂ O, the potassium phosphate mother liquor consists of 0.45. 0.45g K ₂ HPO ₄ 、1.77g KH ₂ PO ₄ And 150ml H ₂ O, the mother liquor of biotin consists of 20mg and 100ml H ₂ O composition.

The invention also provides application of the recombinant pichia pastoris in fermentation production of galactooligosaccharides. Specifically, inoculating the recombinant pichia pastoris into a pichia pastoris fermentation medium BMMY for fermentation culture, centrifugally collecting thalli, and then performing cell transformation by taking lactose as a substrate to obtain the galactooligosaccharide.

The beneficial effects are that: compared with the prior art, the invention adopts a yeast surface display technology to display and express the beta-galactosidase gene lacA from aspergillus oryzae Aspergillus oryzae BK03 on the cell surface of pichia pastoris Pichia pastoris GS, so as to obtain a recombinant strain capable of synthesizing galacto-oligosaccharide, the recombinant surface display strain can always keep higher enzyme activity, the enzyme activity can last longer, the enzyme activity always exists stably along with the survival of the strain, the obtained recombinant strain anchors the beta-galactosidase gene lacA on the cell surface through an anchor protein, and the immobilized enzyme can be used as a whole-cell catalyst.

Drawings

FIG. 1 shows PCR amplified fragments of Pir1p and lacA genes;

FIG. 2 shows Pir1p and lacA overlap results;

FIG. 3 shows the cleavage of pPIC9K-Pir1 p-lacA;

FIG. 4 is a PCR validation of colonies of GS115-Pir1p-lacA recombinant strains;

FIG. 5 is an in situ staining experiment diagram of recombinant bacteria, wherein GS115-Pir1p-lacA is on the left and control is on the right;

FIG. 6 is an experimental diagram of immunofluorescence detection of recombinant bacteria, wherein the left is the state of cell luminescence under a fluorescence microscope, and the right is the state of cell under a visible light microscope;

FIG. 7 is a comparison of the enzyme activities of a surface display lacA strain and a heterologous expression lacA strain;

FIG. 8 is a graph showing the results of a standard curve for enzyme activity measurement;

FIG. 9 is a graph showing the production of galactooligosaccharides.

Detailed Description

The present invention will be described in further detail with reference to the following specific examples, which will aid in understanding the present invention, but the scope of the present invention is not limited to the following examples.

Example 1 recombinant bacteria were obtained by heterologously expressing the beta-galactosidase lacA gene derived from the cell wall protein Pir1p of Saccharomyces cerevisiae and from Aspergillus oryzae.

(one) extracting the genome of Saccharomyces cerevisiae strain Saccharomyces cerevisiae S288 c:

using the fungal genome extraction kit (Dr. GenTLE, takara Corp.) ^TM (from Yeast)High Recovery)

(1) Taking a Saccharomyces cerevisiae Saccharomyces cerevisiae S288c overnight culture solution with an OD of 1.2-1.8 into a 2mL microtube, centrifuging at 12000rpm for 1min, and discarding the supernatant to obtain a precipitate;

(2) Adding 500 mu L of GenTLE Yeast Solution A into the sediment obtained in the step (1), vibrating easily, suspending the sediment fully at 37 ℃, and carrying out warm bath for 1h, wherein the centrifugal tube is gently vibrated for a plurality of times;

(2) Adding 100 μl of GenTLE Yeast Solution B, slightly shaking, mixing, and standing in 70deg.C water bath for 10min;

(3) 200 mu L of GenTLE Yeast Solution C is added, slightly vibrated, mixed uniformly and then placed on ice for 5min;

(4) Centrifuging the microtube at 12000rpm for 5min at 4deg.C;

(5) Transferring the supernatant into a new microtube, adding 400 mu L of isopropanol, and fully and reversely mixing;

(6) Centrifuging the microtube at 12000rpm for 5min at 4deg.C, and discarding supernatant;

(7) Adding 500 μl of precooled 70% ethanol into the precipitate, washing the precipitate upside down, and centrifuging at 12000rpm for 5min at 4deg.C;

(8) Removing supernatant, naturally drying DNA at room temperature, and precipitating until no ethanol smell exists;

(9) 50. Mu.L of TE Buffer/ddH was added ₂ O, dissolving genomic DNA.

(II) acquisition of Aspergillus oryzae RNA:

inoculating the strain into a V8 culture medium for activation, culturing for 3 days in a 30 ℃ incubator, transferring the strain into a V8 liquid culture medium, and culturing for 3 days again at 30 ℃ to obtain the thallus for extracting the Aspergillus oryzae RNA. Extraction procedure of Aspergillus oryzae RNA reference RNAiso Plus reagent extraction kit (III) PCR technique was used to amplify the target genes Pir1p and lacA, respectively:

(1) Amplifying Pir1 gene by using Saccharomyces cerevisiae genome extracted in the step (I) as a template and adopting a PCR technology, and amplifying lacA gene by using Aspergillus oryzae RNA extracted in the step (II) as a template and adopting a PCR technology.

The reaction system is shown in the following table:

TABLE 1 PCR reaction System

The primers for amplifying Pir1p gene were as follows:

Pir1p-UP：AAAGAGAGGCTGAAGCTTACGTATATGCTCCAAAGGACCCPir1p-DOWN：CCAGAACCACCACCACCGAATTCACAGTTGAGCAAATCGA

primers for amplifying the lacA gene were as follows:

lacA-UP：

lacA-DOWN：

wherein, the upper primer part comprises a Linker, and the bold italic part is Linker,45bp; the lower primer part comprises a FLAG tag, and before the stop codon, the bold italic part is a FLAG tag of 24bp;

the PCR products (Pir 1p and lacA gene fragments) were electrophoresed using 1.2% (1.2 g/100 mL) agarose gel, and the results are shown in FIG. 1.

(2) Recovery of purified fractions Pir1p and lacA from the gel

The procedure was performed using a takara kit (TaKaRa MiniBEST Agarose Gel DNA Extraction KitVer.4.0).

2.1 preparing agarose gel by using TBE buffer solution, and then carrying out agarose gel electrophoresis on target fragments Pir1 and lacA;

2.2 cutting agarose gel containing target fragments Pir1p and lacA under ultraviolet lamp, and using paper towel to absorb out surface liquid;

2.3 cutting up the gel blocks and weighing the gel blocks. When calculating the volume, the calculation was performed at 1 mg=1 μl;

2.4 adding a dissolving solution Buffer GM into the glue block, wherein the adding amount of the Buffer GM is equal to that of the glue block, uniformly mixing, and dissolving the glue block at the room temperature of 15-25 ℃, and intermittently oscillating and mixing at the moment to fully dissolve the glue block;

2.5 placing the filtration column in the kit on a 2mL collection tube;

2.6 transferring the solution obtained in the step 2.4 to a filter column, centrifuging at 12000rpm for 1min, and discarding the filtrate;

2.7 adding 700. Mu.L Buffer WB into a filter column, centrifuging at 12000rpm for 1min at room temperature, and discarding the filtrate;

2.8 repeating the operation step 2.7;

2.9 the filter column was placed on a 2mL collection tube, centrifuged at 12000rpm for 1min at room temperature, and the filtrate was discarded;

2.10 placing the filter column on a new 1.5mL centrifuge tube, adding 50 mu L of sterilized water at the center of the filter column membrane, and standing for 1min at room temperature;

2.11 washing out Pir1p and lacA fragments by centrifugation at 12000rpm for 1min;

2.12 agarose gel electrophoresis verification is carried out on the purified Pir1p and lacA target fragments, and the concentration is calculated; wherein the nucleotide sequences of Pir1p and lacA genes are respectively shown in SEQ ID NO:2 and SEQ ID NO: 1.

(IV) ligation of Pir1p and lacA Gene overlap.

And (3) amplifying the Pir1p+lacA overlap gene by using the Pir1p and lacA genes extracted in the step (three) as templates and adopting a PCR technology.

The reaction system is shown in the following table:

TABLE 2 PCR reaction System

The primers for amplifying the pir1p+lacA overlap gene were as follows:

Pir1p-UP：

AAAGAGAGGCTGAAGCTTACGTATATGCTCCAAAGGACCC

lacA-DOWN：

TTAATTCGCGGCCGCCCTAGGTTACTTATCATCATCATCCTTGTAATCGT

AAGCACCCTTTCTT。

the step of recovery of Pir1p+lacA overlap refers to step (III) and the result of running is shown in FIG. 2.

(V) extracting plasmid pPIC9K:

plasmid extraction kit using Axygen (AxyPrep ^TM Plasmid Miniprep Kit) operation.

Wherein, in the operation, the Buffer S1-Buffer S3 and the Buffer W1-Buffer W2 are all reagents in the plasmid kit of the Axygen.

(1) E.coli DH5 a single colony (containing pPIC9K, the nucleotide sequence of which is shown in SEQ ID NO: 3) is selected from a plate culture medium, wherein E.coli DH5 a is purchased from Shanghai Biotechnology (Shanghai) stock, and the preservation method of PET-28a is carried out according to the method in the molecular cloning laboratory Manual (Huang Peitang et al, translation, china, science Press, 2002, third edition); then inoculating into 5mL LB liquid medium containing antibiotics (resistance is 100mg/mL of ampicillin), and culturing at 37 ℃ overnight for 12-16h;

(2) Taking 2mL of overnight culture bacterial liquid, centrifuging at 12000rpm for 1min, and discarding the supernatant;

(3) The bacterial pellet was well suspended with 250. Mu.L of Buffer S1 (RNase A containing) pre-chilled at 4 ℃;

(4) Adding 250 mu L of Buffer S2, slightly turning up and down, mixing for 4-6 times, and fully cracking thalli to form transparent solution;

(5) Adding 350 mu L Buffer S3, and slightly turning over and mixing for 6-8 times until a compact agglomeration block is formed;

(6) Centrifuging at 12000rpm for 10min at room temperature, and collecting supernatant;

(7) Placing a filtration column in the kit on a 2mL collection tube;

(8) Transferring the supernatant obtained in the step (6) into a filter column, centrifuging at 12000rpm for 1min, and discarding the filtrate;

(9) Adding 500 μl of Buffer W1 into a filter column, centrifuging at 12000rpm for 1min, and discarding the filtrate;

(10) 700. Mu.L of Buffer W2 was added to the filter column, centrifuged at 12000rpm for 1min, and the filtrate was discarded;

(11) Repeating the operating step (10);

(12) The filtration column is arranged on a 2mL collecting pipe again, and the filtration column is centrifuged at 12000rpm for 1min to remove residual washing liquid;

(13) Placing the filter column on a new 1.5mL centrifuge tube, adding 30-50 μl of 65 ℃ sterilized water at the center of the filter column membrane, and standing at room temperature for 1min;

(14) Eluting DNA by centrifugation at 12000rpm for 1min;

(15) Agarose gel electrophoresis verification is carried out on the extracted plasmid pPIC9K, and the concentration is calculated.

Sixth, plasmid pPIC9K was digested with restriction enzymes SnaBI and avrII.

TABLE 3 cleavage reaction System

And (3) performing enzyme digestion at 37 ℃ for 30min, performing gel running verification (shown in figure 3), and performing gel recovery after confirming the fragment is correct, wherein the step is as follows.

And (seventh) connecting the target gene Pir1p+lacA overlap and the digested plasmid pPIC9K to obtain a recombinant plasmid pPIC9K+Pir1p+lacA.

TABLE 4 one-step cloning System

After water bath at 37 ℃ for 30min, ice bath is immediately carried out for 5min, and the ice bath is preserved at-20 ℃ for standby.

Eighth, the recombinant plasmid pPIC9K+Pir1p+lacA is transformed into E.coli DH 5. Alpha

(1) Taking a 100 mu LE. Coll DH 5. Alpha. Competent cell (Shanghai Biotechnology (Shanghai) Co., ltd. No. B528413) suspension from a-80 ℃ refrigerator, thawing at room temperature, and immediately placing on ice after thawing;

(2) Adding 10 mu L of the recombinant plasmid pPICD1K+Pir1p+lacA solution obtained in the step seven into E.coli DH5 alpha competent cell suspension, shaking gently, and standing on ice for 30min;

(3) Heat shock in a water bath at 42 ℃ for 90s, and immediately cooling on ice for 5min;

(4) Adding 1mL of LB liquid medium, mixing uniformly, and carrying out shaking culture at 37 ℃ for 1h to recover the thallus to a normal growth state;

(5) Shaking the bacterial liquid uniformly, taking 100 mu L of the bacterial liquid, coating the bacterial liquid on an LB resistance plate, inverting a culture dish, and culturing for 12 hours in a constant temperature incubator at 37 ℃;

wherein the formulation of the LB-resistant plate is as follows: 10g/L of sodium chloride, 10g/L of peptone, 5g/L of yeast powder and 20g/L of agar powder, sterilizing at 121 ℃ for 20min, cooling, and adding 200 mu L of ampicillin (LB culture medium of 200 ml);

(6) Picking single colony from the resistance plate, after preserving bacteria, extracting plasmid pPICD9K+Pir1p+lacA according to a fifth step, and carrying out agarose gel electrophoresis verification and sequencing verification on the extracted plasmid pPICD9K+Pir1p+lacA, wherein the nucleotide sequences of the plasmid pPICD9K+Pir1p+lacA are respectively shown as SEQ ID NO: shown at 5.

Electrically transforming recombinant plasmid pPICD9K+Pir1p+lacA into original Pichia pastoris

(1) Mixing 2-5 μg of pPIC9K+Pir1p+lacA recombinant plasmid with pichia pastoris competence, and pre-cooling on ice for 30min;

(2) Transferring the mixed solution into a 2mm electric rotating cup, and carrying out ice bath for 5min;

(3) Wiping off moisture outside the electric rotating cup, putting the electric rotating cup into an electric rotating instrument, and carrying out electric rotating (voltage 1500V, capacitance 25 mu F and resistance 200 omega);

(4) Adding 1mL of YPD culture medium into the electric rotating cup, uniformly mixing, transferring into a 1.5mL centrifuge tube, and resuscitating for 1h at 30 ℃ and 250 rpm;

(5) Centrifuging at 6000rpm for 5min, discarding 900 supernatant, coating 200 bacterial liquid on MD plate, and culturing at 30deg.C until colony is grown;

wherein, the formula of the MD plate is as follows: 13.4g/LYNB, 20g/L glucose, 20g/L agar powder, etc., and cooling to 60deg.C, adding 0.04% biotin, filtering, and sterilizing.

(6) Colony PCR was used to verify whether it was a GS115-Pir1p-lacA recombinant Saccharomyces cerevisiae strain. The junction of the plasmid and the gene is used as an upper primer, a lower primer is arranged at a position of 1000bp of the gene fragment, the result of the bacterium p is about 1000bp, and the result is correct, as shown in figure 4.

Example 2: recombinant bacteria in situ staining experiments.

Single colonies with correct PCR assay were tested for lacA using beta-galactosidase in situ staining kit

Gene expression and copy status, if there is a color reaction, demonstrate lacA gene expression, if the color is the more within the same time

The deep step initially proves that the copy number is more, and the specific operation is as follows:

(1) Picking the transformant in 5mLYPD liquid medium, culturing overnight at 30 ℃ and 250 rpm;

(2) 2mL of YPD medium is added into 25mL/250mL of BMGY medium, and the mixture is cultured for 20 to 24 hours at the temperature of 30 ℃ and at the speed of 250 rpm;

(3) 2mL of BMGY medium was centrifuged at 6000rpm for 5min, the supernatant was removed, the cells were washed with sterile water, and the pellet was transferred to 50mL/250mL BMMY for 72h at 30℃at 250rpm, wherein 1% methanol was added every 24h for induction culture.

(4) Centrifuging 1mL of thalli at 6000rpm for 5min by using a centrifuge tube, and removing the supernatant;

(5) PBS was used to wash the cells 3 times to prepare a staining solution (1 mL system)

TABLE 5 dyeing working fluid systems

(6) Adding 500 mu L of staining working solution into each of the separation tubes, suspending thalli by a pipetting gun, incubating at 37 ℃,

recording the time for changing the color of each off-tube to blue at any time until the color of blue is no longer changed, observing the color depth, and irradiating

The cell morphology was observed under a microscope as shown in fig. 5.

Conclusion: as shown, to the left is the recombinant surface display strain of Pichia pastoris and the original control, the recombinant surface display strain GS115-Pir1p-lacA started to appear blue just as soon as the staining solution was added, and blue had been very dark and no longer changed for about 10 minutes. As can be seen by an optical microscope, almost all the surfaces of the strains turned blue, indicating a high expression level of the beta-galactosidase gene lacA.

Example 3: cell surface display recombinant Pichia pastoris GS115-Pir1p-lacA strain immunofluorescence detection experiment.

In order to detect whether the lacA gene is displayed on the surface of Pichia pastoris, an immunofluorescence labeling method is adopted, whether the gene is displayed on the surface of the yeast is judged according to the cell morphology under a fluorescence microscope, and meanwhile, a blank control is made by using an original strain Pichia pastoris GS115, and the specific method is as follows:

(1) Culturing cells in BMMY culture medium for 120h respectively, taking 1mL of cultured thalli, centrifuging at 7000rpm for 5min, and collecting thalli;

(2) The supernatant was discarded, the suspension cells were washed 3 times with PBS (pH 7.4), and centrifuged at 7000rpm for 5min;

(3) The cells were suspended in 1mL of PBS (pH 7.4) containing 2% BSA, and blocked for 5min;

(4) 200 mu L of the thallus suspension is taken in a 1.5mL centrifuge tube, and the primary antibody (Flag Tag Mouse Monoclonal Antibody) of the immune reaction is diluted according to the ratio of 1:100;

(5) Wrapping the centrifugal tube containing the mixed solution with tinfoil paper, and placing the centrifugal tube in a shaking table at 37 ℃ and 60rpm to shake for 3 hours so as to enable the thalli to be in a suspension state;

(6) Taking out the mixed solution, and centrifuging at 7000rpm for 5min;

(7) Wash 3 times (gentle) with 1mL PBS (pH 7.4), centrifuge at 7000rpm for 5min;

(8) The cells were washed (gentle) with PBS containing 2% BSA (pH 7.4) and centrifuged at 7000rpm for 5min;

(9) The cells were suspended with 200. Mu.L of PBS (pH 7.4) containing 2% BSA, and 1. Mu.L of secondary antibody (FITC-labeled goat anti-mouse IgG) was added to each tube, and diluted at a volume ratio of 1:500;

(10) The cells were washed 3 times with 1mL of PBS (pH 7.4), centrifuged at 7000rpm for 5min, and finally suspended with 200. Mu.L of PBS (pH 7.4).

The difference between the recombinant Pichia pastoris GS115-Pir1p-lacA cells and the original cells after immunofluorescence labeling treatment is detected and observed by a fluorescence microscope, and the result is shown in FIG. 6.

Conclusion: as shown in the figure, the upper graph uses GS115-pPIC9K as an original control, no light is emitted under a fluorescence microscope, while the Pichia pastoris recombinant strain GS115-Pir1p-lacA in the lower graph emits green fluorescence under the fluorescence microscope, and the cell morphology under the fluorescence microscope is that the whole cell surface emits light, which indicates that the lacA gene is successfully displayed on the Pichia pastoris surface.

Example 4: inducible expression and enzyme activity assay experiments of recombinant Pichia pastoris GS115-Pir1 p-lacA.

1. Inducible expression experiments

(1) Streaking and separating bacterial colony on MD plate to identify correct recombinant Pichia pastoris strain by PCR, culturing at 30 deg.C for 2-3 days;

(2) Respectively picking 3 single colonies, inoculating into a 50mL centrifuge tube filled with 5m L YPD liquid culture medium, and culturing at 30 ℃ at 250rpm overnight to prepare seed liquid;

(3) 2mL of the seed solution was inoculated into a 250mL Erlenmeyer flask containing 25mL of MGY medium at a super clean bench, and cultured at 30℃and 250rpm until OD600 reached 2-6.

(4) Taking 2mL of BMGY culture medium, centrifuging at 6000rpm for 5min, removing supernatant, washing thalli with sterile water, transferring the precipitate to 50mL/250mL BMMY, and culturing at 30 ℃ at 250rpm for 120h, wherein 1mL of induction liquid is taken every 24h to measure enzyme activity, and simultaneously adding 1% methanol to continue induction culture.

2. Enzyme activity assay

o-nitrophenyl-beta-D-galactoside (o-NPG) is colorless and easy to dissolve in water, o-NPG is hydrolyzed to generate o-nitrophenol (ONP) under the catalysis of beta-galactosidase, and the ONP has a maximum absorption peak under the wavelength of 420 nm.

200, 400, 600, 800, 1000, 1200, 1400 and 1600 mu L of ONP solution with the concentration of 0.1M/L are respectively taken and added into a test tube, the volume is fixed to 10mL, and H is used ₂ O is blank, colorimetric at 420nm, plotted against the ONP concentration on the abscissa, and the corresponding OD420 on the ordinate, as shown in fig. 8.

In the first step, 1mL of the inducing solution was taken every 24 hours, washed twice with PBS, and the supernatant was discarded. To the pellet, 50. Mu.L of PBS was added to suspend the pellet, 50. Mu.L of the sample was added to a 96-well plate, and 50. Mu.L of the beta-galactosidase detection reagent was added to each well plate, and after mixing, the mixture was capped, allowed to stand in an incubator at 37℃for ten minutes until pale yellow color appeared in the sample, and 150. Mu.L of the reaction termination solution was added to terminate the reaction. The absorbance was then measured at OD420 nm using a microplate reader and the results are shown in FIG. 7.

Wherein 1 enzyme activity unit is defined as the amount of cells required to produce 1. Mu. Mol of ONP per minute using oNPG as a substrate. As shown in the results, with the recombinant strain GS115-lacA isolated as a control, the recombinant strain GS115-lacA reached the highest enzyme activity at 96 hours, the highest enzyme activity was 4429.67U/g, and the isolated strain reached the highest enzyme activity at 96 hours, the enzyme activity was 29.3U/mL at the highest, a small amount of enzyme activity was also found in the supernatant of the surface display strain, and the enzyme activity was gradually increased over time, we hypothesized that not all the enzymes might be displayed on the cell surface, and that many extracellular hydrolases might be secreted into the medium because Pichia pastoris is a common host for protein secretion expression.

Example 5: fermentation experiments of recombinant Pichia pastoris GS115-Pir1 p-lacA.

(1) Single colony is selected and inoculated into a 50mL centrifuge tube filled with 5m LYPD liquid culture medium, and the seed liquid is prepared by culturing at 30 ℃ and 250rpm overnight;

(2) 2mL of the seed solution was inoculated into a 250mL Erlenmeyer flask containing 25mL of MGY medium at a super clean bench, and cultured at 30℃and 250rpm until OD600 reached 2-6.

(3) 8mL of BMGY medium was centrifuged at 6000rpm for 5min, the supernatant was removed, the cells were washed with sterile water, and the pellet was transferred to 200mL/500mL BMMY for 120h at 30℃at 250rpm, wherein the induction culture was continued by adding 1% methanol every 24 h.

(4) After fermentation, cells were collected by centrifugation, and washed three times with PBS buffer (pH 5.5), and about 15000mg of yeast dry weight cells were directly used for cell transformation.

(5) 500g/L lactose was prepared as substrate, shake-flask cultured at 200rpm in a transformation system at pH=5.5 at 60℃and sampled at 500. Mu.L for various periods of time, centrifuged for dilution and HPLC analysis of the component contents.

The results are shown in FIG. 9: the surface display strain has the highest yield at 6h, the highest yield is 239g/L, the highest conversion rate is 47.8%, the free enzyme has the highest yield at 12h, the highest yield is 175g/L, the highest conversion rate is 35%, the yield of the surface display strain is improved by 64g/L, the enzyme activity of the surface display strain is relatively stable within 7-24h, the production time of the highest yield is shortened by the surface display strain, and the surface display method has higher yield.

The invention provides recombinant pichia pastoris with beta-galactosidase displayed on the surface and a construction thought and method thereof, and the method and the way for realizing the technical scheme are numerous, the above description is only a preferred embodiment of the invention, and it should be pointed out that a plurality of improvements and modifications can be made by those skilled in the art without departing from the principle of the invention, and the improvements and modifications are also regarded as the protection scope of the invention. The components not explicitly described in this embodiment can be implemented by using the prior art.

Sequence listing

<110> university of Nanjing Industrial science

<120> recombinant Pichia pastoris with beta-galactosidase displayed on surface, construction method and application

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3042

<212> DNA

<213> nucleotide sequence of lacA (Artificial Sequence)

<400> 1

gaattcggtg gtggtggttc tggtggtggt ggatctggtg gtggaggttc ttctattaag 60

catagattga atggttttac catcttggaa catcctgatc cagctaagag agatttgttg 120

caggatattg ttacttggga tgataagtct ttgtttatta acggtgaaag aatcatgttg 180

ttctctggtg aggttcaccc atttagattg cctgttccat ctttgtggtt ggatattttt 240

cataagatca gagctttggg ttttaactgt gtttcttttt atatcgactg ggctttgttg 300

gaaggtaagc caggtgatta cagagctgaa ggtatttttg ctttggaacc attttttgat 360

gctgctaagg aagctggtat ttacttgatt gctagaccag gttcttacat taatgctgag 420

gtttccggtg gtggttttcc aggttggttg caaagagtta acggaacttt gagatcttct 480

gatgaaccat ttttgaaggc tactgacaat tacattgcta acgctgctgc tgctgttgct 540

aaggctcaga ttactaacgg tggtccagtt attttgtacc aaccagaaaa cgaatactct 600

ggaggttgtt gtggagttaa atatccagat gctgattaca tgcaatacgt tatggatcaa 660

gctagaaagg ctgatattgt tgttccattt atttctaacg acgcttctcc ttctggtcat 720

aacgctcctg gttctggaac ttctgctgtt gatatttacg gtcatgattc ttacccattg 780

ggttttgatt gtgctaatcc atctgtttgg cctgaaggta agttgccaga taattttaga 840

actttgcatt tggagcaatc cccatctact ccatactctt tgttggaatt tcaagctggt 900

gcttttgatc catggggtgg tcctggtttt gaaaagtgtt acgctttggt taaccatgaa 960

ttttctagag ttttctacag aaacgatttg tcttttggtg tttctacttt taacttgtac 1020

atgactttcg gtggtactaa ttggggtaac ttgggtcacc ctggtggtta cacttcttat 1080

gattacggtt ctcctattac tgagactaga aacgttacta gagaaaagta ctctgatatt 1140

aagttgttgg ctaactttgt taaggcttct ccttcctact tgactgctac tccaagaaac 1200

ttgactactg gtgtttacac tgatacttct gatttggctg ttactccatt gattggtgat 1260

tctcctggtt ctttttttgt tgttagacac actgattact cttctcaaga atctacatct 1320

tacaaattga agttgccaac ttctgctggt aatttgacta ttcctcagtt ggagggtact 1380

ttgtctttga acggtagaga ttccaaaatc catgttgttg attacaacgt ttccggtact 1440

aatattattt actctactgc tgaagttttc acttggaaga agtttgatgg taataaagtt 1500

ttggttttgt acggtggtcc taaggagcat catgaattgg ctatcgcttc taagtctaac 1560

gttaccatta ttgaaggttc tgattctgga attgtttcta ctagaaaggg ttcttctgtt 1620

attattggtt gggatgtttc atctactaga agaattgttc aagttggtga tttgagagtt 1680

tttttgttgg atagaaactc tgcttataac tactgggttc cagaattgcc aaccgagggt 1740

acctctcctg gtttttctac ctctaaaacc accgcttctt ctattattgt taaggctggt 1800

tacttgttga gaggagctca tttggatggt gctgatttgc atttgactgc tgattttaac 1860

gctactactc ctattgaagt tattggagct ccaactggtg ctaagaattt gtttgttaat 1920

ggtgagaagg cttctcatac tgttgataag aacggtattt ggtcctctga ggttaagtat 1980

gctgctcctg agattaagtt gccaggtttg aaggatttgg attggaagta cttggatact 2040

ttgccagaaa ttaaatcctc ttacgatgat tctgcttggg tttctgctga tttgccaaag 2100

actaagaata ctcatagacc attggatacc ccaacttctt tgtactcttc tgattacggt 2160

tttcataccg gatacttgat ttacagaggt cattttgttg ctaacggtaa ggaatccgaa 2220

ttttttatta gaactcaggg tggttctgct tttggttctt ccgtttggtt gaacgagact 2280

tacttgggtt cttggaccgg tgctgattat gctatggatg gtaattcaac ttacaagttg 2340

tctcagttgg aatctggtaa gaactatgtt attactgttg ttatcgacaa cttgggattg 2400

gatgaaaact ggacagttgg tgaagagact atgaagaatc caagaggtat tttgtcttac 2460

aagttgtccg gtcaagatgc ttctgctatt acttggaagt tgacaggaaa cttgggtgga 2520

gaggattacc aagataaggt tagaggacca ttgaacgaag gtggtttgta tgctgaaaga 2580

cagggttttc atcaaccaca accaccatct gaatcatggg aatctggatc tccattggaa 2640

ggtttgtcca agccaggtat tggattttac accgctcaat ttgatttgga tttgccaaaa 2700

ggttgggacg ttccattgta ctttaacttt ggtaataaca ctcaggctgc tagagctcaa 2760

ttgtacgtta acggttacca atacggtaaa tttactggta acgttggtcc tcagacatct 2820

tttccagttc cagaaggtat tttgaattat agaggaacta actacgttgc tttgtctttg 2880

tgggctttgg agtctgatgg tgctaagttg ggatcttttg agttgtctta cactactcct 2940

gttttgactg gttatggtaa cgttgagtcc cctgaacaac caaagtatga gcaaagaaag 3000

ggtgcttacg attacaagga tgatgatgat aagtaaccta gg 3042

<210> 2

<211> 978

<212> DNA

<213> nucleotide sequence of Pir1p (Artificial Sequence)

<400> 2

tacgtatatg ctccaaagga cccgtggtcc attttaactc catcagctac ttacaagggt 60

ggtataactg attactcttc tactttcggt attgctgttg aaccaattgc cactactgct 120

tcctccaagg ctaagagagc cgctgctatc tctcaaattg gtgacggtca aatccaagcc 180

actaccaaaa ccactgctgc tgctgtttct caaattggtg acggtcaaat ccaagccact 240

actaaaacca aagctgctgc tgtctctcaa attggtgacg gccaaatcca agccaccacc 300

aagactacct cagctaagac taccgctgca gccgtctccc aaattggtga cggtcaaatt 360

caagccacta ctaaaaccaa agctgctgct gtctctcaaa ttggtgacgg tcaaatccaa 420

gccactacca aaacaactgc tgcagctgtc tctcaaattg gtgacggtca aatccaagcc 480

actactaaaa ccactgctgc agctgtttct caaattggtg acggtcaaat ccaagccacc 540

accaatacta ctgttgctcc agtctcccaa atcactgatg gccaaatcca agccacaact 600

ttaacttctg caaccattat accatctcca gctccagctc caattactaa tggcactgac 660

ccagtaactg ctgaaacatg taaaagcagt ggcactttag aaatgaactt aaagggtggt 720

atcctgactg acggtaaagg tagaattggt tctatcgttg ccaacagaca attccaattc 780

gatggtcctc caccacaagc tggtgctatc tatgctgctg gttggtccat caccccagaa 840

ggtaacttgg ccatcggtga ccaggatact ttttaccaat gtttgtcagg aaacttctac 900

aacttatacg atgagcacat tggaactcaa tgtaatgcag tccacctaca agctatcgat 960

ttgctcaact gtgaattc 978

<210> 3

<211> 4014

<212> DNA

<213> nucleotide sequence of Pir1p-lacA overlap (Artificial Sequence)

<400> 3

tacgtatatg ctccaaagga cccgtggtcc attttaactc catcagctac ttacaagggt 60

ggtataactg attactcttc tactttcggt attgctgttg aaccaattgc cactactgct 120

tcctccaagg ctaagagagc cgctgctatc tctcaaattg gtgacggtca aatccaagcc 180

actaccaaaa ccactgctgc tgctgtttct caaattggtg acggtcaaat ccaagccact 240

actaaaacca aagctgctgc tgtctctcaa attggtgacg gccaaatcca agccaccacc 300

aagactacct cagctaagac taccgctgca gccgtctccc aaattggtga cggtcaaatt 360

caagccacta ctaaaaccaa agctgctgct gtctctcaaa ttggtgacgg tcaaatccaa 420

gccactacca aaacaactgc tgcagctgtc tctcaaattg gtgacggtca aatccaagcc 480

actactaaaa ccactgctgc agctgtttct caaattggtg acggtcaaat ccaagccacc 540

accaatacta ctgttgctcc agtctcccaa atcactgatg gccaaatcca agccacaact 600

ttaacttctg caaccattat accatctcca gctccagctc caattactaa tggcactgac 660

ccagtaactg ctgaaacatg taaaagcagt ggcactttag aaatgaactt aaagggtggt 720

atcctgactg acggtaaagg tagaattggt tctatcgttg ccaacagaca attccaattc 780

gatggtcctc caccacaagc tggtgctatc tatgctgctg gttggtccat caccccagaa 840

ggtaacttgg ccatcggtga ccaggatact ttttaccaat gtttgtcagg aaacttctac 900

aacttatacg atgagcacat tggaactcaa tgtaatgcag tccacctaca agctatcgat 960

ttgctcaact gtgaattcgg tggtggtggt tctggtggtg gtggatctgg tggtggaggt 1020

tcttctatta agcatagatt gaatggtttt accatcttgg aacatcctga tccagctaag 1080

agagatttgt tgcaggatat tgttacttgg gatgataagt ctttgtttat taacggtgaa 1140

agaatcatgt tgttctctgg tgaggttcac ccatttagat tgcctgttcc atctttgtgg 1200

ttggatattt ttcataagat cagagctttg ggttttaact gtgtttcttt ttatatcgac 1260

tgggctttgt tggaaggtaa gccaggtgat tacagagctg aaggtatttt tgctttggaa 1320

ccattttttg atgctgctaa ggaagctggt atttacttga ttgctagacc aggttcttac 1380

attaatgctg aggtttccgg tggtggtttt ccaggttggt tgcaaagagt taacggaact 1440

ttgagatctt ctgatgaacc atttttgaag gctactgaca attacattgc taacgctgct 1500

gctgctgttg ctaaggctca gattactaac ggtggtccag ttattttgta ccaaccagaa 1560

aacgaatact ctggaggttg ttgtggagtt aaatatccag atgctgatta catgcaatac 1620

gttatggatc aagctagaaa ggctgatatt gttgttccat ttatttctaa cgacgcttct 1680

ccttctggtc ataacgctcc tggttctgga acttctgctg ttgatattta cggtcatgat 1740

tcttacccat tgggttttga ttgtgctaat ccatctgttt ggcctgaagg taagttgcca 1800

gataatttta gaactttgca tttggagcaa tccccatcta ctccatactc tttgttggaa 1860

tttcaagctg gtgcttttga tccatggggt ggtcctggtt ttgaaaagtg ttacgctttg 1920

gttaaccatg aattttctag agttttctac agaaacgatt tgtcttttgg tgtttctact 1980

tttaacttgt acatgacttt cggtggtact aattggggta acttgggtca ccctggtggt 2040

tacacttctt atgattacgg ttctcctatt actgagacta gaaacgttac tagagaaaag 2100

tactctgata ttaagttgtt ggctaacttt gttaaggctt ctccttccta cttgactgct 2160

actccaagaa acttgactac tggtgtttac actgatactt ctgatttggc tgttactcca 2220

ttgattggtg attctcctgg ttcttttttt gttgttagac acactgatta ctcttctcaa 2280

gaatctacat cttacaaatt gaagttgcca acttctgctg gtaatttgac tattcctcag 2340

ttggagggta ctttgtcttt gaacggtaga gattccaaaa tccatgttgt tgattacaac 2400

gtttccggta ctaatattat ttactctact gctgaagttt tcacttggaa gaagtttgat 2460

ggtaataaag ttttggtttt gtacggtggt cctaaggagc atcatgaatt ggctatcgct 2520

tctaagtcta acgttaccat tattgaaggt tctgattctg gaattgtttc tactagaaag 2580

ggttcttctg ttattattgg ttgggatgtt tcatctacta gaagaattgt tcaagttggt 2640

gatttgagag tttttttgtt ggatagaaac tctgcttata actactgggt tccagaattg 2700

ccaaccgagg gtacctctcc tggtttttct acctctaaaa ccaccgcttc ttctattatt 2760

gttaaggctg gttacttgtt gagaggagct catttggatg gtgctgattt gcatttgact 2820

gctgatttta acgctactac tcctattgaa gttattggag ctccaactgg tgctaagaat 2880

ttgtttgtta atggtgagaa ggcttctcat actgttgata agaacggtat ttggtcctct 2940

gaggttaagt atgctgctcc tgagattaag ttgccaggtt tgaaggattt ggattggaag 3000

tacttggata ctttgccaga aattaaatcc tcttacgatg attctgcttg ggtttctgct 3060

gatttgccaa agactaagaa tactcataga ccattggata ccccaacttc tttgtactct 3120

tctgattacg gttttcatac cggatacttg atttacagag gtcattttgt tgctaacggt 3180

aaggaatccg aattttttat tagaactcag ggtggttctg cttttggttc ttccgtttgg 3240

ttgaacgaga cttacttggg ttcttggacc ggtgctgatt atgctatgga tggtaattca 3300

acttacaagt tgtctcagtt ggaatctggt aagaactatg ttattactgt tgttatcgac 3360

aacttgggat tggatgaaaa ctggacagtt ggtgaagaga ctatgaagaa tccaagaggt 3420

attttgtctt acaagttgtc cggtcaagat gcttctgcta ttacttggaa gttgacagga 3480

aacttgggtg gagaggatta ccaagataag gttagaggac cattgaacga aggtggtttg 3540

tatgctgaaa gacagggttt tcatcaacca caaccaccat ctgaatcatg ggaatctgga 3600

tctccattgg aaggtttgtc caagccaggt attggatttt acaccgctca atttgatttg 3660

gatttgccaa aaggttggga cgttccattg tactttaact ttggtaataa cactcaggct 3720

gctagagctc aattgtacgt taacggttac caatacggta aatttactgg taacgttggt 3780

cctcagacat cttttccagt tccagaaggt attttgaatt atagaggaac taactacgtt 3840

gctttgtctt tgtgggcttt ggagtctgat ggtgctaagt tgggatcttt tgagttgtct 3900

tacactactc ctgttttgac tggttatggt aacgttgagt cccctgaaca accaaagtat 3960

gagcaaagaa agggtgctta cgattacaag gatgatgatg ataagtaacc tagg 4014

<210> 4

<211> 9276

<212> DNA

<213> nucleotide sequence of pPIC9K (Artificial Sequence)

<400> 4

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct 960

tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact 1020

acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta 1080

gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg 1140

tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tctcgagaaa 1200

agagaggctg aagcttacgt agaattccct agggcggccg cgaattaatt cgccttagac 1260

atgactgttc ctcagttcaa gttgggcact tacgagaaga ccggtcttgc tagattctaa 1320

tcaagaggat gtcagaatgc catttgcctg agagatgcag gcttcatttt tgatactttt 1380

ttatttgtaa cctatatagt ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc 1440

ttgctcctga tcagcctatc tcgcagctga tgaatatctt gtggtagggg tttgggaaaa 1500

tcattcgagt ttgatgtttt tcttggtatt tcccactcct cttcagagta cagaagatta 1560

agtgagaagt tcgtttgtgc aagcttatcg ataagcttta atgcggtagt ttatcacagt 1620

taaattgcta acgcagtcag gcaccgtgta tgaaatctaa caatgcgctc atcgtcatcc 1680

tcggcaccgt caccctggat gctgtaggca taggcttggt tatgccggta ctgccgggcc 1740

tcttgcggga tatcgtccat tccgacagca tcgccagtca ctatggcgtg ctgctagcgc 1800

tatatgcgtt gatgcaattt ctatgcgcac ccgttctcgg agcactgtcc gaccgctttg 1860

gccgccgccc agtcctgctc gcttcgctac ttggagccac tatcgactac gcgatcatgg 1920

cgaccacacc cgtcctgtgg atctatcgaa tctaaatgta agttaaaatc tctaaataat 1980

taaataagtc ccagtttctc catacgaacc ttaacagcat tgcggtgagc atctagacct 2040

tcaacagcag ccagatccat cactgcttgg ccaatatgtt tcagtccctc aggagttacg 2100

tcttgtgaag tgatgaactt ctggaaggtt gcagtgttaa ctccgctgta ttgacgggca 2160

tatccgtacg ttggcaaagt gtggttggta ccggaggagt aatctccaca actctctgga 2220

gagtaggcac caacaaacac agatccagcg tgttgtactt gatcaacata agaagaagca 2280

ttctcgattt gcaggatcaa gtgttcagga gcgtactgat tggacatttc caaagcctgc 2340

tcgtaggttg caaccgatag ggttgtagag tgtgcaatac acttgcgtac aatttcaacc 2400

cttggcaact gcacagcttg gttgtgaaca gcatcttcaa ttctggcaag ctccttgtct 2460

gtcatatcga cagccaacag aatcacctgg gaatcaatac catgttcagc ttgagacaga 2520

aggtctgagg caacgaaatc tggatcagcg tatttatcag caataactag aacttcagaa 2580

ggcccagcag gcatgtcaat actacacagg gctgatgtgt cattttgaac catcatcttg 2640

gcagcagtaa cgaactggtt tcctggacca aatattttgt cacacttagg aacagtttct 2700

gttccgtaag ccatagcagc tactgcctgg gcgcctcctg ctagcacgat acacttagca 2760

ccaaccttgt gggcaacgta gatgacttct ggggtaaggg taccatcctt cttaggtgga 2820

gatgcaaaaa caatttcttt gcaaccagca actttggcag gaacacccag catcagggaa 2880

gtggaaggca gaattgcggt tccaccagga atatagaggc caactttctc aataggtctt 2940

gcaaaacgag agcagactac accagggcaa gtctcaactt gcaacgtctc cgttagttga 3000

gcttcatgga atttcctgac gttatctata gagagatcaa tggctctctt aacgttatct 3060

ggcaattgca taagttcctc tgggaaagga gcttctaaca caggtgtctt caaagcgact 3120

ccatcaaact tggcagttag ttctaaaagg gctttgtcac cattttgacg aacattgtcg 3180

acaattggtt tgactaattc cataatctgt tccgttttct ggataggacg acgaagggca 3240

tcttcaattt cttgtgagga ggccttagaa acgtcaattt tgcacaattc aatacgacct 3300

tcagaaggga cttctttagg tttggattct tctttaggtt gttccttggt gtatcctggc 3360

ttggcatctc ctttccttct agtgaccttt agggacttca tatccaggtt tctctccacc 3420

tcgtccaacg tcacaccgta cttggcacat ctaactaatg caaaataaaa taagtcagca 3480

cattcccagg ctatatcttc cttggattta gcttctgcaa gttcatcagc ttcctcccta 3540

attttagcgt tcaacaaaac ttcgtcgtca aataaccgtt tggtataaga accttctgga 3600

gcattgctct tacgatccca caaggtggct tccatggctc taagaccctt tgattggcca 3660

aaacaggaag tgcgttccaa gtgacagaaa ccaacacctg tttgttcaac cacaaatttc 3720

aagcagtctc catcacaatc caattcgata cccagcaact tttgagttgc tccagatgta 3780

gcacctttat accacaaacc gtgacgacga gattggtaga ctccagtttg tgtccttata 3840

gcctccggaa tagacttttt ggacgagtac accaggccca acgagtaatt agaagagtca 3900

gccaccaaag tagtgaatag accatcgggg cggtcagtag tcaaagacgc caacaaaatt 3960

tcactgacag ggaacttttt gacatcttca gaaagttcgt attcagtagt caattgccga 4020

gcatcaataa tggggattat accagaagca acagtggaag tcacatctac caactttgcg 4080

gtctcagaaa aagcataaac agttctacta ccgccattag tgaaactttt caaatcgccc 4140

agtggagaag aaaaaggcac agcgatacta gcattagcgg gcaaggatgc aactttatca 4200

accagggtcc tatagataac cctagcgcct gggatcatcc tttggacaac tctttctgcc 4260

aaatctaggt ccaaaatcac ttcattgata ccattattgt acaacttgag caagttgtcg 4320

atcagctcct caaattggtc ctctgtaacg gatgactcaa cttgcacatt aacttgaagc 4380

tcagtcgatt gagtgaactt gatcaggttg tgcagctggt cagcagcata gggaaacacg 4440

gcttttccta ccaaactcaa ggaattatca aactctgcaa cacttgcgta tgcaggtagc 4500

aagggaaatg tcatacttga agtcggacag tgagtgtagt cttgagaaat tctgaagccg 4560

tatttttatt atcagtgagt cagtcatcag gagatcctct acgccggacg catcgtggcc 4620

gacctgcagg gggggggggg gcgctgaggt ctgcctcgtg aagaaggtgt tgctgactca 4680

taccaggcct gaatcgcccc atcatccagc cagaaagtga gggagccacg gttgatgaga 4740

gctttgttgt aggtggacca gttggtgatt ttgaactttt gctttgccac ggaacggtct 4800

gcgttgtcgg gaagatgcgt gatctgatcc ttcaactcag caaaagttcg atttattcaa 4860

caaagccgcc gtcccgtcaa gtcagcgtaa tgctctgcca gtgttacaac caattaacca 4920

attctgatta gaaaaactca tcgagcatca aatgaaactg caatttattc atatcaggat 4980

tatcaatacc atatttttga aaaagccgtt tctgtaatga aggagaaaac tcaccgaggc 5040

agttccatag gatggcaaga tcctggtatc ggtctgcgat tccgactcgt ccaacatcaa 5100

tacaacctat taatttcccc tcgtcaaaaa taaggttatc aagtgagaaa tcaccatgag 5160

tgacgactga atccggtgag aatggcaaaa gcttatgcat ttctttccag acttgttcaa 5220

caggccagcc attacgctcg tcatcaaaat cactcgcatc aaccaaaccg ttattcattc 5280

gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt aaaaggacaa ttacaaacag 5340

gaatcgaatg caaccggcgc aggaacactg ccagcgcatc aacaatattt tcacctgaat 5400

caggatattc ttctaatacc tggaatgctg ttttcccggg gatcgcagtg gtgagtaacc 5460

atgcatcatc aggagtacgg ataaaatgct tgatggtcgg aagaggcata aattccgtca 5520

gccagtttag tctgaccatc tcatctgtaa catcattggc aacgctacct ttgccatgtt 5580

tcagaaacaa ctctggcgca tcgggcttcc catacaatcg atagattgtc gcacctgatt 5640

gcccgacatt atcgcgagcc catttatacc catataaatc agcatccatg ttggaattta 5700

atcgcggcct cgagcaagac gtttcccgtt gaatatggct cataacaccc cttgtattac 5760

tgtttatgta agcagacagt tttattgttc atgatgatat atttttatct tgtgcaatgt 5820

aacatcagag attttgagac acaacgtggc tttccccccc ccccctgcag gtcggcatca 5880

ccggcgccac aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc 5940

gggctcgcca cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg 6000

tggccggggg actgttgggc gccatctcct tgcatgcacc attccttgcg gcggcggtgc 6060

tcaacggcct caacctacta ctgggctgct tcctaatgca ggagtcgcat aagggagagc 6120

gtcgagtatc tatgattgga agtatgggaa tggtgatacc cgcattcttc agtgtcttga 6180

ggtctcctat cagattatgc ccaactaaag caaccggagg aggagatttc atggtaaatt 6240

tctctgactt ttggtcatca gtagactcga actgtgagac tatctcggtt atgacagcag 6300

aaatgtcctt cttggagaca gtaaatgaag tcccaccaat aaagaaatcc ttgttatcag 6360

gaacaaactt cttgtttcga actttttcgg tgccttgaac tataaaatgt agagtggata 6420

tgtcgggtag gaatggagcg ggcaaatgct taccttctgg accttcaaga ggtatgtagg 6480

gtttgtagat actgatgcca acttcagtga caacgttgct atttcgttca aaccattccg 6540

aatccagaga aatcaaagtt gtttgtctac tattgatcca agccagtgcg gtcttgaaac 6600

tgacaatagt gtgctcgtgt tttgaggtca tctttgtatg aataaatcta gtctttgatc 6660

taaataatct tgacgagcca aggcgataaa tacccaaatc taaaactctt ttaaaacgtt 6720

aaaaggacaa gtatgtctgc ctgtattaaa ccccaaatca gctcgtagtc tgatcctcat 6780

caacttgagg ggcactatct tgttttagag aaatttgcgg agatgcgata tcgagaaaaa 6840

ggtacgctga ttttaaacgt gaaatttatc tcaagatctc tgcctcgcgc gtttcggtga 6900

tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc 6960

ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg 7020

cgcagccatg acccagtcac gtagcgatag cggagtgtat actggcttaa ctatgcggca 7080

tcagagcaga ttgtactgag agtgcaccat atgcggtgtg aaataccgca cagatgcgta 7140

aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 7200

gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 7260

gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 7320

cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 7380

aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 7440

tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 7500

ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat 7560

ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 7620

cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 7680

ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 7740

gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 7800

atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 7860

aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 7920

aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 7980

gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 8040

cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 8100

gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 8160

tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 8220

ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 8280

ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 8340

atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 8400

cgcaacgttg ttgccattgc tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct 8460

tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 8520

aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 8580

tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 8640

ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 8700

agttgctctt gcccggcgtc aacacgggat aataccgcgc cacatagcag aactttaaaa 8760

gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 8820

agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 8880

accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 8940

gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 9000

cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 9060

ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc 9120

atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtcttca agaattaatt 9180

ctcatgtttg acagcttatc atcgataagc tgactcatgt tggtattgtg aaatagacgc 9240

agatcgggaa cactgaaaaa taacagttat tattcg 9276

<210> 5

<211> 13272

<212> DNA

<213> nucleotide sequence of pPIC9K-Pir1p-lacA (Artificial Sequence)

<400> 5

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct 960

tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact 1020

acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta 1080

gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg 1140

tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tctcgagaaa 1200

agagaggctg aagcttacgt atatgctcca aaggacccgt ggtccatttt aactccatca 1260

gctacttaca agggtggtat aactgattac tcttctactt tcggtattgc tgttgaacca 1320

attgccacta ctgcttcctc caaggctaag agagccgctg ctatctctca aattggtgac 1380

ggtcaaatcc aagccactac caaaaccact gctgctgctg tttctcaaat tggtgacggt 1440

caaatccaag ccactactaa aaccaaagct gctgctgtct ctcaaattgg tgacggccaa 1500

atccaagcca ccaccaagac tacctcagct aagactaccg ctgcagccgt ctcccaaatt 1560

ggtgacggtc aaattcaagc cactactaaa accaaagctg ctgctgtctc tcaaattggt 1620

gacggtcaaa tccaagccac taccaaaaca actgctgcag ctgtctctca aattggtgac 1680

ggtcaaatcc aagccactac taaaaccact gctgcagctg tttctcaaat tggtgacggt 1740

caaatccaag ccaccaccaa tactactgtt gctccagtct cccaaatcac tgatggccaa 1800

atccaagcca caactttaac ttctgcaacc attataccat ctccagctcc agctccaatt 1860

actaatggca ctgacccagt aactgctgaa acatgtaaaa gcagtggcac tttagaaatg 1920

aacttaaagg gtggtatcct gactgacggt aaaggtagaa ttggttctat cgttgccaac 1980

agacaattcc aattcgatgg tcctccacca caagctggtg ctatctatgc tgctggttgg 2040

tccatcaccc cagaaggtaa cttggccatc ggtgaccagg atacttttta ccaatgtttg 2100

tcaggaaact tctacaactt atacgatgag cacattggaa ctcaatgtaa tgcagtccac 2160

ctacaagcta tcgatttgct caactgtgaa ttcggtggtg gtggttctgg tggtggtgga 2220

tctggtggtg gaggttcttc tattaagcat agattgaatg gttttaccat cttggaacat 2280

cctgatccag ctaagagaga tttgttgcag gatattgtta cttgggatga taagtctttg 2340

tttattaacg gtgaaagaat catgttgttc tctggtgagg ttcacccatt tagattgcct 2400

gttccatctt tgtggttgga tatttttcat aagatcagag ctttgggttt taactgtgtt 2460

tctttttata tcgactgggc tttgttggaa ggtaagccag gtgattacag agctgaaggt 2520

atttttgctt tggaaccatt ttttgatgct gctaaggaag ctggtattta cttgattgct 2580

agaccaggtt cttacattaa tgctgaggtt tccggtggtg gttttccagg ttggttgcaa 2640

agagttaacg gaactttgag atcttctgat gaaccatttt tgaaggctac tgacaattac 2700

attgctaacg ctgctgctgc tgttgctaag gctcagatta ctaacggtgg tccagttatt 2760

ttgtaccaac cagaaaacga atactctgga ggttgttgtg gagttaaata tccagatgct 2820

gattacatgc aatacgttat ggatcaagct agaaaggctg atattgttgt tccatttatt 2880

tctaacgacg cttctccttc tggtcataac gctcctggtt ctggaacttc tgctgttgat 2940

atttacggtc atgattctta cccattgggt tttgattgtg ctaatccatc tgtttggcct 3000

gaaggtaagt tgccagataa ttttagaact ttgcatttgg agcaatcccc atctactcca 3060

tactctttgt tggaatttca agctggtgct tttgatccat ggggtggtcc tggttttgaa 3120

aagtgttacg ctttggttaa ccatgaattt tctagagttt tctacagaaa cgatttgtct 3180

tttggtgttt ctacttttaa cttgtacatg actttcggtg gtactaattg gggtaacttg 3240

ggtcaccctg gtggttacac ttcttatgat tacggttctc ctattactga gactagaaac 3300

gttactagag aaaagtactc tgatattaag ttgttggcta actttgttaa ggcttctcct 3360

tcctacttga ctgctactcc aagaaacttg actactggtg tttacactga tacttctgat 3420

ttggctgtta ctccattgat tggtgattct cctggttctt tttttgttgt tagacacact 3480

gattactctt ctcaagaatc tacatcttac aaattgaagt tgccaacttc tgctggtaat 3540

ttgactattc ctcagttgga gggtactttg tctttgaacg gtagagattc caaaatccat 3600

gttgttgatt acaacgtttc cggtactaat attatttact ctactgctga agttttcact 3660

tggaagaagt ttgatggtaa taaagttttg gttttgtacg gtggtcctaa ggagcatcat 3720

gaattggcta tcgcttctaa gtctaacgtt accattattg aaggttctga ttctggaatt 3780

gtttctacta gaaagggttc ttctgttatt attggttggg atgtttcatc tactagaaga 3840

attgttcaag ttggtgattt gagagttttt ttgttggata gaaactctgc ttataactac 3900

tgggttccag aattgccaac cgagggtacc tctcctggtt tttctacctc taaaaccacc 3960

gcttcttcta ttattgttaa ggctggttac ttgttgagag gagctcattt ggatggtgct 4020

gatttgcatt tgactgctga ttttaacgct actactccta ttgaagttat tggagctcca 4080

actggtgcta agaatttgtt tgttaatggt gagaaggctt ctcatactgt tgataagaac 4140

ggtatttggt cctctgaggt taagtatgct gctcctgaga ttaagttgcc aggtttgaag 4200

gatttggatt ggaagtactt ggatactttg ccagaaatta aatcctctta cgatgattct 4260

gcttgggttt ctgctgattt gccaaagact aagaatactc atagaccatt ggatacccca 4320

acttctttgt actcttctga ttacggtttt cataccggat acttgattta cagaggtcat 4380

tttgttgcta acggtaagga atccgaattt tttattagaa ctcagggtgg ttctgctttt 4440

ggttcttccg tttggttgaa cgagacttac ttgggttctt ggaccggtgc tgattatgct 4500

atggatggta attcaactta caagttgtct cagttggaat ctggtaagaa ctatgttatt 4560

actgttgtta tcgacaactt gggattggat gaaaactgga cagttggtga agagactatg 4620

aagaatccaa gaggtatttt gtcttacaag ttgtccggtc aagatgcttc tgctattact 4680

tggaagttga caggaaactt gggtggagag gattaccaag ataaggttag aggaccattg 4740

aacgaaggtg gtttgtatgc tgaaagacag ggttttcatc aaccacaacc accatctgaa 4800

tcatgggaat ctggatctcc attggaaggt ttgtccaagc caggtattgg attttacacc 4860

gctcaatttg atttggattt gccaaaaggt tgggacgttc cattgtactt taactttggt 4920

aataacactc aggctgctag agctcaattg tacgttaacg gttaccaata cggtaaattt 4980

actggtaacg ttggtcctca gacatctttt ccagttccag aaggtatttt gaattataga 5040

ggaactaact acgttgcttt gtctttgtgg gctttggagt ctgatggtgc taagttggga 5100

tcttttgagt tgtcttacac tactcctgtt ttgactggtt atggtaacgt tgagtcccct 5160

gaacaaccaa agtatgagca aagaaagggt gcttacgatt acaaggatga tgatgataag 5220

taacctaggg cggccgcgaa ttaattcgcc ttagacatga ctgttcctca gttcaagttg 5280

ggcacttacg agaagaccgg tcttgctaga ttctaatcaa gaggatgtca gaatgccatt 5340

tgcctgagag atgcaggctt catttttgat acttttttat ttgtaaccta tatagtatag 5400

gatttttttt gtcattttgt ttcttctcgt acgagcttgc tcctgatcag cctatctcgc 5460

agctgatgaa tatcttgtgg taggggtttg ggaaaatcat tcgagtttga tgtttttctt 5520

ggtatttccc actcctcttc agagtacaga agattaagtg agaagttcgt ttgtgcaagc 5580

ttatcgataa gctttaatgc ggtagtttat cacagttaaa ttgctaacgc agtcaggcac 5640

cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg caccgtcacc ctggatgctg 5700

taggcatagg cttggttatg ccggtactgc cgggcctctt gcgggatatc gtccattccg 5760

acagcatcgc cagtcactat ggcgtgctgc tagcgctata tgcgttgatg caatttctat 5820

gcgcacccgt tctcggagca ctgtccgacc gctttggccg ccgcccagtc ctgctcgctt 5880

cgctacttgg agccactatc gactacgcga tcatggcgac cacacccgtc ctgtggatct 5940

atcgaatcta aatgtaagtt aaaatctcta aataattaaa taagtcccag tttctccata 6000

cgaaccttaa cagcattgcg gtgagcatct agaccttcaa cagcagccag atccatcact 6060

gcttggccaa tatgtttcag tccctcagga gttacgtctt gtgaagtgat gaacttctgg 6120

aaggttgcag tgttaactcc gctgtattga cgggcatatc cgtacgttgg caaagtgtgg 6180

ttggtaccgg aggagtaatc tccacaactc tctggagagt aggcaccaac aaacacagat 6240

ccagcgtgtt gtacttgatc aacataagaa gaagcattct cgatttgcag gatcaagtgt 6300

tcaggagcgt actgattgga catttccaaa gcctgctcgt aggttgcaac cgatagggtt 6360

gtagagtgtg caatacactt gcgtacaatt tcaacccttg gcaactgcac agcttggttg 6420

tgaacagcat cttcaattct ggcaagctcc ttgtctgtca tatcgacagc caacagaatc 6480

acctgggaat caataccatg ttcagcttga gacagaaggt ctgaggcaac gaaatctgga 6540

tcagcgtatt tatcagcaat aactagaact tcagaaggcc cagcaggcat gtcaatacta 6600

cacagggctg atgtgtcatt ttgaaccatc atcttggcag cagtaacgaa ctggtttcct 6660

ggaccaaata ttttgtcaca cttaggaaca gtttctgttc cgtaagccat agcagctact 6720

gcctgggcgc ctcctgctag cacgatacac ttagcaccaa ccttgtgggc aacgtagatg 6780

acttctgggg taagggtacc atccttctta ggtggagatg caaaaacaat ttctttgcaa 6840

ccagcaactt tggcaggaac acccagcatc agggaagtgg aaggcagaat tgcggttcca 6900

ccaggaatat agaggccaac tttctcaata ggtcttgcaa aacgagagca gactacacca 6960

gggcaagtct caacttgcaa cgtctccgtt agttgagctt catggaattt cctgacgtta 7020

tctatagaga gatcaatggc tctcttaacg ttatctggca attgcataag ttcctctggg 7080

aaaggagctt ctaacacagg tgtcttcaaa gcgactccat caaacttggc agttagttct 7140

aaaagggctt tgtcaccatt ttgacgaaca ttgtcgacaa ttggtttgac taattccata 7200

atctgttccg ttttctggat aggacgacga agggcatctt caatttcttg tgaggaggcc 7260

ttagaaacgt caattttgca caattcaata cgaccttcag aagggacttc tttaggtttg 7320

gattcttctt taggttgttc cttggtgtat cctggcttgg catctccttt ccttctagtg 7380

acctttaggg acttcatatc caggtttctc tccacctcgt ccaacgtcac accgtacttg 7440

gcacatctaa ctaatgcaaa ataaaataag tcagcacatt cccaggctat atcttccttg 7500

gatttagctt ctgcaagttc atcagcttcc tccctaattt tagcgttcaa caaaacttcg 7560

tcgtcaaata accgtttggt ataagaacct tctggagcat tgctcttacg atcccacaag 7620

gtggcttcca tggctctaag accctttgat tggccaaaac aggaagtgcg ttccaagtga 7680

cagaaaccaa cacctgtttg ttcaaccaca aatttcaagc agtctccatc acaatccaat 7740

tcgataccca gcaacttttg agttgctcca gatgtagcac ctttatacca caaaccgtga 7800

cgacgagatt ggtagactcc agtttgtgtc cttatagcct ccggaataga ctttttggac 7860

gagtacacca ggcccaacga gtaattagaa gagtcagcca ccaaagtagt gaatagacca 7920

tcggggcggt cagtagtcaa agacgccaac aaaatttcac tgacagggaa ctttttgaca 7980

tcttcagaaa gttcgtattc agtagtcaat tgccgagcat caataatggg gattatacca 8040

gaagcaacag tggaagtcac atctaccaac tttgcggtct cagaaaaagc ataaacagtt 8100

ctactaccgc cattagtgaa acttttcaaa tcgcccagtg gagaagaaaa aggcacagcg 8160

atactagcat tagcgggcaa ggatgcaact ttatcaacca gggtcctata gataacccta 8220

gcgcctggga tcatcctttg gacaactctt tctgccaaat ctaggtccaa aatcacttca 8280

ttgataccat tattgtacaa cttgagcaag ttgtcgatca gctcctcaaa ttggtcctct 8340

gtaacggatg actcaacttg cacattaact tgaagctcag tcgattgagt gaacttgatc 8400

aggttgtgca gctggtcagc agcataggga aacacggctt ttcctaccaa actcaaggaa 8460

ttatcaaact ctgcaacact tgcgtatgca ggtagcaagg gaaatgtcat acttgaagtc 8520

ggacagtgag tgtagtcttg agaaattctg aagccgtatt tttattatca gtgagtcagt 8580

catcaggaga tcctctacgc cggacgcatc gtggccgacc tgcagggggg gggggggcgc 8640

tgaggtctgc ctcgtgaaga aggtgttgct gactcatacc aggcctgaat cgccccatca 8700

tccagccaga aagtgaggga gccacggttg atgagagctt tgttgtaggt ggaccagttg 8760

gtgattttga acttttgctt tgccacggaa cggtctgcgt tgtcgggaag atgcgtgatc 8820

tgatccttca actcagcaaa agttcgattt attcaacaaa gccgccgtcc cgtcaagtca 8880

gcgtaatgct ctgccagtgt tacaaccaat taaccaattc tgattagaaa aactcatcga 8940

gcatcaaatg aaactgcaat ttattcatat caggattatc aataccatat ttttgaaaaa 9000

gccgtttctg taatgaagga gaaaactcac cgaggcagtt ccataggatg gcaagatcct 9060

ggtatcggtc tgcgattccg actcgtccaa catcaataca acctattaat ttcccctcgt 9120

caaaaataag gttatcaagt gagaaatcac catgagtgac gactgaatcc ggtgagaatg 9180

gcaaaagctt atgcatttct ttccagactt gttcaacagg ccagccatta cgctcgtcat 9240

caaaatcact cgcatcaacc aaaccgttat tcattcgtga ttgcgcctga gcgagacgaa 9300

atacgcgatc gctgttaaaa ggacaattac aaacaggaat cgaatgcaac cggcgcagga 9360

acactgccag cgcatcaaca atattttcac ctgaatcagg atattcttct aatacctgga 9420

atgctgtttt cccggggatc gcagtggtga gtaaccatgc atcatcagga gtacggataa 9480

aatgcttgat ggtcggaaga ggcataaatt ccgtcagcca gtttagtctg accatctcat 9540

ctgtaacatc attggcaacg ctacctttgc catgtttcag aaacaactct ggcgcatcgg 9600

gcttcccata caatcgatag attgtcgcac ctgattgccc gacattatcg cgagcccatt 9660

tatacccata taaatcagca tccatgttgg aatttaatcg cggcctcgag caagacgttt 9720

cccgttgaat atggctcata acaccccttg tattactgtt tatgtaagca gacagtttta 9780

ttgttcatga tgatatattt ttatcttgtg caatgtaaca tcagagattt tgagacacaa 9840

cgtggctttc cccccccccc ctgcaggtcg gcatcaccgg cgccacaggt gcggttgctg 9900

gcgcctatat cgccgacatc accgatgggg aagatcgggc tcgccacttc gggctcatga 9960

gcgcttgttt cggcgtgggt atggtggcag gccccgtggc cgggggactg ttgggcgcca 10020

tctccttgca tgcaccattc cttgcggcgg cggtgctcaa cggcctcaac ctactactgg 10080

gctgcttcct aatgcaggag tcgcataagg gagagcgtcg agtatctatg attggaagta 10140

tgggaatggt gatacccgca ttcttcagtg tcttgaggtc tcctatcaga ttatgcccaa 10200

ctaaagcaac cggaggagga gatttcatgg taaatttctc tgacttttgg tcatcagtag 10260

actcgaactg tgagactatc tcggttatga cagcagaaat gtccttcttg gagacagtaa 10320

atgaagtccc accaataaag aaatccttgt tatcaggaac aaacttcttg tttcgaactt 10380

tttcggtgcc ttgaactata aaatgtagag tggatatgtc gggtaggaat ggagcgggca 10440

aatgcttacc ttctggacct tcaagaggta tgtagggttt gtagatactg atgccaactt 10500

cagtgacaac gttgctattt cgttcaaacc attccgaatc cagagaaatc aaagttgttt 10560

gtctactatt gatccaagcc agtgcggtct tgaaactgac aatagtgtgc tcgtgttttg 10620

aggtcatctt tgtatgaata aatctagtct ttgatctaaa taatcttgac gagccaaggc 10680

gataaatacc caaatctaaa actcttttaa aacgttaaaa ggacaagtat gtctgcctgt 10740

attaaacccc aaatcagctc gtagtctgat cctcatcaac ttgaggggca ctatcttgtt 10800

ttagagaaat ttgcggagat gcgatatcga gaaaaaggta cgctgatttt aaacgtgaaa 10860

tttatctcaa gatctctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat 10920

gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg 10980

tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag 11040

cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg 11100

caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc 11160

tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 11220

tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 11280

aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 11340

tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 11400

tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 11460

cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 11520

agcgtggcgc tttctcaatg ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 11580

tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 11640

aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 11700

ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 11760

cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 11820

accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 11880

ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 11940

ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 12000

gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 12060

aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 12120

gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 12180

gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 12240

cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 12300

gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 12360

gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctgca 12420

ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 12480

tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 12540

ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 12600

cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 12660

accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaaca 12720

cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 12780

tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 12840

cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 12900

acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 12960

atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 13020

tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 13080

aaagtgccac ctgacgtcta agaaaccatt attatcatga cattaaccta taaaaatagg 13140

cgtatcacga ggccctttcg tcttcaagaa ttaattctca tgtttgacag cttatcatcg 13200

ataagctgac tcatgttggt attgtgaaat agacgcagat cgggaacact gaaaaataac 13260

agttattatt cg 13272

<210> 6

<211> 40

<212> DNA

<213> upstream primer for amplifying Pir1p Gene (Artificial Sequence)

<400> 6

aaagagaggc tgaagcttac gtatatgctc caaaggaccc 40

<210> 7

<211> 40

<212> DNA

<213> downstream primer for amplifying Pir1p Gene (Artificial Sequence)

<400> 7

ccagaaccac caccaccgaa ttcacagttg agcaaatcga 40

<210> 8

<211> 76

<212> DNA

<213> amplification of the upstream primer of the lacA Gene (Artificial Sequence)

<400> 8

gctcaactgt gaattcggtg gtggtggttc tggtggtggt ggatctggtg gtggaggttc 60

ttctattaag cataga 76

<210> 9

<211> 64

<212> DNA

<213> amplification of the downstream primer of the lacA Gene (Artificial Sequence)

<400> 9

ttaattcgcg gccgccctag gttacttatc atcatcatcc ttgtaatcgt aagcaccctt 60

tctt 64

<210> 10

<211> 40

<212> DNA

<213> amplification of the upstream primer of Pir1p+lacA overlap Gene (Artificial Sequence)

<400> 10

aaagagaggc tgaagcttac gtatatgctc caaaggaccc 40

<210> 11

<211> 64

<212> DNA

<213> amplification of the downstream primer of Pir1p+lacA overlap Gene (Artificial Sequence)

<400> 11

ttaattcgcg gccgccctag gttacttatc atcatcatcc ttgtaatcgt aagcaccctt 60

tctt 64

Claims (8)

1. A recombinant pichia pastoris with beta-galactosidase displayed on the surface, which is characterized in that the recombinant pichia pastoris is obtained by heterologously expressing a beta-galactosidase gene lacA from aspergillus oryzae BK03 and a cell wall protein gene pir1p from saccharomyces cerevisiae in original pichia pastoris, wherein the nucleotide sequence of the beta-galactosidase gene lacA from aspergillus oryzae BK03 is shown as SEQ ID NO:1 is shown in the specification; the nucleotide sequence of the cell wall protein gene pir1p from saccharomyces cerevisiae is shown as SEQ ID NO: 2.

2. The recombinant pichia pastoris of claim 1, wherein the original pichia pastoris isPichia pastoris GS115。

3. The construction method of recombinant pichia pastoris according to claim 1 or 2, characterized in that the cell wall protein pir1p from saccharomyces cerevisiae and the β -galactosidase gene lacA from aspergillus oryzae BK03 are first overlapped and then cloned into the pPIC9k plasmid to obtain a linearized plasmid, which is then introduced into the genome of pichia pastoris by electrotransformation.

4. The method for inducing and expressing recombinant pichia pastoris according to claim 1 or 2, wherein the recombinant pichia pastoris is inoculated in YPD liquid culture medium, seed liquid is obtained by overnight culture, and then the seed liquid is inoculated in BMGY culture medium for culture until OD ₆₀₀ To 2-6, the BMGY medium was centrifuged to remove the supernatant, the resulting bacterial pellet was washed with sterile water, and the pellet was transferred to BMMY medium containing methanol for further culture.

5. The method of claim 4, wherein the YPD liquid medium comprises 10g/L yeast powder, 20g/L peptone, and 20g/L glucose; the BMGY culture medium comprises 10g/L yeast powder, 20g/L peptone, 2ml/L biotin mother liquor, 100 ml/L10% glycerol, 100ml/L potassium phosphate mother liquor and 100ml/L YNB mother liquor.

6. The method of claim 4, wherein the YNB mother liquor consists of 20.1g YNB and 150ml H ₂ O, the potassium phosphate mother liquor consists of 0.45. 0.45g K ₂ HPO ₄ 、1.77g KH ₂ PO ₄ And 150ml H ₂ O, the mother liquor of biotin consists of 20mg and 100ml H ₂ O composition.

7. Use of the recombinant pichia pastoris according to claim 1 or 2 for the fermentative production of galactooligosaccharides.

8. The use according to claim 7, wherein the recombinant pichia pastoris is inoculated into a pichia pastoris fermentation medium BMMY for fermentation culture, the thalli are collected by centrifugation, and then the cells are transformed by taking lactose as a substrate to obtain the galactooligosaccharides.

Images