CN108823230A - A kind of Prokaryotic expression, purification method of source of people selenoprotein H - Google Patents
A kind of Prokaryotic expression, purification method of source of people selenoprotein H Download PDFInfo
- Publication number
- CN108823230A CN108823230A CN201810567021.XA CN201810567021A CN108823230A CN 108823230 A CN108823230 A CN 108823230A CN 201810567021 A CN201810567021 A CN 201810567021A CN 108823230 A CN108823230 A CN 108823230A
- Authority
- CN
- China
- Prior art keywords
- selenoprotein
- people
- expression
- source
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to the Prokaryotic expression, purification methods of source of people selenoprotein H a kind of, the rna transcription of SK-N-SH human neuroblastoma cells cell is cDNA by this method, further people's selenoprotein H gene is obtained with PCR method, and the gene is connected in prokaryotic expression carrier, conversion carries out inducing expression into Escherichia coli, and expression product Glutathione-Sepharose TM4B is purified.Method of the invention can be under the premise of guaranteeing that the selenocysteine for not being mutated selenoprotein H is active in expression in escherichia coli selenoprotein H.
Description
Technical field
The present invention relates to genetic engineering fields, and in particular, to a kind of Prokaryotic expression, purification method of source of people selenoprotein H.
Background technique
Selenium (Selenium) is important one of the microelement of human body.Recent studies indicate that selenium and cardiovascular disease,
The diseases such as tumour, nervous system are related, participate in thyroid hormone metabolism, antioxidant system makes physical exertion normal immunological function
Energy.Selenoprotein (Selenoprotein) is the protein that one kind of discovered in recent years is encoded by specific coding mechanism.Selenium is with selenium
For the form of cysteine (Sec), using the UGA of one of three terminator codons as triplet codon, by a set of high
The coding and synthesis mechanism for spending specialization are encoded in protein, therefore Sec is considered as the intracorporal 21st kind of amino acid of biology.Mesh
Preceding known expression and purification mode of other selenoproteins in protokaryon Escherichia coli is mostly by selenocysteine therein
(Sec) cysteine for being easy coding is sported, i.e., the UGA codon for encoding selenocysteine is become into UGC, by A base
C base is sported, then carries out subsequent purification step again.However, the albumen that this method obtains will affect selenoprotein utilization
The functional activity that selenocysteine is played, therefore, it is necessary to eucaryote selenoprotein H not to be mutated its seleno in prokaryotes
The new technology of the expression of cystein codons.
Summary of the invention
In order to solve the above-mentioned technical problem at least one, the prokaryotic expression that the present invention provides a kind of source of people selenoprotein H are pure
Change method, includes the following steps：
(1) gene of human cloning selenoprotein H, with the gene of reverse transcription PCR method amplification selenoprotein H；
(2) the selenoprotein gene of above-mentioned amplification is connect with expression vector, constructs people's selenoprotein H gene expression vector；
(3) above-mentioned expression vector is transformed into the Escherichia coli for being used for cloning, positive colony is selected and extracts plasmid, conversion is extremely
Escherichia coli for the Escherichia coli of expression, after being recombinated；
(4) Escherichia coli after above-mentioned recombination are induced, it is made to express people's selenoprotein H；
(5) Purification of Human selenoprotein H：
A. it collects thallus and is dissolved in ultrasonication in the PBS that protease inhibitors is added, take bacteria lysis supernatant；
B. it is purified using Glutathione-Sepharose TM4B.
In embodiments of the invention, the primer such as SEQ ID of the gene of the reverse transcription PCR method amplification selenoprotein H
NO:1 and SEQ ID NO:Shown in 2.
In embodiments of the invention, the PCR program of the reverse transcription PCR method amplification selenoprotein H is：95 DEG C of initial denaturations
3min；95 DEG C of denaturation 15s, 60 DEG C of annealing 15s, totally 35 recycle；Extend 72 DEG C of 5min eventually.
In embodiments of the invention, it is by the method that the selenoprotein gene is connect with expression vector：Expression vector
For any expression vector, digestion is carried out to PCR product and expression vector with identical restriction enzyme, after purifying digestion
The PCR product of purifying is connect by PCR product and expression vector with T4 ligase with expression vector.
In embodiments of the invention, the expression vector is pGEX-6p-1, and the restriction enzyme is Xho I
With EcoR I.
In embodiments of the invention, the Escherichia coli for clone are DH5 α, the large intestine for expression
Bacillus is BL21.
In embodiments of the invention, the method for Bacillus coli expression people's selenoprotein H after the induction recombination is：It will
Escherichia coli after recombination are inoculated in LB liquid medium with ampicillin, 37 DEG C, 250rpm shaken cultivation 12h, it
1 is pressed afterwards：100 times of expansion cultures, in 37 DEG C of continuation shaken cultivation 4h, add IPTG to final concentration of 1mmol/L, in 37 DEG C of induction tables
Up to 6hr.
In embodiments of the invention, described the step of being purified using Glutathione-Sepharose TM4B
For：After Glutathione-Sepharose TM4B medium is mixed well, 2mL is taken to be added to the chromatographic column for having put a piece of sieve plate
In, deionization washing column is provided for oneself with 5 times of column volumes, altogether three times；Column is washed with the combination buffer of 5 times of column volumes, altogether three times；By institute
It states supernatant and purification media is added, 4 DEG C combine 1 hour；Column is washed with the combination buffer of 10 times of column volumes, by unbonded miscellaneous egg
It is white to wash away；Column further is washed with configured eluent, collects and saves and penetrate liquid to get to people's selenoprotein H after purification.
In embodiments of the invention, the formula of the combination buffer is Nacl (140mmol/L), KCL
(2.7mmol/L), Na2HPO4(10mmol/L), KH2PO4(1.8mmol/L), final ph is adjusted to 9.7；The eluent is matched
Fang Wei：Tris-HCL (50mmol/L), reduced glutathione (50mmol/L), final ph is adjusted to 9.7.
In embodiments of the invention, further, pure the method also includes being identified using detected by Western blot
The step of people selenoprotein H after change.Preferably, the detected by Western blot is WesternBlot method.
It in embodiments of the invention, further include the step verified using SDS-PAGE electrophoresis before protein immunoblot
Suddenly.
Detailed description of the invention
Fig. 1 shows the result identified using people's selenoprotein H that method of the invention purifies through immunoprecipitation.
Specific embodiment
In order to which the technical problems, technical solutions and beneficial effects solved by the present invention is more clearly understood, below in conjunction with
Embodiment, the present invention will be described in further detail.
Embodiment
Following example is used herein to demonstration the preferred embodiments of the invention.Those skilled in the art, it will be appreciated that under
State the technology disclosed in example represent inventor discovery can be used for implementing technology of the invention, therefore can be considered as implementation this
The preferred embodiment of invention.But those skilled in the art should be understood that specific reality disclosed herein according to this specification
Many modifications can be made by applying example, still can be obtained identical or similar as a result, rather than away from the spirit or scope of the present invention.
Unless otherwise defined, the term of all technologies as used herein and science, and the technology in fields of the present invention
Personnel institute is normally understood equivalent in meaning, and being disclosed reference and their materials of reference will all be incorporated.
Those skilled in the art will recognize or just will appreciate that by routine test many described here
Invention specific embodiment many equivalent technologies.These will equally be comprised in claims.
Embodiment 1
(1) material
E. coli bl21, DH5 α are purchased from TIANGEN Biotech (Beijing) Co., Ltd..Prokaryotic expression carrier is pGEX-
6p-1.IPTG is purchased from green skies biotech company.Primer synthesis, sequencing technologies are completed by Huada gene company.Carrier construction
Kit be purchased from Nanjing Nuo Weizan company.Glutathione-Sepharose TM4B is purchased from GE company, and other reagents are
Domestic analysis is pure.
(2) method
The cDNA clone of 1.SelenoH
The total serum IgE of SK-N-SH human neuroblastoma cells cell is extracted using TRIZOL, RT-PCR method amplification obtains selenium egg
White H (SelenoH) gene (Gene ID：280636) cDNA is obtained as template through upstream and downstream primer PCR amplification
The product of SelneoH overall length.
Upstream primer (SEQ ID NO:1)：
CCCCTGGGATCCCCGGAATTCATGGCTCCCCGCGGGAGGAAG
Downstream primer (SEQ ID NO:2)：
GTCACGATGCGGCCGCTCGAGACAATGCCTTACTAGAGGGTTGC
The parameter of PCR is as follows：95 DEG C of initial denaturation 3min；95 DEG C of denaturation 15s, 60 DEG C of annealing 15s, totally 35 recycle；Prolong eventually
Stretch 72 DEG C of 5min.
The building of 2.pGEX-6p-1-SelenoH carrier.
Vector pGEX -6p-1 is subjected to double digestion, enzyme is XhoI and EcoRI, and the carrier after PCR product and double digestion is passed through
After gel extraction, it is attached using kit.Competent escherichia coli cell DH5 α is converted after the completion of connection.Picking monoclonal
Afterwards, bacterium solution PCR is carried out, after obtaining positive colony, after sending sequencing identification accurate, extracts plasmid.
3. being transformed into competent escherichia coli cell BL21.
4. the inducing expression of destination protein.
By the bacterial strain containing expression vector pGEX-6p-1-SelenoH, (the mould of benzyl containing ammonia is inoculated in LB liquid medium
Element), 37 DEG C, 250rpm shaken cultivation overnight (about 12h), secondary morning, by 1：100 times of expansion cultures, in 37 DEG C of continuation shaken cultivations
4h.Add isopropyl B-D- thiogalactoside (IPTG) to final concentration of 1mmol/L, in 37 DEG C of inducing expression 6h.Centrifugation is received
Collection thallus is dissolved in ultrasonication in the PBS that protease inhibitors is added, and takes bacteria lysis supernatant and sediment fraction, carries out SDS-
PAGE electrophoretic analysis, is observed with detected by Western blot.There are expression products for supernatant fraction, supernatant fraction are continued to do subsequent
Purification part.
5. the purifying of destination protein.
In conjunction with liquid：Nacl (140mmol/L), KCL (2.7mmol/L), Na2HPO4(10mmol/L), KH2PO4
(1.8mmol/L), final ph is adjusted to 9.7.
Eluent：Tris-HCL (50mmol/L), reduced glutathione (50mmol/L), final ph is adjusted to 9.7.
After Glutathione-Sepharose TM4B medium is mixed well, takes to be added in right amount and put a piece of sieve plate
(supernatant fraction is taken to measure protein concentration, the destination protein yield 1ml medium of 2.5 μ g) in chromatographic column, is provided for oneself with 5 times of column volumes
Deionization washes column, altogether three times.Column is washed with the combination buffer of newly matching of 5 times of column volumes, altogether three times.By above-mentioned spare albumen supernatant
Purification media is added in liquid, and 4 DEG C combine 1 hour.Column is washed with the combination buffer of newly matching of 10 times of column volumes, the foreign protein that will be not associated with
It washes away, collects and save and penetrate liquid.Column further is washed with configured eluent, collects and saves and penetrate liquid.After elution, successively
Pillar is washed using the deionized water of 10 times of column volumes, then is balanced with 20% ethyl alcohol of 3 times of column volumes, is finally blocked under chromatographic column
The leak at end, 4 DEG C of preservations use next time.
6. the identification of destination protein.
The liquid that penetrates that purifying is obtained carries out SDS-PAGE electrophoretic analysis, with detected by Western blot (Western Blot)
Observation.
After protein purification, expressed successfully with the SelenoH that detected by Western blot observes unmutated selenocysteine,
As shown in Figure 1.It is about 42kDa that band, which is significantly partially size, in figure, the people's selenoprotein H (SelenoH) purified.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Sequence table
<110>Wenzhou Medical University
<120>A kind of Prokaryotic expression, purification method of source of people selenoprotein H
<130> XY-2018-1-W-008
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cccctgggat ccccggaatt catggctccc cgcgggagga ag 42
<210> 2
<211> 44
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gtcacgatgc ggccgctcga gacaatgcct tactagaggg ttgc 44
Claims (10)
1. a kind of Prokaryotic expression, purification method of source of people selenoprotein H, which is characterized in that include the following steps：
（1）The gene of human cloning selenoprotein H, with the gene of reverse transcription PCR method amplification selenoprotein H；
（2）The selenoprotein gene of above-mentioned amplification is connect with expression vector, constructs people's selenoprotein H gene expression vector；
（3）Above-mentioned expression vector is transformed into the Escherichia coli for being used for cloning, positive colony is selected and extracts plasmid, conversion is to being used for
The Escherichia coli of expression, the Escherichia coli after being recombinated；
（4）Escherichia coli after inducing above-mentioned recombination make it express people's selenoprotein H；
（5）Purification of Human selenoprotein H：
A. it collects thallus and is dissolved in ultrasonication in the PBS that protease inhibitors is added, take bacteria lysis supernatant；
B. it is purified using Glutathione-Sepharose TM4B.
2. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 1, which is characterized in that the reverse transcription PCR
Method expands the primer such as SEQ ID NO of the gene of selenoprotein H:1 and SEQ ID NO:Shown in 2.
3. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 2, which is characterized in that the reverse transcription PCR
Method amplification selenoprotein H PCR program be：95 DEG C of initial denaturation 3min；95 DEG C of denaturation 15s, 60 DEG C of annealing 15s, totally 35 recycle；Eventually
Extend 72 DEG C of 5min.
4. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 1 or claim 2, which is characterized in that by the selenium egg
The method that white gene is connect with expression vector is：Expression vector is any expression vector, with identical restriction enzyme to PCR
Product and expression vector carry out digestion, PCR product and expression vector after purifying digestion, are produced the PCR of purifying with T4 ligase
Object is connect with expression vector.
5. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 3, which is characterized in that the expression vector
For pGEX-6p-1, the restriction enzyme isXhoI andEcoRI。
6. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 1 or claim 2, which is characterized in that it is described for gram
Grand Escherichia coli are DH5 α, and the Escherichia coli for expression are BL21.
7. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 1 or claim 2, which is characterized in that the induction weight
The method of Bacillus coli expression people's selenoprotein H after group is：Escherichia coli after recombination are inoculated in LB with ampicillin
In fluid nutrient medium, 37 DEG C, 250rpm shaken cultivation 12h press 1 later：100 times of expansion cultures, in 37 DEG C of continuation shaken cultivations
4h adds IPTG to final concentration of 1mmol/L, in 37 DEG C of 6 hr of inducing expression.
8. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 1 or claim 2, which is characterized in that the utilization
The step of Glutathione-Sepharose TM4B is purified be：By Glutathione-Sepharose TM4B medium
After mixing well, 2mL is taken to be added in the chromatographic column for having put a piece of sieve plate, provides deionization washing column for oneself with 5 times of column volumes, totally three
It is secondary；Column is washed with the combination buffer of 5 times of column volumes, altogether three times；Purification media is added in the supernatant, 4 DEG C combine 1 hour；
Column is washed with the combination buffer of 10 times of column volumes, unbonded foreign protein is washed away；Column further is washed with configured eluent,
It collects and saves and penetrate liquid to get the people's selenoprotein H arrived after purification.
9. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 8, which is characterized in that the combination buffering
The formula of liquid is Nacl（140mmol/L）, KCL（2.7mmol/L）, Na2HPO4（10mmol/L）, KH2PO4（1.8mmol/L）,
Final ph is adjusted to 9.7；
The formula of the eluent is：Tris-HCL（50mmol/L）, reduced glutathione（50mmol/L）, final ph tune
To 9.7.
10. the Prokaryotic expression, purification method of source of people selenoprotein H according to claim 8, which is characterized in that the method is into one
The step of step is including the use of people selenoprotein H after detected by Western blot purification Identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810567021.XA CN108823230B (en) | 2018-06-05 | 2018-06-05 | Prokaryotic expression purification method of human selenoprotein H |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810567021.XA CN108823230B (en) | 2018-06-05 | 2018-06-05 | Prokaryotic expression purification method of human selenoprotein H |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108823230A true CN108823230A (en) | 2018-11-16 |
| CN108823230B CN108823230B (en) | 2022-03-18 |
Family
ID=64143716
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810567021.XA Active CN108823230B (en) | 2018-06-05 | 2018-06-05 | Prokaryotic expression purification method of human selenoprotein H |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108823230B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109957575A (en) * | 2019-04-09 | 2019-07-02 | 扬州大学 | A kind of preparation method of goat capripoxvirus p32 soluble protein |
| CN112641947A (en) * | 2019-10-11 | 2021-04-13 | 沈阳福洋医药科技有限公司 | Screening target spot, application and screening method of anti-tumor drug |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1314469A (en) * | 2000-03-20 | 2001-09-26 | 北京市营养源研究所 | purifying method recombined human se-protein p gene express and its special primer and culture medium |
| CN107884587A (en) * | 2017-12-18 | 2018-04-06 | 温州医科大学 | A kind of screening of micromolecular inhibitor that can suppress Infection of Toxoplasma Gondii propagation and application process |
-
2018
- 2018-06-05 CN CN201810567021.XA patent/CN108823230B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1314469A (en) * | 2000-03-20 | 2001-09-26 | 北京市营养源研究所 | purifying method recombined human se-protein p gene express and its special primer and culture medium |
| CN107884587A (en) * | 2017-12-18 | 2018-04-06 | 温州医科大学 | A kind of screening of micromolecular inhibitor that can suppress Infection of Toxoplasma Gondii propagation and application process |
Non-Patent Citations (4)
| Title |
|---|
| COX AG等: "登录号：NM_001321335.1", 《GENBANK》 * |
| COX AG等: "登录号：NM_170746.3", 《GENBANK》 * |
| NOVOSELOV SV等: "Selenoprotein H is a nucleolar thioredoxin-like protein with a unique expression pattern", 《JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| 吴丕宏: "猪硒蛋白基因TrxR2和SelH的克隆、表达及抗体制备", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109957575A (en) * | 2019-04-09 | 2019-07-02 | 扬州大学 | A kind of preparation method of goat capripoxvirus p32 soluble protein |
| CN112641947A (en) * | 2019-10-11 | 2021-04-13 | 沈阳福洋医药科技有限公司 | Screening target spot, application and screening method of anti-tumor drug |
| WO2021068910A1 (en) * | 2019-10-11 | 2021-04-15 | 沈阳福洋医药科技有限公司 | Target for screening anti-tumor drug, use thereof and screening method therefor |
| CN112641947B (en) * | 2019-10-11 | 2023-02-03 | 沈阳福洋医药科技有限公司 | Screening target spot, application and screening method of anti-tumor drug |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108823230B (en) | 2022-03-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110128521B (en) | Auxiliary protein for producing recombinant fusion protein, encoding gene, recombinant fusion protein, recombinant expression vector and preparation method | |
| CN103122027A (en) | Recombinant human collagen and production method thereof | |
| CN106397610B (en) | The preparation method and applications of Echinococcus Granulosus Cysts multi-epitope fusion diagnosis antigen protein | |
| CN107245494A (en) | Solution expression with high efficiency and purification process of the A β 42 in Escherichia coli | |
| CN110903383A (en) | Recombinant human type I collagen, encoding gene, engineering bacterium and application thereof | |
| CN101353659B (en) | Method for preparing dissolvable high activity recombinant human epidermal growth factor | |
| CN104774813B (en) | Leucine dehydrogenase and preparation method and application thereof | |
| CN108823230A (en) | A kind of Prokaryotic expression, purification method of source of people selenoprotein H | |
| CN104211799B (en) | Human Epidermal growth factor domain protein and its application | |
| CN111217903A (en) | Recombinant human fibronectin III 1-C and preparation method and application thereof | |
| CN101760470B (en) | Method for preparing human growth hormone recombinant | |
| CN104480125B (en) | Trachinotus ovatus thioredoxin gene | |
| CN104726461B (en) | Soft-shelled turtle collagen gene function fragment and its recombinant protein and application | |
| CN108822195A (en) | Dangshan pear has albumen, encoding gene PbrTTS1 and its application for promoting pollen tube growth function | |
| CN102676568A (en) | Method for producing recombinant dermatophagoides farinae allergen Der f1 and Der f2 fusion protein | |
| Kajino et al. | Efficient production of artificially designed gelatins with a Bacillus brevis system | |
| CN113736766B (en) | Collagen hydrolase and its coding gene, preparation method and use | |
| CN103966191A (en) | Preparation method of recombinant bovine trypsin | |
| CN109942694A (en) | Grass carp Akirin1 gene, coding albumen and its application | |
| CN108300725B (en) | Soluble single-chain antibody superantigen fusion gene and protein, and preparation and application thereof | |
| CN101955969A (en) | Construction and application for general efficient and soluble pronucleus fusion expression vector | |
| Stancombe et al. | Isolation of the gene and large-scale expression and purification of recombinant Erythrina cristagalli lectin | |
| CN110819645B (en) | Fancy carp Gtpch2 gene, coded protein and application thereof | |
| CN105646701B (en) | Recombinant human endostatin albumen of different aminoacids structure and its preparation method and application | |
| CN103965341B (en) | Bacterium-binding protein, encoding gene of bacterium-binding protein, fusion protein prepared with encoding gene as target gene and application of fusion protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |