CN108823230B - Prokaryotic expression purification method of human selenoprotein H - Google Patents
Prokaryotic expression purification method of human selenoprotein H Download PDFInfo
- Publication number
- CN108823230B CN108823230B CN201810567021.XA CN201810567021A CN108823230B CN 108823230 B CN108823230 B CN 108823230B CN 201810567021 A CN201810567021 A CN 201810567021A CN 108823230 B CN108823230 B CN 108823230B
- Authority
- CN
- China
- Prior art keywords
- selenoprotein
- purification
- expression
- human
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a prokaryotic expression purification method of human selenoprotein H, which transcribes RNA of SK-N-SH cells of human neuroblastoma into cDNA, further obtains human selenoprotein H gene by a PCR method, connects the gene into a prokaryotic expression vector, transforms the gene into escherichia coli for induced expression, and purifies an expression product by Glutathieone-Sepharose TM 4B. The method can express the selenocysteine H in the escherichia coli on the premise of ensuring that the selenocysteine activity of the selenocysteine H is not mutated.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to a prokaryotic expression purification method of human selenoprotein H.
Background
Selenium (Selenium) is one of the important trace elements of the human body. Recent researches show that selenium is related to cardiovascular diseases, tumors, nervous system and other diseases, and participates in thyroid hormone metabolism and an antioxidant system to enable an organism to play a normal immune function. Selenoprotein (selenin) is a recently discovered class of proteins encoded by a specific coding mechanism. Selenium is encoded into proteins in the form of selenocysteine (Sec) by a set of highly specialized coding and synthesis mechanisms using UGA, one of the three stop codons, as the triplet codon, and thus Sec is considered the 21 st amino acid in organisms. Most of the currently known expression and purification modes of other selenoproteins in prokaryotic escherichia coli are to mutate selenocysteine (Sec) in the selenocysteine into cysteine which is easy to code, namely, UGA codon for coding selenocysteine is changed into UGC, A base is mutated into C base, and then subsequent purification steps are carried out. However, the protein obtained by this method affects the functional activity of selenocysteine, and thus, a new technique for expressing eukaryotic selenocysteine H without mutating selenocysteine codon in prokaryotes is required.
Disclosure of Invention
In order to solve at least one of the above technical problems, the present invention provides a prokaryotic expression purification method of human selenoprotein H, comprising the following steps:
(1) cloning the gene of human selenoprotein H, and amplifying the gene of selenoprotein H by a reverse transcription PCR method;
(2) connecting the amplified selenoprotein gene with an expression vector to construct a human selenoprotein H gene expression vector;
(3) transforming the expression vector into escherichia coli for cloning, selecting positive clones to extract plasmids, and transforming the plasmids into the escherichia coli for expression to obtain recombinant escherichia coli;
(4) inducing the recombinant Escherichia coli to express human selenoprotein H;
(5) purifying human selenoprotein H:
a. collecting thallus, dissolving in PBS (phosphate buffer solution) added with protease inhibitor, ultrasonically crushing, and taking bacterial lysis supernatant;
b. purification was performed using Glutathione-Sepharose TM 4B.
In the embodiment of the invention, the primers for amplifying the selenoprotein H gene by the reverse transcription PCR method are shown as SEQ ID NO. 1 and SEQ ID NO. 2.
In an embodiment of the present invention, the PCR procedure for the reverse transcription PCR method to amplify selenoprotein H is: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 15s, 35 cycles; final extension at 72 ℃ for 5 min.
In an embodiment of the present invention, the method for linking the selenoprotein gene to an expression vector comprises: the expression vector is any expression vector, the PCR product and the expression vector are subjected to enzyme digestion by using the same restriction enzyme, the PCR product and the expression vector after enzyme digestion are purified, and the purified PCR product is connected with the expression vector by using T4 ligase.
In an embodiment of the present invention, the expression vector is pGEX-6p-1 and the restriction enzymes are Xho I and EcoR I.
In an embodiment of the present invention, the E.coli used for cloning is DH5 a, and the E.coli used for expression is BL 21.
In an embodiment of the present invention, the method for expressing human selenoprotein H by escherichia coli after induction recombination comprises: the recombinant Escherichia coli is inoculated in LB liquid culture medium containing ampicillin, and is subjected to shaking culture at 37 ℃ and 250rpm for 12h, and then the mixture is subjected to 1: performing 100-fold amplification culture, further performing shaking culture at 37 deg.C for 4 hr, adding IPTG to final concentration of 1mmol/L, and inducing expression at 37 deg.C for 6 hr.
In an embodiment of the present invention, the purification step using glutaminone-Sepharose TM4B is: after fully and uniformly mixing Glutathione-Sepharose TM4B medium, adding 2mL of the mixed solution into a chromatographic column with a sieve plate, and washing the column with self-prepared deionized water with 5 times of column volume for three times; washing the column with 5 column volumes of binding buffer for a total of three times; adding the supernatant to a purification medium and binding for 1 hour at 4 ℃; washing the column with 10 column volumes of binding buffer to remove unbound contaminating proteins; and further washing the column with the prepared eluent, and collecting and storing the penetrating liquid to obtain the purified human selenoprotein H.
In an embodiment of the invention, the binding buffer is formulated as NaCl (140mmol/L), KCL (2.7mmol/L), Na2HPO4(10mmol/L)，KH2PO4(1.8mmol/L), the final pH was adjusted to 9.7; the formula of the eluent is as follows: Tris-HCl (50mmol/L), reduced glutathione (50mmol/L), final pH adjusted to 9.7.
In an embodiment of the invention, the method further comprises the step of identifying purified human selenoprotein H using western blotting. Preferably, the western immunoblotting method is a western blot method.
In an embodiment of the invention, a step of electrophoretic validation by SDS-PAGE is further included before western blotting.
Drawings
FIG. 1 shows the results of immunoprecipitation identification of human selenoprotein H purified using the methods of the invention.
Detailed Description
In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.
Examples
The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
Example 1
(A) Material
Coli BL21 and DH5 α were purchased from Tiangen Biochemical technology (Beijing) Ltd. The prokaryotic expression vector is pGEX-6 p-1. IPTG was purchased from bi yun sky biotechnology. The primer synthesis and sequencing technology is completed by Huada Gene Co. Kits for constructing vectors were purchased from Nanjing Novozam. Glutathione-Sepharose TM4B was purchased from GE, and all other reagents were in domestic analytical purity.
(II) method
cDNA cloning of SelenoH
Total RNA of human neuroblastoma SK-N-SH cells is extracted by TRIZOL, cDNA of selenoprotein H (SelenoH) Gene (Gene ID: 280636) is obtained by RT-PCR amplification, and the cDNA is used as a template to obtain a product with the full length of SelneoH through upstream and downstream primer PCR amplification.
Upstream primer (SEQ ID NO: 1):
CCCCTGGGATCCCCGGAATTCATGGCTCCCCGCGGGAGGAAG
downstream primer (SEQ ID NO: 2):
GTCACGATGCGGCCGCTCGAGACAATGCCTTACTAGAGGGTTGC
the PCR parameters were as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 15s, 35 cycles; final extension at 72 ℃ for 5 min.
Construction of pGEX-6p-1-SelenoH vector.
And carrying out double enzyme digestion on the vector pGEX-6p-1 by using XhoI and EcoRI, and connecting the PCR product and the vector subjected to double enzyme digestion by using a kit after cutting and recycling the PCR product and the vector. After the ligation was completed, E.coli competent cells DH 5. alpha. were transformed. After the monoclonal is selected, the PCR of a bacterial liquid is carried out, positive clones are obtained, and then the plasmids are extracted after the sequencing identification is accurate.
3. Transformed into Escherichia coli competent cells BL 21.
4. And (3) induced expression of the target protein.
The strain containing the expression vector pGEX-6p-1-SelenoH was inoculated in LB liquid medium (containing ampicillin) and cultured overnight (about 12 hours) at 37 ℃ with shaking at 250rpm, the following morning, in a 1: the culture was expanded 100 times and the shaking culture was continued at 37 ℃ for 4 hours. Isopropyl B-D-thiogalactoside (IPTG) was added to a final concentration of 1mmol/L and expression was induced at 37 ℃ for 6 h. Centrifuging, collecting thallus, dissolving in PBS containing protease inhibitor, ultrasonic crushing, collecting bacterial lysis supernatant and precipitate, performing SDS-PAGE electrophoretic analysis, and observing by western blotting. The expression product exists in the supernatant part, and the supernatant part is continued to be used as a subsequent purification part.
5. And (4) purifying the target protein.
Binding liquid: NaCl (140mmol/L), KCL (2.7mmol/L), Na2HPO4(10mmol/L)，KH2PO4(1.8mmol/L), the final pH was adjusted to 9.7.
Eluent: Tris-HCl (50mmol/L), reduced glutathione (50mmol/L), final pH adjusted to 9.7.
After fully mixing the Glutathione-Sepharose TM4B medium, adding a proper amount of the mixture into a chromatographic column with a sieve plate (taking the supernatant part to measure the protein concentration, using 1ml of medium for the yield of 2.5 mu g of target protein), and washing the column with 5 times of column volume of self-prepared deionized water for three times. The column was washed three times with 5 column volumes of fresh conjugate buffer. The above-mentioned protein supernatant was added to the purification medium and bound at 4 ℃ for 1 hour. The column was washed with 10 column volumes of fresh conjugate buffer, unbound contaminating proteins were washed away, and the permeate was collected and stored. The column was further washed with the prepared eluent, and the permeate was collected and stored. After elution, the column was washed with 10 column volumes of deionized water, equilibrated with 3 column volumes of 20% ethanol, and finally plugged with a leak at the lower end of the column, and stored at 4 ℃ for the next use.
6. And (3) identifying the target protein.
The purified permeate was subjected to SDS-PAGE and visualized by Western blotting.
After protein purification, successful SelenoH expression of non-mutated selenocysteine was observed by western blotting, as shown in FIG. 1. The obvious part of the band in the figure is human selenoprotein H (SelenoH) with the size of about 42kDa and obtained by purification.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Wenzhou university of medical science
<120> prokaryotic expression purification method of human selenoprotein H
<130> XY-2018-1-W-008
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cccctgggat ccccggaatt catggctccc cgcgggagga ag 42
<210> 2
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtcacgatgc ggccgctcga gacaatgcct tactagaggg ttgc 44
Claims (8)
1. A prokaryotic expression purification method of human selenoprotein H is characterized by comprising the following steps:
(1) cloning a gene of human selenoprotein H, and amplifying the gene of selenoprotein H by a reverse transcription PCR method, wherein primers for amplifying the gene of selenoprotein H by the reverse transcription PCR method are shown as SEQ ID NO. 1 and SEQ ID NO. 2;
(2) connecting the amplified selenoprotein gene with an expression vector to construct a human selenoprotein H gene expression vector, wherein the expression vector is pGEX-6p-1, and restriction enzymes are Xho I and EcoR I;
(3) transforming the expression vector into escherichia coli for cloning, selecting positive clones to extract plasmids, and transforming the plasmids into the escherichia coli for expression to obtain recombinant escherichia coli;
(4) inducing the recombinant Escherichia coli to express human selenoprotein H;
(5) purifying human selenoprotein H:
a. collecting thallus, dissolving in PBS (phosphate buffer solution) added with protease inhibitor, ultrasonically crushing, and taking bacterial lysis supernatant;
b. purification was performed using Glutathione-Sepharose TM 4B.
2. The method for prokaryotic expression and purification of human selenoprotein H according to claim 1, wherein the PCR procedure for amplification of selenoprotein H by reverse transcription PCR method is as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 15s, 35 cycles; final extension at 72 ℃ for 5 min.
3. The method for prokaryotic expression and purification of human selenoprotein H according to claim 1, wherein the method for linking the selenoprotein gene with an expression vector comprises: the expression vector is any expression vector, the PCR product and the expression vector are subjected to enzyme digestion by using the same restriction enzyme, the PCR product and the expression vector after enzyme digestion are purified, and the purified PCR product is connected with the expression vector by using T4 ligase.
4. The method for prokaryotic expression and purification of human selenoprotein H according to claim 1, wherein the Escherichia coli used for cloning is DH5 α, and the Escherichia coli used for expression is BL 21.
5. The method for prokaryotic expression and purification of human selenoprotein H according to claim 1, wherein the method for expressing human selenoprotein H by E.coli after induction and recombination comprises: the recombinant Escherichia coli is inoculated in LB liquid culture medium containing ampicillin, and is subjected to shaking culture at 37 ℃ and 250rpm for 12h, and then the mixture is subjected to 1: performing 100-fold amplification culture, further performing shaking culture at 37 deg.C for 4 hr, adding IPTG to final concentration of 1mmol/L, and inducing expression at 37 deg.C for 6 hr.
6. The method for prokaryotic expression and purification of human selenoprotein H according to claim 1, wherein the purification by Glutathieone-Sepharose TM4B comprises the following steps: after fully and uniformly mixing Glutathione-Sepharose TM4B medium, adding 2mL of the mixed solution into a chromatographic column with a sieve plate, and washing the column with self-prepared deionized water with 5 times of column volume for three times; washing the column with 5 column volumes of binding buffer for a total of three times; adding the supernatant to a purification medium and binding for 1 hour at 4 ℃; washing the column with 10 column volumes of binding buffer to remove unbound contaminating proteins; and further washing the column with the prepared eluent, and collecting and storing the penetrating liquid to obtain the purified human selenoprotein H.
7. The method for prokaryotic expression and purification of human selenoprotein H according to claim 6, wherein the formula of the binding buffer solution is NaCl 140mmol/L, KCL 2.7mmol/L, Na2HPO4 10mmol/L，KH2PO41.8mmol/L, and the final pH value is adjusted to 9.7;
the formula of the eluent is as follows: 50mmol/L Tris-HCL and 50mmol/L reduced glutathione, and finally adjusting the pH value to 9.7.
8. The method for prokaryotic expression and purification of human selenoprotein H according to claim 6, wherein the method further comprises the step of identifying purified human selenoprotein H by using Western blotting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810567021.XA CN108823230B (en) | 2018-06-05 | 2018-06-05 | Prokaryotic expression purification method of human selenoprotein H |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810567021.XA CN108823230B (en) | 2018-06-05 | 2018-06-05 | Prokaryotic expression purification method of human selenoprotein H |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108823230A CN108823230A (en) | 2018-11-16 |
| CN108823230B true CN108823230B (en) | 2022-03-18 |
Family
ID=64143716
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810567021.XA Active CN108823230B (en) | 2018-06-05 | 2018-06-05 | Prokaryotic expression purification method of human selenoprotein H |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108823230B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109957575A (en) * | 2019-04-09 | 2019-07-02 | 扬州大学 | A kind of preparation method of goat capripoxvirus p32 soluble protein |
| CN112641947B (en) * | 2019-10-11 | 2023-02-03 | 沈阳福洋医药科技有限公司 | Screening target spot, application and screening method of anti-tumor drug |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1314469A (en) * | 2000-03-20 | 2001-09-26 | 北京市营养源研究所 | purifying method recombined human se-protein p gene express and its special primer and culture medium |
| CN107884587A (en) * | 2017-12-18 | 2018-04-06 | 温州医科大学 | A kind of screening of micromolecular inhibitor that can suppress Infection of Toxoplasma Gondii propagation and application process |
-
2018
- 2018-06-05 CN CN201810567021.XA patent/CN108823230B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1314469A (en) * | 2000-03-20 | 2001-09-26 | 北京市营养源研究所 | purifying method recombined human se-protein p gene express and its special primer and culture medium |
| CN107884587A (en) * | 2017-12-18 | 2018-04-06 | 温州医科大学 | A kind of screening of micromolecular inhibitor that can suppress Infection of Toxoplasma Gondii propagation and application process |
Non-Patent Citations (4)
| Title |
|---|
| Selenoprotein H is a nucleolar thioredoxin-like protein with a unique expression pattern;Novoselov SV等;《JOURNAL OF BIOLOGICAL CHEMISTRY》;20070420;第282卷(第16期);第11960-11968页 * |
| 猪硒蛋白基因TrxR2和SelH的克隆、表达及抗体制备;吴丕宏;《中国优秀硕士学位论文全文数据库 农业科技辑》;20120415(第4期);第D050-107页 * |
| 登录号：NM_001321335.1;Cox AG等;《GenBank》;20180509;第1-1428位 * |
| 登录号：NM_170746.3;Cox AG等;《GenBank》;20180509;第1-1448位 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108823230A (en) | 2018-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EA200701023A1 (en) | SELECTION OF HOSPITAL CELLS EXPRESSING PROTEINS AT HIGH LEVELS | |
| CN108823230B (en) | Prokaryotic expression purification method of human selenoprotein H | |
| CN114276445B (en) | Rotavirus recombinant protein specific antibody, plasmid vector and method | |
| CN100432230C (en) | Fusion expression method for metallothionein and use thereof | |
| KR101373297B1 (en) | Expression Vector Comprising Gene coding for E. coli Phosphoglycerate kinase As a Novel Fusion Partner | |
| CN116716329A (en) | Preparation method of unlabeled wild BKV VP1 protein | |
| CN108300725B (en) | Soluble single-chain antibody superantigen fusion gene and protein, and preparation and application thereof | |
| JP5540367B2 (en) | Chaperonin mutant and DNA encoding the same | |
| Shteiman-Kotler et al. | RNA-binding characteristics of the chloroplast S1-like ribosomal protein CS1 | |
| EP1981978B1 (en) | Affinity polypeptide for purification of recombinant proteins | |
| JP2008193923A (en) | Protein library | |
| JPH06311884A (en) | Plasmid and escherichia coli transformed with the same | |
| Chandrasekaran et al. | Expression, purification and characterization of individual bromodomains from human Polybromo-1 | |
| Saffari et al. | An efficient method for recombinant production of human alpha synuclein in Escherichia coli using thioredoxin as a fusion partner | |
| CN114921449B (en) | Preparation method of cathepsin K | |
| CN116773811B (en) | Application of BRCA2 truncated protein in lung cancer screening | |
| CN114195876B (en) | Truncated protein of fibronectin 1 and application thereof | |
| JP5645155B2 (en) | Molecular weight marker and method for producing molecular weight marker | |
| WO1990004026A1 (en) | New plasmid constructions for high level production of eukaryotic proteins | |
| JP2002218980A (en) | New ferritin | |
| CN118127027A (en) | CYFRA21-1-A sequence and application thereof | |
| WO2021026854A1 (en) | Method for selective hydrazide modification on c terminus of enzyme-catalyzed protein | |
| CN116063571A (en) | Preparation method and application of recombinant SSB antigen | |
| Callis et al. | Preparation, characterization, and use of tagged ubiquitins | |
| CN114891819A (en) | Preparation method and application of porcine beta-defensin 129 protein and polyclonal antibody thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |