CN108795979A - The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter - Google Patents
The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter Download PDFInfo
- Publication number
- CN108795979A CN108795979A CN201810757800.6A CN201810757800A CN108795979A CN 108795979 A CN108795979 A CN 108795979A CN 201810757800 A CN201810757800 A CN 201810757800A CN 108795979 A CN108795979 A CN 108795979A
- Authority
- CN
- China
- Prior art keywords
- ga20ox
- poplar
- transgenic
- willow
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8255—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The method that the present invention relates to the use of glycosyl transferase 8D1 promoters driving GA20ox improvement lignocellulosic utilization rates changes poplar lignin structure composition using the specific expressed glycosyl transferase 8D1 promoters driving gibberellin oxidizing ferment GA20ox gene overexpressions of xylem；Wherein, the recombinant vector of GA20ox gene overexpressions is driven by obtaining the specifically expressed promoter 8D1P in willow stalk xylem, and the recombinant vector is used for the genetic transformation of willow, obtains 8D1P:GA20ox transgenic poplars, achieve the purpose that Wood property improvement；The Wood property improvement of the transgenic poplar is presented as that Biomass of Poplar increases, the S/G ratios in lignin improve, and so as to improve cellulase hydrolysis efficiency, and then improves pulping and paper-making lignocellulosic utilization rate.
Description
Technical field
The present invention relates to genetic engineering fields, more particularly to a kind of red mould using the driving of glycosyl transferase 8D1 promoters
The method that plain synthetic gene GA20ox is overexpressed improvement lignocellulosic utilization rate.
Background technology
Lignocellulosic is the maximum renewable resource of quantity on the earth, by lignin, hemicellulose and cellulose three
The anti-degradation barrier action of generation of combining closely be major obstacle of the cellulose as using energy source, and it is wooden in cell wall
Element is a pulp and paper industry principal element of high cost with production bio-ethanol.Lignin is by p-hydroxyphenyl (H), guaiaci lignum
Base (G) and lilac base (S) these three structural units composition.If developed by genetic engineering regulation trees physiological growth, change
Become the content and constituent structure (improving S/G ratios) of lignin in plant, it will to raw material delignification efficiency and subsequent slurry
Bleaching process has an important influence on, and plays the role of improving wood-cellulose transformation efficiency and reduces conversion cost.
Willow is a kind of xylophyta, and China's poplar resource is abundant, is one of the important reproducting tree species cultivated extensively.As
A kind of distribution is extensive, adaptive faculty is strong, fast growing, asexual multiplication ability are strong and the clear seeds of genetic background, willow from
However so become the first choice of Forest Biomass Energy research.Become biomass because wood raw material contains abundant secondary wall
The main source of the energy.During constantly growing tall with tree, the constantly movable result of micro-pipe forming layer of willow leads to trunk
Also continuous thickening therewith.The cell that micro-pipe forming layer is generated to the inside generates two types that there is secondary wall to thicken by differentiation
Type cell：Conduit and fibrocyte.Fibrocyte and conduit play mechanical support in wood material, while conduit plays fortune
The effect of water delivery point.Cellulose, hemicellulose and lignin are the main ingredient of its secondary wall thickeied.Lignocellulosic
Effectively hydrolyzing is that Forest Biomass Energy rationally utilizes primary technical barrier to be solved, and cellulose resource is caused to be difficult to effectively
Therefore the main obstacle utilized, which is protective effect of the lignin component to cellulose macromolecule structure, reasonably to be reduced wooden
Cellulose content changes the raising that lignin component structure is beneficial to the effective degradation and sugared transformation efficiency of cellulose.
Gibberellin is by influencing cell division come regulating plant growth and development, including stem elongation and wood formation etc., so
And shortcoming is compared in the research for how influencing wood formation and material about the route of synthesis of gibberellin at present.Gibberellin oxidizing ferment base
Because GA20ox is the key regulator of gibberellin metabolic pathway, technique for gene engineering poplar adjusted and controlled gibberellin synthesis way is utilized
Diameter is still in the exploratory stage at present on the research that Wood Properties Within influences.
The correlative study that forefathers influence trees material in gibberellin synthetic gene is relatively limited, although to the work(of GA20ox
Certain research can have been carried out, it is found that being overexpressed transgenic poplar stem cross section to GA20ox shows that wood radiaftive rays is significantly increased,
Tracheid's width increases by 130%, can speculate that xylem thickening may promote due to xylem differentiation, shows that GA20ox is expressed
Increase can stimulate Cambial activation to generate more xylems (Hyung-Woo Jeon et al., 2016).But for GA20ox
How gene, which influences wood components structure, is not studied.Separately some researches show that overexpression gibberellin synthetic gene can be significantly
Improve the biomass (Peng Xiaopeng etc., 2010) of crop and xylophyta.
Therefore, using gene regulation willow gibberellin route of synthesis be one cultivation Wood properies improvement willow new lines can
Capable and effective technological approaches, and have broad application prospects.
Invention content
The purpose of the present invention is propose that a kind of utilization glycosyl transferase 8D1 promoters driving GA20ox changes regarding to the issue above
The method of good lignocellulosic utilization rate.
To achieve the above object, wooden the present invention provides being improved using glycosyl transferase 8D1 promoters driving GA20ox
The method of cellulose utilization rate drives gibberellin oxygen including the use of the specific expressed glycosyl transferase 8D1 promoters of xylem
Change the constituent structure that enzyme GA20ox gene overexpressions change poplar lignin.
Preferably, the willow is 84K silver gland poplars (P.alba × P.glandulossa).
Wherein, by obtaining the specifically expressed promoter 8D1P in stalk xylem, driving GA20ox genes cross scale
The recombinant vector reached is used for agriculture bacillus mediated 84K poplar genetic transformations, obtains the 8D1P of Wood property improvement:GA20ox turns base
Because of 84K willows, to achieve the purpose that Wood property improvement；
The Wood property improvement of the transgenic poplar is presented as that Biomass of Poplar increases, lignin structure changes,
S/G ratios increase.
Preferably, it is overexpressed transgenic poplar plant relative to control type biomass to increase, the S/G in cell wall lignin
Increase, is increased to by the 2.3 of 84K control type plant and is overexpressed the 2.6 of transgenic poplar plant.
Preferably, it is overexpressed transgenic poplar plant relative to β-O-4 keys in control type to increase, β-O-4 keys are compareed by 84K
The 47.8/100Ar of type plant increases to the 53.2/100Ar for being overexpressed transgenic poplar plant.
Preferably, the glycosyl transferase 8D1 promoters pass through the specifically overexpression in willow xylem
GA20ox promotes the synthesis of gibberellin (GA3, GA9) and isopentennyladenine (IP), to influence growth of poplar, and improved wood
Material structure.
The present invention also provides a kind of methods of the transgenic poplar of cultivation lignocellulosic utilization rate improvement comprising：
A, the expression cassette of glycosyl transferase 8D1 promoters and gibberellin oxidizing ferment GA20ox genes is obtained, and builds recombination
Carrier；
B, the recombinant vector is transferred to willow, obtains 8D1P:GA20ox transgenic poplars.
Preferably, the method for the transgenic poplar of cultivation lignocellulosic utilization rate improvement includes：
A, it obtains and contains 8D1P:The recombinant vector of GA20ox expression casettes；
B, it chooses the good poplar leaf of growth conditions to be put into differential medium, preculture is carried out under dark condition；
C, the recombinant vector is infected by conversion and is transferred in the poplar leaf, obtain 8D1P:GA20ox transgenosis
Willow plant.
It is highly preferred that cultivating the 8D1P:The step of GA20ox transgenosis 84K willows includes：
A, extraction arabidopsis stem extracts total serum IgE, and divides the sequence information and characteristic of arabidopsis GA20ox genes
Analysis, determines the expression pattern of GA20ox genes；
B, GA20ox gene overexpression carriers are built, GA20ox full length gene cDNA forward directions are connected to pBI121-
In PtrGT8D1P carriers, the plant over-express vector containing GA20ox genes is obtained after sequencing is correct；
C, it chooses growth 4 weeks or so and 84K poplar blades in good condition is put into differential medium dark preculture 3 days,
GA20ox over-express vectors are transferred to Agrobacterium GV3101, is prepared into and infects liquid (OD600=1.0~1.3)；
D, using being put back in former culture medium with infecting after liquid infects 84K poplar blades, screening is gone to after dark co-cultures 4 days
In culture medium, 1 subculture is changed within every 15 days, wait for that visible bud occurs, then leaf dish is gone to bud elongation medium, bud is grown to 1~2cm
When be transferred to root media root induction, obtain 8D1P:GA20ox transgenosis 84K willows.
Based on the above-mentioned technical proposal, it is an advantage of the invention that：
The present invention is passed through using the glycosyl transferase 8D1 promoters driving GA20ox methods for improveing lignocellulosic utilization rate
Gibberellin synthesis regulation changes the correlation with Wood Properties Within, and parsing gibberellin synthesis specific gene GA20ox gives birth in xylem
Effect long, in wood formation is woods explicitly by the feasibility of regulation and control GA20ox expression transformation willow material and component structure
The wooden Wood properies improvement and pulping and paper-making production application research developing new approaches.
The present invention drives GA20ox gene mistakes from specifically expressed promoter (8D1P) in stalk xylem is obtained in willow
Amount expression.Specifically, by the genetic transformation of agriculture bacillus mediated 84K willows, 8D1P is obtained:GA20ox transgenosis 84K poplars
Tree.The transfer-gen plant is taller and bigger relative to control type, and biomass is more, while the S/G ratios in cell wall lignin increase
Height, while β-O-4 keys increase, and have larger researching value and application potential.
Description of the drawings
Attached drawing described herein is used to provide further understanding of the present invention, and is constituted part of this application, this hair
Bright illustrative embodiments and their description are not constituted improper limitations of the present invention for explaining the present invention.In the accompanying drawings：
Fig. 1 a are the co-cultivation figure of willow leaf disk method genetic transformation；
Fig. 1 b are the callus induced map of willow leaf disk method genetic transformation；
Fig. 1 c are the screening figure (amplification) of the resistant buds of willow leaf disk method genetic transformation；
Fig. 1 d are the screening figure of the resistant buds of willow leaf disk method genetic transformation；
Fig. 1 e are the culture of rootage figure of the resistant buds of willow leaf disk method genetic transformation；
Fig. 2 is that qRT-PCR provided in an embodiment of the present invention analyzes expression signals of the GA20ox in transgenic poplar
Figure；
Fig. 3 a are the plant height photo provided in an embodiment of the present invention for being overexpressed GA20ox transgenosis 84K and compareing；
Fig. 3 b are the plant height contrast schematic diagram provided in an embodiment of the present invention for being overexpressed GA20ox transgenosis 84K and compareing；
Fig. 4 a are the gibberellin GA3 hormone-content figures that GA20ox is overexpressed transgenosis 84K and the type that compares；
Fig. 4 b are the gibberellin GA9 hormone-content figures that GA20ox is overexpressed transgenosis 84K and the type that compares；
Fig. 4 c are the isopentennyladenine IP hormone-content figures that GA20ox is overexpressed transgenosis 84K and the type that compares；
Fig. 5 is the lignin structure two-dimensional nucleus magnetic chart that GA20ox is overexpressed transgenosis 84K and the type that compares.
Specific implementation mode
Below by drawings and examples, technical scheme of the present invention will be described in further detail.
The present invention provides a kind of lignocellulosic utilization rate is improved using glycosyl transferase 8D1 promoters driving GA20ox
Method, with poplar adjusted and controlled wood components structure improve cellulase hydrolysis saccharification efficiency.Tree lignin structure and wooden
Plain monomer S/G ratios are to influence cellulose utilization rate and the important indicator of pulping and paper-making, specifically expressed by using xylem
Glycosyl transferase 8D1 (Glycosyltransferase 8D1, GT8D1) gene promoter overexpression gibberellin oxidizing ferment
It is to improve cellulase hydrolysis efficiency, improve pulping and paper-making utilization that GA20ox gene alteration poplar lignin structures, which improve S/G ratios,
One of effective way.
The GA20ox genes are a key genes in gibberellin synthesis, and the promoter of the GT8D1 genes is wood
Lignin structure can be changed in matter portion expression specificity promoter, and fiber utilization rate is low in being produced for solution and improves pulping and paper-making
The problem of application develops new way, and then shortens its breeding cycle.
The GA20ox genes that the present invention is cloned from arabidopsis are expressed by specific regulatory GA20ox in wood,
Willow material and structure is transformed, is the new think of of genetic breeding research developing of forest Wood properies improvement and biomass energy type willow
Road is with a wide range of applications and great economic value.
The present invention provides the sides that lignocellulosic utilization rate is improved using glycosyl transferase 8D1 promoters driving GA20ox
Method, it is excessive including the use of the specifically expressed glycosyl transferase 8D1 promoters driving gibberellin oxidizing ferment GA20ox genes of xylem
Expression changes poplar lignin structure.
Preferably, the willow is 84K silver gland poplars (P.alba × P.glandulossa).
Wherein, GA20ox overexpressions are driven by obtaining the specifically expressed promoter 8D1P in willow stalk xylem
Recombinant vector, and by the recombinant vector be used for agriculture bacillus mediated 84K willow genetic transformations, obtain Wood property improvement
8D1P:GA20ox transgenosis 84K willows；
The Wood property improvement of the transgenic poplar is presented as that Biomass of Poplar increases, the S/G ratios in lignin carry
It is high.
Preferably, it is overexpressed transgenic poplar plant relative comparison type biomass to increase, the S/G in cell wall lignin increases
Height is increased to by the 2.3 of 84K control type plant and is overexpressed the 2.6 of transgenic poplar plant.Preferably, it is overexpressed transgenosis poplar
β-O-4 keys increase in tree plant relative comparison type, and β-O-4 keys increase to overexpression by the 47.8/100Ar of 84K control type plant
The 53.2/100Ar of transgenic poplar plant.
Further, glycosyl transferase 8D1 promoters driving GA20ox passes through the specifically mistake in willow xylem
Amount expression GA20ox adjusts gibberellin (GA3, GA9) and the synthesis of isopentennyladenine (IP) promotes growth of poplar, and changes wood
Material material structure.
The present invention also provides a kind of methods of the transgenic poplar of cultivation lignocellulosic utilization rate improvement comprising：
A, the expression cassette of glycosyl transferase 8D1 promoters and gibberellin oxidizing ferment GA20ox genes is obtained, and builds recombinant vector；B, will
The recombinant vector is transferred to willow, obtains 8D1P:GA20ox transgenic poplars.
Preferably, the method for the transgenic poplar of cultivation lignocellulosic utilization rate improvement includes：
A, it obtains and contains 8D1P:The recombinant vector of GA20ox expression casettes；
B, it chooses the good poplar leaf of growth conditions to be put into differential medium, preculture is carried out under dark condition；
C, the recombinant vector is infected by conversion and is transferred in the poplar leaf, obtain 8D1P:GA20ox transgenosis
Willow plant.
Further, the 8D1P is cultivated:The step of GA20ox transgenic poplars includes：
A, it takes arabidopsis stem to extract total serum IgE, and the sequence information of arabidopsis GA20ox genes is analyzed with characteristic,
Determine the expression pattern of GA20ox genes；
B, GA20ox gene overexpression carriers are built, GA20ox full length gene cDNA forward directions are connected to pBI121-
In PtrGT8D1P carriers, the plant over-express vector containing GA20ox genes is obtained after sequencing is correct；
C, it chooses growth 4 weeks or so and 84K poplar blades in good condition is put into differential medium dark preculture 3 days,
GA20ox over-express vectors are transferred to Agrobacterium GV3101, is prepared into and infects liquid；
D, using being put back in former culture medium with infecting after liquid infects 84K poplar blades, screening is gone to after dark co-cultures 4 days
In culture medium, 1 subculture is changed within every 15 days, wait for that visible bud occurs, then leaf dish is gone to bud elongation medium, bud is grown to 1~2cm
When be transferred to root media root induction, obtain 8D1P:GA20ox transgenosis 84K willows.
Embodiment 1
GA20ox is driven to improve lignocellulosic profit using glycosyl transferase 8D1 promoters to further illustrate the present invention
With the method for rate, 8D1P will be prepared by genetic engineering:Specific method and the data explanation of GA20ox transgenosis 84K willows are such as
Under：
Involved drug is tested in the present embodiment 1 is purchased from Sigma companies, Fermentas companies, Thermo
Fisher companies, Shanghai Sangon Biotech Company.
The molecular cloning of GA20ox genes
1. extraction arabidopsis stem extracts its total serum IgE, the full-length cDNA of GA20ox genes is expanded using RT-PCR technology, it will
It is sequenced, and sequence is referring to SEQ ID No.1.Amplification condition is：95 DEG C of 5min pre-degenerations；94 DEG C of 30s, 55 DEG C of 40s, 72 DEG C
1min completes 35 cycles；72 DEG C of 8min segments extend again.Amplimer is：
ArGA2OF:TGCAGGATCCATGGCCGTAAGTTTCGTAAC
ArGA2OR:TGCAGAGCTC TTAGATGGGTTTGGTGAGCC2。
SEQIDNo.1：
M13R:
(a) sequence signature：
Length：1134bp
Type：Base sequence
Chain：Double-strand
Topological structure：Linearly
(b) molecule type：DNA
(c) assume：It is no
(d) antisense：It is no
(e) initial source：Arabidopsis
To the sequence information and specificity analysis of arabidopsis GA20ox genes：GA20ox genes include the code area of 1134bp
(referring to SEQ ID No.1), the molecular weight for encoding albumen are 43kDa, and there are one the morphine N being made of about 100 amino acid for N-terminal
End synthesis dioxygenase superfamily conserved domain (non-haem dioxygenase in morphine synthesis N-
Terminal), it is typical 2- oxygen glutaric acid (2OG) and Fe (II) dependent form oxygenase superfamily proteins albumen (2-
oxoglutarate(2OG)and Fe(II)-dependent oxygenase superfamily protein)。
2.GA20ox the expression pattern analysis of gene
Its total serum IgE is extracted, RNA reverse transcriptions are obtained into the first chain cDNA, with GA20oxPCRF/R (5 '-
GGACGCTTCTCCACCAAGCT-3'；5 '-GTCCCAACGCATCGCAGAAG-3 ') it is primer, it is detected using qRT-PCR methods
Willow GA20ox genes organized at this six in expression.Amplification condition is：95 DEG C of 3min pre-degenerations；94 DEG C of 10s, 56 DEG C
20s, 72 DEG C of 20s complete 35 cycles；72 DEG C of 5min segments extend again.
Internal reference is used as using willow 18SrRNA genes, the results showed that GA20ox genes great expression in the xylem of stem.
By conversion, GA20ox specifically expressed transgenosis in xylem is driven using glycosyl transferase 8D1 promoters
The incubation step of willow includes：
1. building GA20ox gene overexpression carriers
GA20ox full length gene cDNA forward directions are connected in pBI121-PtrGT8D1P carriers, are contained after sequencing is correct
There is the plant over-express vector of GA20ox genes.
2. agrobacterium mediation converted willow
Growth 4 weeks or so and 84K poplar blades in good condition are chosen, master pulse and limb edge is removed, is cut into size one
The leaf dish of cause, is put into differential medium dark preculture 3 days.Meanwhile GA20ox over-express vectors are transferred to Agrobacterium
GV3101,28 DEG C of cultures are prepared into OD600=1.0~1.3 and infect liquid.It is infected what the leaf dish immersion after pre- training prepared
20min is infected in liquid, during which constantly shaking makes leaf dish be come into full contact with bacterium solution；It takes out leaf dish and blots extra bacterium with aseptic filter paper
Liquid is put back in former culture medium, and dark goes to screening and culturing medium (MS+0.5mg/lKT+1mg/l2,4-D+1mg/ after co-culturing 4 days
LHyg in)；It changes 1 subculture within every 15 days, waits for that visible bud occurs, then leaf dish is gone to bud elongation medium (MS+0.02mg/
LTDE+2mg/lHyg), it is transferred to root media (MS+2mg/lHyg) root induction when bud is grown to 1~2cm, process such as Fig. 1 a~
Shown in Fig. 1 e.
3. transfer-gen plant Molecular Identification
The candidate transgenic poplar blade for taking growth 1 month, its total serum IgE is extracted in liquid nitrogen using CTAB methods, is used
DNAaseI (Sigma companies) removes the genomic DNA that may be polluted, and then utilizes reverse transcription reagent box (Fermentas companies)
Reverse transcription is at the first chain cDNA.Using GA20oxPCRF/R as primer, it is (wild relative to adjoining tree to detect it using qRT-PCR methods
Raw type 84K) expression.Amplification condition is：95 DEG C of 3min pre-degenerations；94 DEG C of 10s, 60 DEG C of 20s, 72 DEG C of 20s complete 40
Cycle；72 DEG C of 5min segments extend again.
Internal reference is used as using GA20ox genes, the results are shown in Figure 2, and GA20ox genes are in 3 representative overexpression strains
In expression quantity than compare it is high, show these strains be strictly GA20ox be overexpressed transgenic line.Wherein, GT8D1P:
GA20ox-7, -16, -17 be transgenosis 84K willows, and 18S rRNA genes are used as internal reference.
4. hot-house culture 4 months, as shown in Figure 3a, 3b, GA20ox overexpression plant are tall and big compared to control 84K, growth
Promoted, stalk gets higher, is thicker, and biomass increases.
5. pair transgenic line carries out hormone-content measurement, as shown in Fig. 4 a, Fig. 4 b, Fig. 4 c, find compared with CK is compareed,
The IP isopentennyladenines of three strains of xylem-specific promoter 8D gene gibberellin oxidizing ferment overexpression transgenic poplar,
Gibberellin GA3 and gibberellin GA9 contents increase.
6. a pair transgenic poplar lignin extracts analysis, as shown in figure 5, by two-dimensional nucleus magnetic chart, can be explained following
Several points：β-O-4, β-β, β -5, β -1, the connecting keys such as benzyl ehter bond (BE) are found that in the willow of transgenosis and control group；Turn
The S/G ratios of gene willow increase and (are increased to the 2.6 of transgenosis by the 2.3 of 84K controls), while β-O-4 connection linkage contents
Rise (rising to 53.2/100Ar from 47.8/100Ar).
Above-mentioned variation is beneficial to the removing of lignin, to improve cellulase hydrolysis saccharification efficiency, improves wood fibre
Plain utilization rate.There are para hydroxybenzene methyl esters unit (PB), the content phase of the unit in the positions side chain γ in lignin in transgenosis poplar
Control is risen；The lignin link unit β -5 connection linkage content transgenosis 84K relative comparisons that G type units are constituted have drop
It is low, further illustrate the relative reduction of G types unit in lignin monomer.
The present invention drives GA20ox gene mistakes from specifically expressed promoter (8D1P) in stalk xylem is obtained in willow
The carrier of expression is measured, agriculture bacillus mediated 84K poplar genetic transformations is used for, obtains 8D1P:GA20ox transgenosis 84K poplars.It is overexpressed
Transfer-gen plant relative comparison type is tall and big, and the S/G in cell wall lignin increases, and is increased to and is turned by the 2.3 of 84K control type plant
The 2.6 of gene willow；β-O-4 keys are more simultaneously, and β-O-4 increase to transgenosis poplar by the 47.8/100Ar of 84K control type plant
The 53.2/100Ar of tree, with larger researching value and application potential.
Finally it should be noted that:The above embodiments are merely illustrative of the technical scheme of the present invention and are not intended to be limiting thereof；To the greatest extent
The present invention is described in detail with reference to preferred embodiments for pipe, those of ordinary skills in the art should understand that：Still
It can modify to the specific implementation mode of the present invention or equivalent replacement is carried out to some technical characteristics；Without departing from this hair
The spirit of bright technical solution should all cover within the scope of the technical scheme claimed by the invention.
Claims (9)
1. using the method for glycosyl transferase 8D1 promoters driving GA20ox improvement lignocellulosic utilization rates, including the use of wood
The specific expressed glycosyl transferase 8D1 promoters driving gibberellin oxidizing ferment GA20ox gene overexpressions in matter portion change willow
Lignin structure forms.
2. the method according to claim 1, it is characterised in that：The willow is 84K silver gland poplars.
3. method according to claim 1 or 2, including by obtaining the special table in willow stalk xylem
The recombinant vector of the promoter 8D1P driving GA20ox gene overexpressions reached, and the heredity by recombinant vector for 84K willows
Conversion, obtains the 8D1P of Wood property improvement:GA20ox transgenic poplars；
The Wood property improvement of the transgenic poplar is presented as that Biomass of Poplar increases, the S/G ratios in lignin increase.
4. according to the method described in claim 2, it is characterized in that：It is overexpressed transgenic poplar plant relative comparison type biomass
Increase, the S/G in cell wall lignin is increased, and is increased to by the 2.3 of 84K control type plant and is overexpressed transgenic poplar plant
2.6。
5. according to the method described in claim 2, it is characterized in that：It is overexpressed β-O- in transgenic poplar plant relative comparison type
4 keys increase, and β-O-4 keys are increased to by the 47.8/100Ar of 84K control type plant is overexpressed the 53.2/ of transgenic poplar plant
100Ar。
6. according to the method described in claim 2, it is characterized in that：The glycosyl transferase 8D1 promoters pass through in willow wood
Specifically overexpression GA20ox adjusts gibberellin (GA3, GA9) in matter portion and the synthesis of isopentennyladenine (IP) promotes poplar
Tree growth, and change Wood Properties Within structure.
7. a kind of method of transgenic poplar that cultivating the improvement of lignocellulosic utilization rate comprising：
A, the expression cassette of glycosyl transferase 8D1 promoters and gibberellin oxidizing ferment GA20ox genes is obtained, and builds recombinant vector；
B, the recombinant vector is transferred to willow, obtains 8D1P:GA20ox transgenic poplars.
8. according to the method described in claim 7, including：
A, it obtains and contains 8D1P:The recombinant vector of GA20ox expression casettes；
B, it chooses the good poplar leaf of growth conditions to be put into differential medium, preculture is carried out under dark condition；
C, the recombinant vector is infected by conversion and is transferred in the poplar leaf, obtain 8D1P:GA20ox transgenic poplars
Plant.
9. according to the method described in claim 8, it is characterized in that：Cultivate the 8D1P:The step of GA20ox transgenic poplars
Including：
A, it takes arabidopsis stem to extract total serum IgE, and the sequence information of arabidopsis GA20ox genes is analyzed with characteristic, determine
The expression pattern of GA20ox genes；
B, GA20ox gene overexpression carriers are built, GA20ox full length gene cDNA forward directions are connected to pBI121-PtrGT8D1P
In carrier, the plant over-express vector containing GA20ox genes is obtained after sequencing is correct；
C, it chooses growth 4 weeks or so and 84K poplar blades in good condition is put into differential medium dark preculture 3 days, it will
GA20ox over-express vectors are transferred to Agrobacterium GV3101, are prepared into and infect liquid；
D, using being put back in former culture medium with infecting after liquid infects 84K poplar blades, screening and culturing is gone to after dark co-cultures 4 days
In base, 1 subculture being changed within every 15 days, waiting for that visible bud occurs, then leaf dish is gone to bud elongation medium, bud, which is grown to when 1~2cm, to be turned
Enter root media root induction, obtains 8D1P:GA20ox transgenosis 84K willows.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810757800.6A CN108795979A (en) | 2018-07-11 | 2018-07-11 | The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810757800.6A CN108795979A (en) | 2018-07-11 | 2018-07-11 | The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108795979A true CN108795979A (en) | 2018-11-13 |
Family
ID=64076070
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810757800.6A Pending CN108795979A (en) | 2018-07-11 | 2018-07-11 | The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108795979A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113430211A (en) * | 2021-07-07 | 2021-09-24 | 浙江农林大学 | Phyllostachys pubescens high growth related gene PeGA20ox1 and application thereof |
| CN114277054A (en) * | 2022-01-19 | 2022-04-05 | 中国林业科学研究院 | Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1416468A (en) * | 2000-03-07 | 2003-05-07 | 瑞典树木基因改良公司 | Transgenic trees exhibiting increased growth, biomass prodn. and xylem fibre length, and methods for their prodn |
| CN101984064A (en) * | 2010-03-22 | 2011-03-09 | 湖南大学 | Method for lowering plant lignin content by genetic transformation |
| CN103014031A (en) * | 2013-01-17 | 2013-04-03 | 东北林业大学 | White birch GA20o*1 gene BpGA20o*1 and application thereof |
-
2018
- 2018-07-11 CN CN201810757800.6A patent/CN108795979A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1416468A (en) * | 2000-03-07 | 2003-05-07 | 瑞典树木基因改良公司 | Transgenic trees exhibiting increased growth, biomass prodn. and xylem fibre length, and methods for their prodn |
| CN101984064A (en) * | 2010-03-22 | 2011-03-09 | 湖南大学 | Method for lowering plant lignin content by genetic transformation |
| CN103014031A (en) * | 2013-01-17 | 2013-04-03 | 东北林业大学 | White birch GA20o*1 gene BpGA20o*1 and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| MARIA E. ERIKSSON ET AL.: "Increased gibberellin biosynthesis in transgenic trees promotes growth, biomass production and xylem fiber length", 《NATURE BIOTECHNOLOGY》 * |
| MARIA ISRAELSSON ET AL.: "Changes in gene expression in the wood-forming tissue of transgenic hybrid aspen with increased secondary growth", 《PLANT MOLECULAR BIOLOGY》 * |
| 路静等: "高等植物启动子及其应用研究进展", 《自然科学进展》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113430211A (en) * | 2021-07-07 | 2021-09-24 | 浙江农林大学 | Phyllostachys pubescens high growth related gene PeGA20ox1 and application thereof |
| CN114277054A (en) * | 2022-01-19 | 2022-04-05 | 中国林业科学研究院 | Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhou et al. | Transcription profiles of boron-deficiency-responsive genes in citrus rootstock root by suppression subtractive hybridization and cDNA microarray | |
| CN105683382A (en) | Constructs for expressing transgenes using regulatory elements from brachypodium ubiquitin 1C genes | |
| CN104087597A (en) | Caragana korshinskii Kom. transcription factor CkMYB4 and its gene | |
| Fursova et al. | An efficient method for transient gene expression in monocots applied to modify the Brachypodium distachyon cell wall | |
| CN102409062B (en) | Method for changing content of chlorophyll in plant | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN108795979A (en) | The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter | |
| CN102757487A (en) | Plant dwarfing related protein GA2ox, and encoding gene and application thereof | |
| CN110184293A (en) | A method of increasing phytomass or yield by improving photosynthetic efficiency | |
| CN106591321A (en) | Carya cathayensis auxin efflux carrier protein CcPILS gene cloning and expression analysis method | |
| CN110964740B (en) | Preparation method and application of tobacco with high flavonol content | |
| Nakano et al. | Enhancement of secondary cell wall formation in poplar xylem using a self-reinforced system of secondary cell wall-related transcription factors | |
| Van Beveren et al. | Transformation of cambial tissue in vivo provides an efficient means for induced somatic sector analysis and gene testing in stems of woody plant species | |
| CN105907733B (en) | A kind of Sophora alopecuroide inositol transmethylase and its encoding gene and application | |
| CN108795980A (en) | The method for improveing nano-cellulose characteristic using glycosyl transferase promoter driving GA20ox | |
| CN109384837B (en) | Poplar drought-resistant gene and application thereof | |
| CN104372019B (en) | Turn cultivation, authentication method and the application of CmWRKY48 gene Cut Flower Chrysanthemum Morifoliums | |
| CN104829702B (en) | A kind of rubber tree manipulation of lignin biosynthesis GAP-associated protein GAP HbMYB85 and its encoding gene and application | |
| CN116640195A (en) | Citrus CsPIF4 gene, protein coded by same and application thereof | |
| CN105294846A (en) | Application of CIC1 protein in regulation and control of plant low-temperature resistance | |
| CN103451169B (en) | A kind of regulate and control timber grow related gene and application thereof | |
| KR102113170B1 (en) | Wat1 protein for growth promoting or biomass increasing of plants and uses same | |
| CA2796491A1 (en) | Plants with altered cell wall biosynthesis and methods of use | |
| CN105821041B (en) | It is a kind of regulation timber development related gene and its application | |
| CN110331149A (en) | The method of the application of PagKNAT2/6b gene and poplar adjusted and controlled plant type |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200319 Address after: 100091 No. 2 east mansion, Beijing, Haidian District Applicant after: The Research Institute of Forestry, Chinese Academy of Forestry Address before: 100091 No. 2 east mansion, Beijing, Haidian District Applicant before: CHINESE ACADEMY OF FORESTRY |