CN114277054A - Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter - Google Patents
Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter Download PDFInfo
- Publication number
- CN114277054A CN114277054A CN202210060652.9A CN202210060652A CN114277054A CN 114277054 A CN114277054 A CN 114277054A CN 202210060652 A CN202210060652 A CN 202210060652A CN 114277054 A CN114277054 A CN 114277054A
- Authority
- CN
- China
- Prior art keywords
- ga20ox
- poplar
- paper
- promoter
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for improving paper mechanical properties by utilizing glycosyltransferase promoter to drive GA20ox, which utilizes a glycosyltransferase8D1 promoter with xylem specificity expression to drive gibberellin oxidase GA20ox gene to excessively express so as to change the properties of poplar wood nanocellulose; the 8D1P: GA20ox transgenic poplar is obtained by obtaining a recombinant vector which drives GA20ox gene over-expression by a promoter 8D1P specifically expressed in the xylem of the stem of the poplar, and using the recombinant vector for genetic transformation of the poplar, and the aim of improving the characteristic of the wood nanocellulose is fulfilled; the characteristic improvement of the wood nanocellulose of the transgenic poplar is embodied in that the diameter of the nanocellulose is increased, the specific surface area is increased to increase the hydrogen bonds among fibers as an additive, and the bonding capability of the fibers is improved, so that the mechanical property of the paper is better enhanced. The diameter of the transgenic material nano-cellulose is larger, the mechanical strength of paper fibers can be obviously improved, and the characteristic change can be more beneficial to the application of pulping and papermaking.
Description
Technical Field
The invention relates to the field of pulping and papermaking characteristic improvement, in particular to a method for improving paper mechanical characteristics by driving GA20ox through glycosyltransferase promoter.
Background
Poplar is one of the important afforestation species widely cultivated all over the world, has the characteristics of wide distribution, quick growth, strong asexual reproduction capability and the like, and has the advantages of quick growth, high yield, clear genetic background and the like, and is widely used as a model system for woody plant genetic research. China has abundant poplar resources, and the afforestation area of China is continuously enlarged in recent years, so that the poplar forest is the country with the largest artificial forest area in the world. The silver adenophora clone 84K is widely applied to pulping and papermaking because of fast growth in the seedling emergence stage, easy transformation and good wood quality.
Gibberellins influence cell division to regulate and control plant growth and development, including stem elongation, wood formation and the like, however, studies on how gibberellins influence wood quality traits are deficient at present, and therefore influence on the field of pulping and papermaking applications is relatively deficient. Nanocellulose (NCC) as an additive in papermaking pulps is an effective way to improve the overall performance of paper, especially with the addition of nanocellulose, both paper strength and density are increased. The nano-cellulose as an additive increases hydrogen bonds among fibers by increasing the specific surface area, improves the bonding capacity of the fibers, and further better enhances the mechanical property of paper, so that the diameter of the nano-cellulose is an important index influencing the mechanical property of pulping and papermaking. Gibberellin oxidase gene GA20ox is a key regulation factor of gibberellin metabolic pathway, and studies on influence of genetic engineering technology on wood nanocellulose characteristics by regulating and controlling poplar gibberellin synthetic pathway are reported.
Previous researches on the influence of gibberellin synthetic genes on wood properties of trees are relatively limited, although certain researches on the function of GA20ox are carried out, the cross section of a stem of a transgenic poplar with GA20ox overexpression shows that wood rays are greatly increased, the width of xylem cells is increased by 130%, the fact that the xylem thickening is probably promoted due to xylem differentiation is presumed, the fact that GA20ox expression is increased can stimulate cambium activity to generate more xylem (Hyung-Woo Jeon et al, 2016) is shown, and the effect of GA20ox in wood formation is preliminarily explained. However, there was no study on how the GA20ox gene affects the structure of wood components. And the biotechnology provides an effective way for directionally improving the wood properties.
Therefore, the method utilizes the gene to regulate the synthesis way of the gibberellin of the poplar, drives and regulates the expression of the gibberellin gene through the xylem specific promoter, changes the morphological characteristics of the nano-cellulose, is a bold exploration attempt for improving the mechanical property of paper, and has wide application prospect in the field of pulping and papermaking.
Disclosure of Invention
The invention aims to provide a method for improving the mechanical properties of paper by utilizing a glycosyltransferase promoter to drive GA20ox, wherein a plurality of relatively large pores exist among fibers of a paper product produced by plant fibers, and the mechanical properties of the paper product can be remarkably improved by adding nanocellulose, so that the nanocellulose is a potential paper reinforcing additive. The characteristic of poplar nanocellulose is modified by regulating GA20ox expression, and the diameter of nanocellulose is increased, so that the nanocellulose is used as a paper additive to enhance the mechanical property of paper, and the application of pulping and papermaking is facilitated.
In order to achieve the purpose of the invention, the invention adopts the technical scheme that:
the method for improving the mechanical property of paper by using glycosyl transferase promoter to drive GA20ox is characterized in that the glycosyl transferase8D1 promoter is used to drive gibberellin oxidase GA20ox gene to express excessively to change the nano-cellulose property of poplar wood, and 5% concentration of nano-cellulose is added into bleached pine pulp to serve as a paper additive to improve the mechanical property of paper.
Further: the full-length cDNA of the GA20ox gene is positively connected into a pBI121-PtrGT8D1P vector, and after the sequencing is correct, an overexpression recombinant vector containing the GA20ox gene is obtained; A8D 1P-GA 20ox transgenic poplar with improved nano-cellulose characteristics is obtained by obtaining a recombinant vector for driving GA20ox gene over-expression by a promoter 8D1P specifically expressed in the xylem of the stem of the poplar and applying the recombinant vector to genetic transformation of the poplar.
Further: the diameter of the overexpression transgenic poplar nanocellulose is 100 nm.
Further: the tensile strength of the paper was 71.3Nm/g, the tensile strength was 71.3N, and the burst strength was 255.2 Kpa.
Further: the glycosyltransferase8D1 promoter regulates the synthesis of gibberellin and isopentenyl adenine by specifically over-expressing GA20ox in the xylem of poplar to promote the growth of poplar and change the nano cellulose characteristics of poplar wood.
The invention has the beneficial effects that:
1. according to the invention, a glycosyl transferase8D1 (GT 8D1) gene promoter specifically expressed in xylem is used for driving the gibberellin oxidase GA20ox gene to be overexpressed, the diameter of the nano-fiber is improved, 5% concentration of improved nano-cellulose is added into bleached pine pulp as an additive, and hydrogen bonds among fibers are increased by increasing the specific surface area, so that the fiber binding capacity is improved, and the mechanical property of the paper is obviously enhanced.
2. The promoter of the GT8D1 gene utilized by the invention is a xylem expression specific promoter, can improve the nano cellulose characteristics of trees, increase the diameter of fiber cells, develop a new idea for wood improvement and pulping and papermaking applications, and have wide application prospect and great economic value.
Drawings
FIG. 1 is a schematic diagram of the expression level of GA20ox in transgenic poplar according to the embodiment of the present invention;
FIG. 2 is a graph showing the hormone content of gibberellin GA9 in GA20ox over-expressed transgenic 84K poplar and control plants according to the present invention;
FIG. 3 is a graph showing the hormone content of gibberellin GA34 in GA20ox over-expressed transgenic 84K poplar and control plants according to the present invention;
FIG. 4 is a SEM image of nanocellulose of a control plant (wild type 84K) provided by the examples of the present invention;
FIG. 5 is a nano-cellulose SEM image of GA20ox over-expressed transgenic 84K poplar provided by an embodiment of the invention.
Detailed Description
The following description of the embodiments of the present invention is provided to facilitate the understanding of the present invention by those skilled in the art, but it should be understood that the present invention is not limited to the scope of the embodiments, and it will be apparent to those skilled in the art that various changes may be made without departing from the spirit and scope of the invention as defined and defined in the appended claims, and all matters produced by the invention using the inventive concept are protected.
Examples
The drugs referred to in the tests of this example were purchased from Sigma, Fermentas, Thermo Fisher, Shanghai Biotech.
Molecular cloning of the GA20ox Gene
Total RNA of Arabidopsis stems is extracted, and the full-length cDNA of the GA20ox gene is amplified by using an RT-PCR technology and sequenced (see SEQ ID No. 1). The amplification conditions were: pre-denaturation at 95 ℃ for 5 min; 30s at 94 ℃, 40s at 55 ℃ and 1min at 72 ℃ to finish 35 cycles; fragment extension was then carried out at 72 ℃ for 8 min. The amplification primers are as follows:
ArGA20F:TGCAGGATCC ATGGCCGTAAGTTTCGTAAC
ArGA20R:TGCAGAGCTC TTAGATGGGTTTGGTGAGCC
SEQIDNo.1：
M13R：
(a) sequence characteristics:
length: 1134bp
Type (2): base sequence
Chain type: double chain
Topological structure: linearity
(b) Molecular type: DNA
(c) Suppose that: whether or not
(d) Antisense: whether or not
(e) The initial sources were: arabidopsis thaliana
Sequence information and characterization of the Arabidopsis GA20ox gene: the GA20ox gene contained a 1134bp coding region (see SEQ ID No.1), the molecular weight of the encoded protein was 43kDa, the N-terminus was a non-hale dioxygenase in morphine synthesis N-terminal consisting of about 100 amino acids, and typical 2-oxoglutarate (2OG) and Fe (II) -dependent oxygenase superfamily protein proteins.
Analysis of expression Pattern of GA20ox Gene
Extracting total RNA, reverse transcribing the RNA to obtain first strand cDNA, and detecting the expression of GA20ox gene in six tissues of poplar by using a qRT-PCR method with GA20oxPCRF/R (5'-GGACGCTTCTCCACCAAGCT-3'; 5'-GTCCCAACGCATCGCAGAAG-3') as a primer. The amplification conditions were: pre-denaturation at 95 ℃ for 3 min; completing 35 cycles at 94 ℃ for 10s, 56 ℃ for 20s, and 72 ℃ for 20 s; fragment extension was then performed at 72 ℃ for 5 min.
Using the poplar 18S rRNA gene as an internal control, it was revealed that the GA20ox gene was abundantly expressed in the xylem of the stem.
3. The invention provides a method for improving the mechanical property of paper by using a glycosyltransferase promoter to drive GA20ox, which comprises the following steps:
(1) construction of GA20ox Gene overexpression vector
The full-length cDNA of the GA20ox gene is forward connected to a pBI121-PtrGT8D1P vector, and a plant overexpression vector containing the GA20ox gene is obtained after the sequencing is correct.
(2) Agrobacterium mediated transformation of poplar
And infecting an 84K leaf disc with agrobacterium containing the target gene when OD600 is 0.3-0.8. Single colonies containing the target gene were picked up from the plate in a small amount and inoculated into 3ml of LB liquid medium (Str 25. mu.g/ml, Rif 50. mu.g/ml, Kan 80. mu.g/ml) on a constant temperature shaker at 27 ℃ and 180rpm overnight to an OD600 of 0.6 to 0.8. Transferring the bacteria liquid after being shaken overnight into a newly-prepared LB culture medium without antibiotics according to the mass ratio of 1-2%, culturing for about 6h under the same conditions, and using the bacteria liquid for transformation when OD600 is 0.2-0.5.
On a clean bench, the bacteria solution was poured into a small sterile petri dish. Directly using the tissue culture seedling leaves for genetic transformation, taking young and robust leaves without kanamycin resistance, removing main veins, cutting the leaves into three paths, soaking the leaves in bacterial liquid for 5min, and slightly shaking for 2-3 times. The leaf disks were removed and the attached bacterial solution was aspirated through sterilized filter paper. After the infection with Agrobacterium tumefaciens, the leaves were inoculated on MS medium (SIM, Murashige-Skoog (MS) minimal medium supplemented with 0.5mg/l 6-benzyl aminopurin (6-BA) and 0.05mg/l Naphthalene Acetic Acid (NAA)) without any antibiotic, the dishes were sealed with the sealing film side, and cultured in the dark at 28 ℃ for 3 days. Transferring the leaves after 3 days of co-culture to a kanamycin-resistant screening culture medium, sealing the culture dish with a sealing film, and irradiating at 2000-10000 lux and 28 ℃ and 16/8hd-1Selecting and culturing under photoperiod condition, and gradually differentiating callus on resistant selection medium.
About 20 days or so, the explants start to sprout, then adventitious buds are gradually differentiated from the sprouts, and surrounding leaf tissues are gradually browned and die. When the adventitious bud grows to about 3cm, cutting the adventitious bud, transferring the adventitious bud to a rooting culture medium (RIM, 1/2MS minimal medium added with 0.05mg/L IBA and 0.02mg/LNAA) for inducing rooting, and growing the adventitious root after 5-10 days. Transferring the rooted seedlings to RIMC culture medium (adding 400mg/L Carb in RIM) to culture into strong seedlings, obtaining stable resistant plants, transplanting into sterilized soil, and culturing in greenhouse. Wherein, for the induction of adventitious buds, leaf discs need to be cultured in SIM for 18 days; for adventitious root induction, the stem segments need to be cultured in RIM for 9 days.
(3) Molecular identification of transgenic plants
Taking candidate transgenic poplar leaves growing for 1 month, extracting total RNA of the candidate transgenic poplar leaves in liquid nitrogen by using a CTAB method, removing possibly polluted genomic DNA by using DNAseI (Sigma company), and carrying out reverse transcription to form first-strand cDNA by using a reverse transcription kit (Fermentas company). And (3) detecting the expression level of the gene relative to a control plant (wild 84K) by using a GA20oxPCRF/R as a primer and utilizing a qRT-PCR method. The amplification conditions were: pre-denaturation at 95 ℃ for 3 min; 10s at 94 ℃, 20s at 60 ℃ and 20s at 72 ℃ to complete 40 cycles; fragment extension was then carried out at 72 ℃ for 5 min.
The results using the 18S ribosomal ribonucleic acid (18S rRNA) gene as an internal reference are shown in FIG. 1, where GA20ox gene was expressed in 3 representative over-expressed lines higher than the control, and GT8D1P: GA20ox-7, -16, -17 is a transgenic 84K poplar, indicating that these lines are indeed GA20ox over-expressed transgenic lines.
(4) Hormone content determination of transgenic material
Taking out the biological material sample stored at ultralow temperature, and grinding (30Hz, 1min) to be powder by using a grinder (MM 400, Retsch); 100mg of the ground powder was weighed out and extracted overnight at 4 ℃ with the addition of 1.0ng/g of the isotope internal standard and 1mL of the extract (methanol/water, 80/20, v/v). Centrifuge at 10,000g for 20min at 4 ℃. Washing the C18/SAX solid phase extraction cartridge with 8mL of water and 8mL of methanol respectively; the C18/SAX solid phase extraction cartridge was activated with 8mL of 80% aqueous methanol-water solution (80/20, v/v). The centrifuged supernatant was aspirated and passed through a C18/SAX solid phase extraction column. After loading, the upper C18 solid phase extraction column (1mL, 50mg) was removed and the SAX extraction cartridge (3 mL) was loaded with 2mL methanol/water (20/80, v/v)200mg) and then desorbed with 3ml of a CN/FA (99/1, v/v) the target acid phytohormone retained on the SAX extraction cartridge. The desorption solution was blown dry at 40 ℃ under a constant nitrogen flow and redissolved with 100. mu.L of water. To 100. mu.L of the resulting solution, 10. mu.L of FA was added, followed by extraction with diethyl ether 2 times (2X 1 mL). The organic phases from the 2 extractions were combined, blown dry with nitrogen at room temperature and redissolved in 100. mu.LACN. To the resulting ACN solution, 10. mu.L.times.20. mu. mol/mL of BTA and 10. mu.L.times.20. mu. mol/mL of BTA were added, vortexed at room temperature for 35min, and then blown dry with nitrogen. Finally, 200 mu L of H is used2O/ACN (90/10, v/v) was redissolved for subsequent UPLC-MS/MS (Thermo Scientific Ultimate 3000-Thermo Scientific TSQ Quantiva) analysis.
(5) Extraction of transgenic material nanocellulose
Taking 2g of crude cellulose, and grinding by using a grinder; adding 150mL of distilled water, 1g of sodium hypochlorite and 0.2mL of glacial acetic acid, and stirring in an oil bath at 75 ℃ for 1 h; filtering, taking the upper layer residue, scraping off from the filter paper, placing into a beaker, adding deionized water according to the concentration of the residue of 0.5%, and ultrasonically treating twice with ultrasonic waves for 30min respectively; centrifuging, and taking the supernatant as the nano-cellulose.
As a natural fiber-based nano material, the nano cellulose has good compatibility with paper products, obviously improves the strength and the surface performance of paper, and has very favorable influence on the pulping and papermaking industry. The nano-cellulose of the control group and the transgenic material is extracted and separated by a TEMPO oxidation method, and the analysis by an Atomic Force Microscope (AFM) and a Scanning Electron Microscope (SEM) shows that the diameter of the nano-cellulose is increased to about 100nm from about 40nm of a control group sample, the diameter is increased by about 1.5 times, and the length is shortened, as shown in fig. 4 and 5.
(6) Improving the mechanical properties of paper
TEMPO oxidized nanocellulose, separated from control and transgenic material at 5% concentration, was added to each of the two bleached pine pulps.
The test results show that the tensile strength of the paper after adding the TEMPO oxidized nanocellulose separated by the control group is increased to 64.4Nm/g from 59.9Nm/g without adding, and the tensile strength is further increased to 71.3Nm/g after adding the same amount of transgenic material TEMPO oxidized nanocellulose. The result shows that the carboxyl group generated after the TEMPO oxidation can increase the anion charge quantity of the nano-cellulose, thereby being beneficial to the attachment of the nano-cellulose among fiber structures, reducing gaps and improving the mechanical property of paper. Analysis shows that the TEMPO oxidized nanocellulose separated from the transgenic material has smaller length and wider diameter, is more favorable for entering the internal gaps of a paper fiber network, further improves the tensile strength of paper, and shows the same result on the test results of folding strength and bursting strength: the tensile strength increased from 59.9N without addition to 64.4N (control group) and further to 71.3N (transgenic material); the burst strength increased from 234.5KPa without addition to 241.6KPa (control), and further to 255.2KPa (transgenic material). In contrast, the paper with the control TEMPO oxidized nanocellulose added had the highest elongation at break, mainly because this property is mainly related to fibre length, whereas the length of the isolated TEMPO oxidized nanocellulose in the transgenic material was shorter.
The paper product produced by the plant fiber has a plurality of pores with larger ratio among the fibers, and the mechanical property of the paper can be obviously improved by adding the nano-cellulose, so the nano-cellulose is a potential paper reinforcing additive. Research shows that 1-2% of nano-cellulose addition amount can increase tensile strength of paper by 8g/cm2The addition of 5% TEMPO oxidized nanocellulose increased the yield strength and tensile strength of chemithermomechanical pulp paper by 200% and 20%, respectively. Meanwhile, the morphological characteristics of the nano-cellulose can also have obvious influence on the enhancement effect of the nano-cellulose. The diameter of the fiber of the transgenic material nano-cellulose is larger, so that the mechanical strength of the fiber is improved, the fiber is used as a paper additive to obviously improve the mechanical property of paper, and the characteristic change can be more beneficial to the application of pulping and papermaking.
According to the method for improving the mechanical property of paper by using the Glycosyltransferase promoter to drive GA20ox, the promoter of the Glycosyltransferase8D 1(Glycosyltransferase8D1, GT8D1) gene specifically expressed by xylem is used to drive the overexpression of the gibberellin oxidase GA20ox gene, so that the diameter of the nanofiber is improved, and the method is one of effective ways for improving the utilization of pulping and papermaking.
The invention drives GA20ox gene to be over-expressed by obtaining a promoter (8D1P) specifically expressed in xylem of the stem. Specifically, 8D1P: GA20ox transgenic 84K poplar was obtained by Agrobacterium-mediated genetic transformation of 84K poplar. Compared with CK control, the content of gibberellin GA9 and gibberellin GA34 for driving GA20ox to over-express transgenic poplar by using glycosyltransferase promoter 8D1 is increased. The diameter of the transgenic plant is increased by 1.5 times compared with that of a control plant (wild 84K), and the transgenic plant has a high application value.
According to the invention, TEMPO oxidized nano-cellulose separated by a transgenic material which utilizes a glycosyltransferase8D1 promoter to over-express gibberellin oxidase GA20ox is added into bleached pine pulp at a concentration of 5% as an additive, so that the mechanical properties of the obtained paper are obviously enhanced.
The above examples are only intended to illustrate the technical solution of the present invention and not to limit it; although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art will understand that: modifications to the specific embodiments of the invention or equivalent substitutions for parts of the technical features may be made; without departing from the spirit of the present invention, it is intended to cover all aspects of the invention as defined by the appended claims.
Sequence listing
<110> scientific research institute of forestry in China
Institute of forestry, Chinese Academy of Forestry Sciences
<120> method for improving mechanical properties of paper by driving GA20ox using glycosyltransferase promoter
<141> 2022-01-19
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1134
<212> DNA
<213> Arabidopsis thaliana (Arabidopsis thaliana)
<400> 1
atggccgtaa gtttcgtaac aacatctcct gaggaagaag acaaaccgaa gctaggcctt 60
ggaaatattc aaactccgtt aatcttcaac ccttcaatgc ttaaccttca agccaatatc 120
ccaaaccaat tcatctggcc tgacgacgaa aaaccttcca tcaacgtcct cgagcttgat 180
gttcctctca tcgaccttca aaaccttctc tctgatccat cctccacttt agatgcttcg 240
agactgatct ctgaggcctg taagaagcac ggtttcttcc tcgtggtcaa tcacggcatc 300
agcgaggagc ttatttcaga cgctcatgaa tacacgagcc gcttctttga tatgcctctc 360
tccgaaaaac agagggttct tagaaaatcc ggtgagagtg ttggctacgc aagcagtttc 420
accggacgct tctccaccaa gcttccatgg aaggagaccc tttctttccg gttttgcgac 480
gacatgagcc gctcaaaatc cgttcaagat tacttctgcg atgcgttggg acatgggttt 540
cagccatttg ggaaggtgta tcaagagtat tgtgaagcaa tgagttctct atcactgaag 600
atcatggagc ttctggggct aagtttaggc gtaaaacggg actactttag agagtttttc 660
gaagaaaacg attcaataat gagactgaat tactaccctc catgtataaa accagatctc 720
acactaggaa caggacctca ttgtgatcca acatctctta ccatccttca ccaagaccat 780
gttaatggcc ttcaagtctt tgtggaaaat caatggcgct ccattcgtcc caaccccaag 840
gcctttgtgg tcaatatcgg cgatactttc atggctctat cgaacgatag atacaagagc 900
tgcttgcacc gggcggtggt gaacagcgag agcgagagga aatcacttgc attcttcttg 960
tgtccgaaaa aagacagagt agtgacgcca ccgagagagc ttttggacag catcacatca 1020
agaagatacc ctgacttcac atggtctaag ttccttgagt tcactcagaa acattataga 1080
gcagacatga acactgtcca agccttttca gattggctca ccaaacccat ctaa 1134
<210> 2
<211> 30
<212> DNA
<213> Arabidopsis thaliana (Arabidopsis thaliana)
<400> 2
tgcaggatcc atggccgtaa gtttcgtaac 30
<210> 3
<211> 30
<212> DNA
<213> Arabidopsis thaliana (Arabidopsis thaliana)
<400> 3
tgcagagctc ttagatgggt ttggtgagcc 30
Claims (5)
1. A method for improving the mechanical properties of paper by driving GA20ox with glycosyltransferase promoter, which is characterized in that: the characteristic of the nano-cellulose of poplar wood is changed by using a glycosyltransferase8D1 promoter to drive the gene of gibberellin oxidase GA20ox to express excessively, and the nano-cellulose with the concentration of 5% is added into bleached pine pulp to be used as a paper additive, so that the mechanical property of paper is improved.
2. The method of claim 1, wherein: the full-length cDNA of the GA20ox gene is positively connected into a pBI121-PtrGT8D1P vector, and after the sequencing is correct, an overexpression recombinant vector containing the GA20ox gene is obtained; A8D 1P-GA 20ox transgenic poplar with improved nano-cellulose characteristics is obtained by obtaining a recombinant vector for driving GA20ox gene over-expression by a promoter 8D1P specifically expressed in the xylem of the stem of the poplar and applying the recombinant vector to genetic transformation of the poplar.
3. The method of claim 2, wherein: the diameter of the overexpression transgenic poplar nanocellulose is 100 nm.
4. The method of claim 3, wherein: the paper had a tensile strength of 71.3Nm/g, a tensile strength of 71.3N and a burst strength of 255.2 Kpa.
5. The method of claim 2, wherein: the glycosyltransferase8D1 promoter regulates the synthesis of gibberellins GA9 and GA34 by specifically overexpressing GA20ox in the xylem of poplar and alters the wood nanocellulose properties of poplar.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210060652.9A CN114277054A (en) | 2022-01-19 | 2022-01-19 | Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210060652.9A CN114277054A (en) | 2022-01-19 | 2022-01-19 | Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114277054A true CN114277054A (en) | 2022-04-05 |
Family
ID=80881205
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210060652.9A Pending CN114277054A (en) | 2022-01-19 | 2022-01-19 | Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114277054A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103726379A (en) * | 2014-01-09 | 2014-04-16 | 齐鲁工业大学 | Application of modified nano-microcrystalline cellulose serving as papermaking strengthening agent |
| CN108795980A (en) * | 2018-07-11 | 2018-11-13 | 中国林业科学研究院 | The method for improveing nano-cellulose characteristic using glycosyl transferase promoter driving GA20ox |
| CN108795979A (en) * | 2018-07-11 | 2018-11-13 | 中国林业科学研究院 | The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter |
| CN113638259A (en) * | 2020-04-27 | 2021-11-12 | 中国科学院理化技术研究所 | Application of wood nano-cellulose in enhancing paper wet strength |
-
2022
- 2022-01-19 CN CN202210060652.9A patent/CN114277054A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103726379A (en) * | 2014-01-09 | 2014-04-16 | 齐鲁工业大学 | Application of modified nano-microcrystalline cellulose serving as papermaking strengthening agent |
| CN108795980A (en) * | 2018-07-11 | 2018-11-13 | 中国林业科学研究院 | The method for improveing nano-cellulose characteristic using glycosyl transferase promoter driving GA20ox |
| CN108795979A (en) * | 2018-07-11 | 2018-11-13 | 中国林业科学研究院 | The method for driving GA20ox modified cellulose utilization rates using glycosyl transferase promoter |
| CN113638259A (en) * | 2020-04-27 | 2021-11-12 | 中国科学院理化技术研究所 | Application of wood nano-cellulose in enhancing paper wet strength |
Non-Patent Citations (3)
| Title |
|---|
| 赵永虎等: "纳米纤维素的制备及其对纸张增强作用的研究", 《造纸科学与技术》 * |
| 陈翠: "纳米纤维素作为纸张增强剂的应用", 《国际造纸》 * |
| 魏建华等: "抑制CCoAOMT表达的转基因杨树的制浆性能", 《科学通报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2326527C2 (en) | Potato with increase starch in terms of each plant and method of its cultivation | |
| CA2672756C (en) | Polynucleotides and polypeptides involved in plant fiber development and methods of using same | |
| US5608148A (en) | Transgenic cotton plants producing heterologous peroxidase | |
| CN110904122B (en) | Apple drought-resistant gene MdbHLH130 and application thereof | |
| CN110577960A (en) | pear lignin synthesis gene PbMC1a/1b and application thereof in genetic improvement of fruit quality | |
| CN110184293A (en) | A method of increasing phytomass or yield by improving photosynthetic efficiency | |
| CN105907733B (en) | A kind of Sophora alopecuroide inositol transmethylase and its encoding gene and application | |
| CN114277054A (en) | Method for improving paper mechanical properties by driving GA20ox through glycosyltransferase promoter | |
| CN108795980A (en) | The method for improveing nano-cellulose characteristic using glycosyl transferase promoter driving GA20ox | |
| KR20120055911A (en) | The promoter from Brassica napus and method for using thereof | |
| WO2007019245A2 (en) | Methods for enhancing expression of secondary cell wall cellulose synthases in plants | |
| KR101351265B1 (en) | Method for preparing transgenic alfalfa plant with increased anthocyanin content and the plant thereof | |
| WO1994020606A1 (en) | Plant tissue culture method for taxol production | |
| CN116640775B (en) | Longan DlMYB15 gene capable of enhancing anthocyanin synthesis regulation capability of MBW complex | |
| CN114395566B (en) | Application of sweet potato ERF transcription factor IbERF4 in promoting synthesis of plant chlorogenic acid substances | |
| CN114539373B (en) | IbPIF1 related to sweet potato stem nematode resistance as well as encoding gene and application thereof | |
| JP7097547B2 (en) | Plants with modified cell walls, methods and nucleic acids for obtaining such plants, and methods for producing glucose using such plants. | |
| MX2011001896A (en) | Increasing cell wall deposition and biomass in plants. | |
| CN117512003A (en) | Application of PtoESK1 gene in improving mechanical strength and wood yield of populus tomentosa | |
| CN117106800A (en) | PAP1 gene for cultivating color-leaf poplar and application thereof | |
| AU2013206379B2 (en) | Polynucleotides and Polypeptides Involved in Plant Fiber Development and Methods of Using Same | |
| AU2016202762B2 (en) | Polynucleotides and Polypeptides Involved in Plant Fiber Development and Methods of Using Same | |
| CN117384266A (en) | Poplar fiber secondary wall regulation transcription factor PtoKANT3a, application and method thereof | |
| CN113584055A (en) | Piper PNPAL3 gene and application thereof in resisting pestilence of pepper | |
| CN114736890A (en) | Application of rice chitinase and coding gene thereof in enhancing abiotic stress resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |