CN113430211A

CN113430211A - Phyllostachys pubescens high growth related gene PeGA20ox1 and application thereof

Info

Publication number: CN113430211A
Application number: CN202110769216.4A
Authority: CN
Inventors: 侯丹; 魏涵天; 林新春; 兰智鑫; 刘容秀; 张朋威
Original assignee: Zhejiang A&F University ZAFU
Current assignee: Zhejiang A&F University ZAFU
Priority date: 2021-07-07
Filing date: 2021-07-07
Publication date: 2021-09-24
Anticipated expiration: 2041-07-07
Also published as: CN113430211B

Abstract

A moso bamboo high growth related gene PeGA20ox1 and application thereof belong to the technical field of molecular biology. The invention provides a moso bamboo high growth related gene PeGA20ox1 and its coded protein on one hand, and provides the use of the moso bamboo high growth related gene PeGA20ox1 on the other hand. The invention provides an important and possibly universal gene resource for regulating and controlling the plant height and the stalk biomass accumulation, and provides an excellent candidate gene for cultivating plant varieties with higher plant height and more stalk biomass accumulation.

Description

Phyllostachys pubescens high growth related gene PeGA20ox1 and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a moso bamboo high growth related gene PeGA20ox1 and application thereof.

Background

Phyllostachys edulis belongs to Phyllostachys of Bambusoideae of Gramineae, and has wide distribution and high economic value. The moso bamboo is one of plants growing fastest in the plant kingdom, and the average growth amount in spring and day with proper climate can reach 1 m. The moso bamboo is a typical bamboo plant, has the longest cultivation history and the most extensive distribution area in China, and is a bamboo-wood dual-purpose bamboo species integrating a plurality of functions. The moso bamboo is an excellent non-wood resource due to high lignification degree and toughness of the stems, and can be used for processing artificial boards, bamboo pulp paper, bamboo artware and the like. The bamboo industry is developed vigorously in major bamboo producing areas such as Fujian, Zhejiang, Sichuan and Jiangxi, and has become an important part of the local people's economic income at present. In recent years, with the development of molecular biology, a series of high growth related genes have been identified in moso bamboos, but the data of the function research of the high growth related genes of the moso bamboos are still very deficient, so that the moso bamboos are worthy of being further explored.

Gibberellins (GAs) play an important role throughout the growth cycle of plants, regulating the growth of plants and influencing the development of plants. GA20 oxidase (GA20 oxidase, GA20ox) catalyzes GA via the 13-hydroxylation pathway₁₂Formation of GA₉Alternatively, GA may be catalyzed by a non-13-hydroxylation pathway₅₃Formation of GA₂₀Wherein GA₉And GA₂₀Are respectively GA with biological activity₄And GA₁Is used as a direct precursor of (1). In bamboo plants, gibberellin is synthesized at the shoot tips and transported to the middle part through polarity, and the high growth of the bamboo plants can be regulated and controlled by means of influencing the division of internode cells of bamboo and the like.

In conclusion, the research on GA pathway related genes participating in the high growth of the moso bamboos is helpful for understanding the rapid growth mechanism of the moso bamboos, lays a good foundation for constructing excellent bamboo for subsequent genetic breeding, further improves the biomass of bamboo forests and promotes the economic prosperity and development of the bamboo industry, and has important practical significance and application prospect.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to design and provide a moso bamboo high growth related gene PeGA20ox1 and an application technical scheme thereof.

The invention is realized by the following technical scheme:

the nucleotide sequence of the moso bamboo high growth related gene PeGA20ox1 is shown in SEQ ID NO. 1.

The amino acid sequence of the protein encoded by the phyllostachys pubescens high growth related gene PeGA20ox1 is shown in SEQ ID NO. 2.

The application of the moso bamboo high growth related gene PeGA20ox1 in regulating and controlling plant height and stalk biomass accumulation.

The use enables plants to contain the gene PeGA20ox1 or enables plants to over-express the gene PeGA20ox 1.

The application comprises the steps of constructing a plant expression vector containing a gene PeGA20ox1, heterogeneously transforming the plant expression vector into arabidopsis thaliana, screening to obtain a T3 generation positive plant, and obtaining a plant with the plant height and the increased stalk biomass through phenotype analysis of the positive plant and a wild plant.

The application specifically comprises the following steps:

1) collecting moso bamboo internodes from the moso bamboo forest of the east lake village in Lingan region of Hangzhou city, Zhejiang, performing RNA extraction, performing reverse transcription to obtain cDNA, cloning a CDS sequence of PeGA20ox1, connecting the CDS sequence with a pMD18-T vector for sequencing, constructing an over-expression vector after correct identification, and performing heterologous transformation to Arabidopsis;

2) the method comprises the steps of screening positive plants of PeGA20ox1 gene heterologously transformed Arabidopsis thaliana by utilizing hygromycin resistance and a PCR technology to obtain T3 generation positive plants, carrying out RNA extraction and phenotype statistics on the positive plants, verifying the increase of the plant height and the stalk biomass, and obtaining plants with the increased plant height and the stalk biomass.

The invention has the following beneficial effects:

1. the invention obtains the PeGA20ox1 gene and the coding protein from the moso bamboo for the first time, and verifies the biological function of regulating and controlling the plant height and the stalk biomass.

2. The invention expresses the Phyllostachys pubescens PeGA20ox1 gene in Arabidopsis thaliana for the first time, and uses a PCR method to prove that the gene is successfully integrated into the genome of Arabidopsis thaliana, namely a positive plant.

3. According to the invention, phenotype observation and biomass statistics are carried out on T3 generation transgenic arabidopsis thaliana and wild type arabidopsis thaliana, and the result shows that the plant height and the stalk biomass of a transgenic plant are higher than those of the wild type arabidopsis thaliana, so that the overexpression of the PeGA20ox1 gene improves the accumulation of the plant height and the stalk biomass of the transgenic arabidopsis thaliana.

Drawings

FIG. 1 detection of positive plants of PeGA20ox1 transgenic Arabidopsis lines;

FIG. 2 gene expression level of PeGA20ox1 transgenic Arabidopsis line positive plants;

FIG. 3 different transgenic Arabidopsis phenotypes at day 30 post-transplantation;

FIG. 4 statistics of transgenic Arabidopsis stem length after transplantation;

FIG. 5 dry fresh weight of transgenic line Arabidopsis stems;

FIG. 6 the lignin and cellulose content of transgenic Arabidopsis straw.

Detailed Description

The present invention will now be described in further detail with reference to specific examples, which are intended to be illustrative, but not limiting, of the invention.

Example 1: cloning of Phyllostachys pubescens PeGA20ox1 Gene

1. Preparing materials: the Phyllostachys Pubescens internode is collected from Phyllostachys Pubescens forest (30 deg.C 15 'N, 119 deg.C 43' E) in Lingan region of Hangzhou city, Zhejiang province, and stored at-80 deg.C for use in subsequent experiments.

2. RNA extraction

With reference to the Takara RNAiso plus reagent specification, the specific steps are as follows:

(1) sterilizing vessels such as mortar and tweezers at high temperature, pre-cooling with liquid nitrogen, placing the Phyllostachys pubescens sample preserved at-80 deg.C in mortar, adding liquid nitrogen, and rapidly grinding into powder.

(2) Taking about 100mg of sample powder into a 2ml RNA-free centrifuge tube, adding 1ml of RNAioso plus reagent, fully shaking and uniformly mixing, standing for 5min, and then centrifuging 12000g of the sample for 5min at 4 ℃.

(3) And (3) taking 800 mu l of the supernatant obtained in the step (2) to a 1.5ml RNA-free centrifuge tube, adding 200ul of trichloromethane, violently shaking and uniformly mixing for 15s, standing for 5min, and then centrifuging for 15min at 12000g at 4 ℃.

(4) And (3) taking 400 mu l of the supernatant in the step 3 to a new 1.5ml RNA-free centrifuge tube, adding 400 mu l of precooled isopropanol at the temperature of-20 ℃, turning upside down and mixing uniformly, standing for 10min, and then centrifuging for 10min at 12000g at the temperature of 4 ℃.

(5) The supernatant was discarded, 1ml of absolute ethanol was added to resuspend, wash and precipitate, and centrifuged at 7500g for 5min at 4 ℃.

(6) Discarding the supernatant, centrifuging at 4 deg.C and 7500g for 5min, sucking out the residual alcohol, air drying in a super clean bench for 5min, and adding 40 μ l RNA-free water to dissolve the precipitate.

3. Reverse transcription of RNA

Referring to the PrimeScript RT reagent Kit with gDNA Eraser (Takara) Kit, the experimental consumables were all RNA-free and the reactions were all performed on ice.

(1) Removing genome DNA. The following reagents are mixed on ice to prepare a reaction mixed solution, and the reaction mixed solution is centrifuged and mixed evenly and then reacts for 2min at 42 ℃.

(2) RNA reverse transcription cDNA. Adding the following reaction mixture into the PCR tube in the first step, thoroughly mixing, centrifuging, reacting at 37 ℃ for 15min, reacting at 85 ℃ for 5s, and cooling on ice.

(3) The cDNA after reverse transcription is diluted by 10 times and can be used for related experiments such as gene cloning, fluorescence quantitative PCR and the like.

4. Cloning of genes

(1) Extracting cDNA sequence of PeGA20ox1 gene from bamboo database, designing primer with the following sequence:

PeGA20ox 1-cds-F: ATGGTGCAGAACCCACAGGTGGTCT (shown as SEQ ID NO. 3)

PeGA20ox 1-cds-R: CTAGCTAGGAGCCCTGGAGGGCTCA (shown in SEQ ID NO. 4)

(2) PCR amplification

Performing PCR amplification by using a corresponding primer by using moso bamboo cDNA as a template, wherein the reaction procedure is as follows: 5min at 95 ℃; 5s at 95 ℃,30 s at 60 ℃, 60s at 72 ℃ and 30 cycles; 10min at 72 ℃. The amplification apparatus is CFX96^TMThe Real-time PCR instrument has the following amplification system:

(3) and (3) detecting whether the size of the band is in accordance with the expectation by using 1% agarose gel electrophoresis, and performing next-step tapping recovery verification.

(4) And (4) recovering and purifying the gel, wherein a gel recovery product is purified by using a SanPrep column type DNA gel recovery kit of Shanghai Biotechnology company.

(5) Ligation reaction

Reference is made to Takara pMD^TMThe 18-T Vector Cloning Kit, the linker system is shown below:

(6) ligation product transformed Escherichia coli competent DH5 alpha

With reference to the transformation specification of Escherichia coli competent DH 5. alpha. of Shanghai Dingwei Biotechnology Limited, the specific steps are as follows:

freezing and thawing the purchased escherichia coli competence DH5 alpha on ice, adding 10 mu l of the ligation product, flicking the tube bottom, mixing uniformly, and standing on ice for 30 min.

② standing for 2min on ice after 90s at 42 ℃.

③ adding 300 mul of non-resistant LB culture medium, shaking and culturing for 1h at 220rpm and 37 ℃.

And fourthly, taking about 100 mu l of culture solution, uniformly coating the culture solution on Luria-Bertani (LB) culture medium (containing ampicillin), and culturing for 12h at 37 ℃.

Fifthly, selecting the monoclonal colony in a 1ml centrifugal tube containing a corresponding antibiotic liquid culture medium, performing shake culture at 37 ℃ and 220rpm for 4-5h until the bacterial liquid is turbid, and performing PCR identification on the bacterial liquid.

Sixthly, the positive bacteria liquid which is identified correctly in the step 5 is sent to Shanghai bio-corporation for sequencing, more than 3 monoclonals are selected from each sequence, and the influence of mismatching on the confirmation of the gene sequence in the PCR process is reduced.

The nucleotide sequence of the finally cloned moso bamboo high growth related gene PeGA20ox1 is shown as SEQ ID NO.1, and the amino acid sequence of the moso bamboo high growth related gene PeGA20ox1 encoding protein is shown as SEQ ID NO. 2.

Example 2: application of PeGA20ox1 gene heterologously transformed arabidopsis thaliana for improving plant height and stalk biomass thereof

1. Screening and culturing of transgenic arabidopsis positive plants

(1) DNA extraction and PCR detection

Firstly, preheating a proper amount of CTAB solution at 65 ℃, and precooling a proper amount of isopropanol at-20 ℃.

Secondly, grinding the collected sample into powder by using liquid nitrogen, transferring the powder into a 2ml centrifuge tube, adding 800 mu l of preheated CTAB solution, and uniformly mixing by oscillation.

③ centrifuging the tube in the step 2 in water bath at 65 ℃ for 40min, and evenly mixing the solution by reversing every 8 min.

Add 800 μ l chloroform: isopropanol (24: 1) was emulsified by vigorous shaking and mixing.

13000rpm for 12min, and 600. mu.l of supernatant is put into a 1.5ml centrifuge tube.

Sixthly, adding 600 mu l of precooled isopropanol, shaking and uniformly mixing, and placing at-20 ℃ for 1 h.

Seventhly, centrifuging at 13000rpm for 10min, discarding the supernatant, and adding 1ml of absolute ethyl alcohol to wash the precipitate.

Eighty percent (7500 rpm) centrifuging for 5min, abandoning the supernatant and leaving the precipitated DNA.

Ninthly, after the precipitation and the airing in a fume hood, adding 40 mu l of ddH₂And dissolving the precipitate by using O.

And (c) performing PCR detection on the obtained DNA to finally obtain 16 positive strains, and respectively naming the positive strains as OW-1, OW-2, OW-3, OW-4, OW-5, OW-6, OW-7, OW-8, OW-9, OW-10, OW-11, OW-12, OW-13, OW-16, OW-17 and OW-18 as shown in figure 1.

(2) RNA extraction and detection of PeGA20ox1 gene expression level

The method for extracting RNA in example 1 was used to extract RNA from transgenic Arabidopsis thaliana, and the details are not repeated here.

② the expression level of PeGA20ox1 gene was detected from the above-mentioned extracted RNA. As can be seen from FIG. 2, there was a large difference in the expression level of the different strains of PeGA20ox1 transgenic Arabidopsis. Finally, according to the expression quantity measuring result and the primary phenotype analysis, the OW-1, OW-2 and OW-16 transgenic plants are selected to carry out subsequent experiments.

(3) Culture of transgenic Arabidopsis thaliana

The method comprises sterilizing dried seeds, uniformly spreading on 1/2Murashigeand Skoog (MS) culture medium (containing hygromycin), germinating, spreading wild type Arabidopsis (Col-0) as control, and vernalizing at 4 deg.C in dark for 24 h.

② after the vernalization is finished, transferring to the illumination condition (16h light/8h dark) for culturing at the temperature of 23 ℃.

And thirdly, transplanting the arabidopsis thaliana which grows 4 true leaves and is rooted in the culture medium into a flowerpot to provide sufficient water.

2. Functional verification of transgenic Arabidopsis thaliana

(1) And (3) phenotype statistics: more than 30 biological replicates are arranged in each transgenic line Arabidopsis thaliana, and meanwhile, a wild type Arabidopsis thaliana (Col-0) and a mutant Arabidopsis thaliana (pg1, which is identified as pure sum and has the SALK number of SALK _094207C) are arranged as control interplanting, and the planting place is an Arabidopsis thaliana room of agriculture and forestry university in Zhejiang. The bolting time and the plant height of the arabidopsis are counted from 2 to 4 pm every day after transplanting. The number of rosette leaves, the diameter of rosette leaves and the biomass of stalks were counted at day 30 after transplantation. The measurement results are shown in fig. 3, 4, 5 and 6. The bolting time of the transgenic arabidopsis is 3-4 days earlier than that of the wild type arabidopsis, the number of rosette leaves is about 10 less than that of the wild type arabidopsis, and the diameter difference of the rosette leaves is not obvious. At day 30, the length of the main stems of the transgenic arabidopsis thaliana OW-1, OW-2 and OW-16 is about 1.40 times that of the main stem of the wild arabidopsis thaliana. On the 30 th day, the stems of the transgenic arabidopsis are dry and fresh, the weight of the stems is larger than that of the wild arabidopsis, and significant differences exist. The results show that the PeGA20ox1 transgenic Arabidopsis enters the reproductive growth stage in advance, and the plant height and the stalk biomass of the transgenic Arabidopsis are both obviously greater than those of the wild Arabidopsis. The high-growth PeGA20ox1 gene of the moso bamboo has the functions of improving the plant height of plants and the biomass accumulation of stalks to a certain extent.

(2) Lignin and cellulose content: the arabidopsis thaliana stalk lignin and cellulose content at day 30 was determined according to the tsuzhou kethamn biotechnology limited lignin content test kit and cellulose Content (CLL) test kit instructions. The determination results are shown in table 1, the stem lignin and cellulose content of the transgenic arabidopsis are both significantly greater than that of the wild arabidopsis, wherein the stem lignin content of the transgenic arabidopsis is about 1.42 times that of the wild arabidopsis, and the cellulose content of the transgenic arabidopsis is about 1.92 times that of the wild arabidopsis.

The results show that the accumulation of the lignin and the cellulose of the transgenic arabidopsis is obviously higher than that of the wild arabidopsis, and the accumulation of the stalk biomass of the transgenic arabidopsis is possibly one of the reasons for the fact that the accumulation of the stalk biomass of the transgenic arabidopsis is higher than that of the wild arabidopsis.

TABLE 1 transgenic lines phenotypic statistics

Sequence listing

<110> Zhejiang agriculture and forestry university

<120> Phyllostachys pubescens high growth related gene PeGA20ox1 and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1230

<212> DNA

<213> Phyllostachys edulis

<400> 1

atggtgcaga acccacaggt ggtcttcgac gccgccgtgc tgagcggcca ggccgacatc 60

ccgtcgcagt tcatctggcc cgcggacgag agccccaccc ctgacgccgc cgaggagctc 120

cccgtgccgc tcatcgacat cggcgggctc ctctcggggg accgcgcggc cgccgccgag 180

gtgacccggc tggtgggcga ggcgtgcgag cggcacggct tcttccaggt cgtgaaccac 240

ggcatcgacg cggagcttct ggcggaggcc caccggtgcg tggacgcctt cttcacgctg 300

ccgctcgcgg agaagcagcg cgccctgcgc cgcccaggcg agagctgcgg ctacgcgagc 360

agcttcacgg ggcggttcgc gtccaagctc ccctggaaag agacgctctc cttcccttac 420

tccgcctgcg cctcctcccc cgacctcgtc gtcgataact tcgtgcaaaa gctcggcgag 480

gagtaccgcc gcctcgggta actatccatt aattaatttc ttcctgcttg gtccgtgaaa 540

cagagcagag ctgcatccgt gcgtggaaga tgaaactaac aaaggtcggt cgatatatgg 600

tgcatatgaa aaaacaggga ggtttacgcg cgctactgcg gcgagatgag ccggctgtcg 660

ctggagatca tggaggtgct gggcgagagc ctgggcgtgg ggcgcgcgca ctaccggagc 720

ttcttcgagg gcaacgactc cataatgcgg ctcaactact acccgccgtg ccagcgcccg 780

tacgagacgc tgggcacggg cccgcattgc gaccccacct ccctcaccat cctccaccag 840

gacgacgtcg gcggcctcca ggtcttcacc gacggccgct ggcgctccat ccgcccccac 900

gccggcgcct tcgtcgtcaa cattggcgac accttcatgg cgctctccaa cggccgctac 960

aagagcggcc tgcaccgcgc cgtcgtcaac agccgggtgc cgcgcaagtc gctcgccttc 1020

ttcctctgcc cggagatgga caaggtggtg cgccctccgg ggacactcgt cgacgccgac 1080

aacccccgcg cgtacccgga cttcacatgg cggacgctgc tcgacttcac gcagaaggac 1140

tacagggccg acatgaggac gctcgaggcc ttctcaagct gggtccaagc ccaggcccaa 1200

ccagctgagc cctccagggc tcctagctag 1230

<210> 2

<211> 369

<212> PRT

<213> Phyllostachys edulis

<400> 2

Met Val Gln Asn Pro Gln Val Val Phe Asp Ala Ala Val Leu Ser Gly

1 5 10 15

Gln Ala Asp Ile Pro Ser Gln Phe Ile Trp Pro Ala Asp Glu Ser Pro

20 25 30

Thr Pro Asp Ala Ala Glu Glu Leu Pro Val Pro Leu Ile Asp Ile Gly

35 40 45

Gly Leu Leu Ser Gly Asp Arg Ala Ala Ala Ala Glu Val Thr Arg Leu

50 55 60

Val Gly Glu Ala Cys Glu Arg His Gly Phe Phe Gln Val Val Asn His

65 70 75 80

Gly Ile Asp Ala Glu Leu Leu Ala Glu Ala His Arg Cys Val Asp Ala

85 90 95

Phe Phe Thr Leu Pro Leu Ala Glu Lys Gln Arg Ala Leu Arg Arg Pro

100 105 110

Gly Glu Ser Cys Gly Tyr Ala Ser Ser Phe Thr Gly Arg Phe Ala Ser

115 120 125

Lys Leu Pro Trp Lys Glu Thr Leu Ser Phe Pro Tyr Ser Ala Cys Ala

130 135 140

Ser Ser Pro Asp Leu Val Val Asp Asn Phe Val Gln Lys Leu Gly Glu

145 150 155 160

Glu Tyr Arg Arg Leu Gly Glu Val Tyr Ala Arg Tyr Cys Gly Glu Met

165 170 175

Ser Arg Leu Ser Leu Glu Ile Met Glu Val Leu Gly Glu Ser Leu Gly

180 185 190

Val Gly Arg Ala His Tyr Arg Ser Phe Phe Glu Gly Asn Asp Ser Ile

195 200 205

Met Arg Leu Asn Tyr Tyr Pro Pro Cys Gln Arg Pro Tyr Glu Thr Leu

210 215 220

Gly Thr Gly Pro His Cys Asp Pro Thr Ser Leu Thr Ile Leu His Gln

225 230 235 240

Asp Asp Val Gly Gly Leu Gln Val Phe Thr Asp Gly Arg Trp Arg Ser

245 250 255

Ile Arg Pro His Ala Gly Ala Phe Val Val Asn Ile Gly Asp Thr Phe

260 265 270

Met Ala Leu Ser Asn Gly Arg Tyr Lys Ser Gly Leu His Arg Ala Val

275 280 285

Val Asn Ser Arg Val Pro Arg Lys Ser Leu Ala Phe Phe Leu Cys Pro

290 295 300

Glu Met Asp Lys Val Val Arg Pro Pro Gly Thr Leu Val Asp Ala Asp

305 310 315 320

Asn Pro Arg Ala Tyr Pro Asp Phe Thr Trp Arg Thr Leu Leu Asp Phe

325 330 335

Thr Gln Lys Asp Tyr Arg Ala Asp Met Arg Thr Leu Glu Ala Phe Ser

340 345 350

Ser Trp Val Gln Ala Gln Ala Gln Pro Ala Glu Pro Ser Arg Ala Pro

355 360 365

Ser

<210> 3

<211> 25

<212> DNA

<213> primer (primer)

<400> 3

atggtgcaga acccacaggt ggtct 25

<210> 4

<211> 25

<212> DNA

<213> primer (primer)

<400> 4

ctagctagga gccctggagg gctca 25

Claims

1. A moso bamboo high growth related gene PeGA20ox1, characterized in that: the nucleotide sequence is shown in SEQ ID NO. 1.

2. The protein encoded by the phyllostachys pubescens high growth related gene PeGA20ox1 is characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO. 2.

3. An application of the gene PeGA20ox1 related to the growth of Mao bamboo in regulating the plant height and stalk biomass accumulation.

4. Use according to claim 3, characterized in that: the plant is made to contain the gene PeGA20ox1 or the plant is made to overexpress the gene PeGA20ox 1.

5. Use according to claim 3, characterized in that: a plant over-expression vector containing the gene PeGA20ox1 is constructed, the plant over-expression vector is heterogeneously transformed into Arabidopsis, a T3 generation positive plant is obtained by screening, and a plant with the plant height and the stalk biomass increased is obtained by phenotype analysis of the positive plant and a wild plant.

6. Use according to claim 3, characterized in that: the method specifically comprises the following steps: