CN108795833B - Acetic CoA transferase defective escherichia coli engineering bacterium and application thereof - Google Patents

Abstract

The invention discloses an acetic CoA transferase gene defect type escherichia coli engineering bacterium and application thereof. The isopropanol synthesis path provided by the invention consists of acetoacetyl-CoA synthetase, hydroxymethylglutaryl-CoA lyase, acetoacetate decarboxylase and secondary alcohol dehydrogenase, and can realize the conversion of acetyl-CoA serving as an initial metabolite into isopropanol in an organism. The mutant strain provided by the invention expresses the genes which are provided by the invention and used for coding all enzymes in an isopropanol anabolic pathway. The recombinant Escherichia coli strain constructed by the invention can synthesize 364mg/L isopropanol by using rich culture medium containing glucose or glycerol as raw material under the condition of facultative anaerobism.

Description

Acetic CoA transferase defective escherichia coli engineering bacterium and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an acetic CoA transferase defective escherichia coli engineering bacterium and application thereof.

Background

Isopropanol (isopopanol) is a secondary alcohol. In the conventional industry, the water-reducing agent is mainly used as a dehydrating agent and a cleaning agent in pharmacy, cosmetics, plastics, spices, coatings and electronics industry. With the increasing energy demand of the current society, the application of the energy is paid attention and developed. Isopropanol can be used as biofuel to partially replace petrochemical gasoline, can replace methanol to esterify fat and oil so as to synthesize biodiesel, and can also generate propylene which can only be extracted from petroleum at present after dehydration.

At present, the production of isopropanol is mainly based on a chemical route taking propylene or acetone as a raw material. The chemical synthesis method has the characteristics of complex process, high temperature and high pressure, high energy consumption and high material consumption, and increases the synthesis cost. In addition, the chemical synthesis method causes serious environmental pollution.

The traditional biotechnology industry, which has or is undergoing major adjustments in technology and structure, has been moving towards the microbial cell factory and the biorefinery technology, which is the core of high-efficiency biocatalysis, and the traditional biotechnology process is gradually replaced by a green process and technology with high efficiency, low energy consumption and low pollution.

In nature, the metabolic synthetic pathway of isopropanol naturally occurs in some clostridia. This pathway is considered to be a model pathway for isopropanol synthesis, starting from acetyl-coa through acetoacetate and acetone, and finally synthesizing isopropanol. First, two molecules of acetyl-CoA are catalyzed by acetyl-CoA acyltransferase (ACoAAT) to remove CoA to produce one molecule of acetoacetyl-CoA. Secondly, the produced acetoacetyl-CoA generates acetoacetic acid by the action of acetoacetyl-transferases (atoD and atoA), and CoA is transferred to acetic acid to regenerate acetyl-CoA. Acetoacetate is then converted to acetone and carbon dioxide by Acetoacetate Decarboxylase (ADC). Finally, acetone is catalyzed by a Secondary Alcohol Dehydrogenase (SADH) to produce isopropanol. This pathway has been constructed in different host microorganisms for the synthesis of isopropanol. However, this metabolic pathway involves the enrichment of acetic acid, which is theoretically unfavorable for the growth of the bacterial cells. In addition, the pathway relies on the synthesis of acetoacetate catalyzed by the acetyl acetyltransferases atoD and atoA. However, acetylacetyltransferases are more prone to degradation rather than synthesis of acetoacetate, and are detrimental to the synthesis of the metabolite isopropanol.

Disclosure of Invention

The purpose of the invention is as follows: in order to solve the defects of the prior art, the invention designs a novel isopropanol synthesis way which does not relate to acetic acid enrichment and does not depend on acetyl acetyltransferase atoD and atoA, introduces escherichia coli, and achieves the purpose of blocking an acetoacetic acid degradation way by knocking out the genes of the atoD and atoA on the genome of the escherichia coli.

The invention aims to solve the technical problem of providing an acetic CoA transferase gene-deficient escherichia coli engineering bacterium.

The invention also aims to solve the technical problem of providing the application of the acetic CoA transferase gene-deficient escherichia coli engineering bacteria in the production of isopropanol.

The invention finally aims to solve the technical problem of providing a method for producing isopropanol.

The technical scheme is as follows: in order to solve the technical problems, the technical scheme adopted by the invention is as follows: an acetic CoA transferase gene defect type escherichia coli engineering bacterium constructs an engineering bacterium with an isopropanol synthesis path and composed of multiple genes, and is obtained by knocking out an encoding gene of acetic CoA transferase of host escherichia coli.

Wherein the plurality of genes in the isopropanol synthesis pathway composed of a plurality of genes according to the present invention comprise genes encoding acetoacetyl-CoA synthetase, hydroxymethylglutaryl-CoA lyase, acetoacetate decarboxylase, and secondary alcohol dehydrogenase.

Wherein, the escherichia coli engineering bacteria are obtained by knocking out coding genes atoD and atoA of acetate CoA transferase of host escherichia coli.

Wherein, the host Escherichia coli comprises Escherichia coli BL21, BL21pLysS, JM109, DH5 alpha, TOP10, HB101, DH10B or one of wild type Escherichia coli.

The vector for coding all genes in the isopropanol synthesis pathway is one or more of pTrc99A series expression vector, pSTV28 series expression vector, pET21 series expression vector or pBR322 series vector.

The isopropanol synthesis way provided by the invention is a brand new way. The initial metabolite of this pathway is acetyl-coa. Acetyl-coa is first converted to acetoacetyl-coa; acetoacetyl-coa is subsequently condensed with acetyl-coa under the action of hydroxymethylglutaryl-coa synthetase (HMGS) to hydroxymethylglutaryl-coa and release coenzyme a; the hydroxyglutaryl-CoA is then catalyzed by hydroxyglutaryl-CoA lyase (HMGL) to form acetyl-CoA and acetoacetate; acetoacetate is then converted to acetone and carbon dioxide by Acetoacetate Decarboxylase (ADC). Finally, acetone is catalyzed by a Secondary Alcohol Dehydrogenase (SADH) to produce isopropanol (fig. 1).

Wherein, the gene atoB for coding the acetoacetyl-CoA synthetase is from escherichia coli, the gene HMGS for coding the hydroxymethylglutaryl-CoA synthetase is from enterococcus faecalis, the gene HMGL for coding the hydroxymethylglutaryl-CoA lyase is from pseudomonas, and the gene ADC for coding the acetoacetate decarboxylase and the gene SADH for coding the secondary alcohol dehydrogenase are both from clostridium butyricum.

The gene HMGL of the hydroxymethylglutaryl coenzyme A lyase in the novel isopropanol synthesis way is obtained by artificial synthesis after codon optimization, and the DNA sequence of the optimized gene HMGL is shown as SEQ NO: 1 is shown.

The gene sequence of the gene ADC for coding the acetoacetate decarboxylase and the gene SADH for coding the secondary alcohol dehydrogenase in the novel isopropanol synthesis way is obtained by artificial synthesis after codon optimization, and the DNA sequence of the optimized gene ADC and the gene SADH in series is shown as SEQ NO: 2, respectively.

Wherein, all genes in the new isopropanol synthesis way are artificially added with ribosome binding site sequences when the polymerase chain reaction amplification is carried out.

Since the genes encoding acetate CoA transferase are atoD and atoA. Further, acetyltransferase is more prone to degradation rather than synthesis of acetoacetate, which is detrimental to the synthesis of isopropanol, a metabolite, the synthesis of isopropanol, which is involved in the knock-out of the atoD and atoA genes in the host bacterial genome (fig. 2).

Wherein, in the expression vector and the isopropanol synthesis pathway gene with ribosome binding site sequence, all the isopropanol synthesis pathway genes with ribosome binding site sequence are arranged at the downstream of the polyclonal enzyme cutting site promoter on any one of the listed vectors and are combined and arranged in any order.

The invention also comprises the application of the acetic CoA transferase gene-deficient escherichia coli engineering bacterium in producing compounds. Wherein the compound comprises acetic acid, ethanol, acetone and isopropanol, wherein the isopropanol is the target product of the invention.

The invention also comprises a method for producing isopropanol, namely a step of obtaining isopropanol by the escherichia coli engineering bacteria, specifically, introducing air in the fermentation process, consuming glycerol, glucose or other carbon sources, and producing isopropanol, wherein: the fermentation temperature is 25-38 ℃; the pH value of the fermentation system is 6.5-7.5; the carbon source in the fermentation medium is one or more of glycerol, glucose and starch; the nitrogen source in the fermentation medium is one or more of yeast powder, peptone, ammonia water, ammonium salt and urea.

Has the advantages that: compared with the prior art, the invention has the following advantages: the genetic engineering bacteria provided by the invention are obtained by taking escherichia coli as an original strain, knocking out coding genes atoD and atoA of the genome acetate CoA transferase of the escherichia coli, and expressing the genes which are provided by the invention and used for coding all enzymes in an isopropanol anabolism pathway. The recombinant Escherichia coli strain constructed by the invention can synthesize 364mg/L isopropanol by using rich culture medium containing glucose or glycerol as raw material under the condition of facultative anaerobism.

Drawings

FIG. 1 is a diagram of the novel isopropanol anabolic pathway of the present invention;

FIG. 2 is a diagram showing the knock-out of the genes atoD and atoA encoding the E.coli genomic acetate CoA transferase to block the conversion of acetoacetate into acetoacetyl-CoA in the present invention;

FIG. 3 is a plasmid map of pT-ISOP1 in the present invention;

FIG. 4 is a time chart of isopropanol production by engineered Escherichia coli MG1655MG Δ atoDA in the present invention;

FIG. 5 is a gas phase detection spectrum of the standard;

FIG. 6 shows engineered bacteria MG 1655. delta. atoDA: pT-ISOP1 gas phase detection pattern for synthesis of isopropanol with glucose as carbon source.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1:

1. extraction of Escherichia coli MG1655 genome DNA

A commercially available bacterial genomic DNA rapid extraction kit (Biotechnology engineering, Shanghai, Ltd.) was used to extract MG1655 whole genomic DNA from 1mL of a culture of wild-type Escherichia coli MG1655 (purchased from American type culture Collection) and dissolved in 0.1mL of ultrapure water.

2. Extraction of enterococcus faecalis genomic DNA

Whole genome DNA was extracted from 1mL of a culture of Enterococcus faecalis ATCC 29212 (purchased from American type culture Collection) using a commercial bacterial genome DNA rapid extraction kit (Biotechnology engineering, Shanghai, Ltd.), and dissolved in 0.1mL of ultrapure water.

3. Preparation of acetoacetyl-CoA synthetase Gene atoB

The atoB gene may be prepared by the following method, or may be obtained by artificial synthesis.

The Escherichia coli MG1655 genome DNA is used as a template, and the PCR amplification is carried out by the following primers:

EcAtoB-F：5’-CATCATGTTTAAACAACAGAAGGAATATAAAATGAAA-3’；

EcAtoB-R：5’-ATGCTCGAGTTAATTCAACCGTTCAATCAC-3’

when the primers are synthesized, the enzyme cutting site Pme I is introduced into EcAtoB-F, and the enzyme cutting site Xho I is introduced into EcAtoB-R.

The PCR reaction system is as follows: 1 μ L MG1655 genomic DNA, 1 μ L EcAtoB-F, 1 μ L EcAtoB-R, 25 μ L Premix ExTaq, 22 μ L ultrapure water.

And (3) PCR reaction conditions: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30sec, annealing at 51 ℃ for 30sec, extension at 72 ℃ for 1.2min, 30 cycles, extension at 72 ℃ for 10min, and heat preservation at 4 ℃.

The PCR product was checked for yield and specificity by 1% agarose gel electrophoresis and purified using a PCR product recovery kit (Biotechnology engineering (Shanghai) Co., Ltd.).

4. Preparation of hydroxymethylglutaryl coenzyme A synthetase gene HMGS

The HMGS gene can be prepared by the following method, and can also be obtained by artificial synthesis.

The Enterococcus faecalis ATCC 29212 genome DNA is used as a template, and the PCR amplification is carried out by the following primers:

EfMvaS-F：5’-ATATTAATTAAAGGAGTTAAAGAAATGACAATTG-3’；

EfMvaS-R：5’-AATCATGTTTAAACAGTTAGTTTCGATAAGAGCG-3’

when the primers are synthesized, the EfMvaS-F is introduced into a Pac I enzyme cutting site, and the EfMvaS-R is introduced into a Pme I enzyme cutting site.

The PCR reaction system is as follows: mu.L of Enterococcus faecalis ATCC 29212 genomic DNA, 1. mu.L of EfMvaS-F, 1. mu.L of EfMvaS-R, 25. mu.L of Premix ExTaq, and 22. mu.L of ultrapure water.

And (3) PCR reaction conditions: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30sec, annealing at 52 ℃ for 30sec, extension at 72 ℃ for 1min, 30 cycles, extension at 72 ℃ for 10min, and heat preservation at 4 ℃.

The PCR product was checked for yield and specificity by 1% agarose gel electrophoresis and purified using a PCR product recovery kit (Biotechnology engineering (Shanghai) Co., Ltd.).

5. Preparation of hydroxymethylglutaryl-CoA lyase gene HMGL

The HMGL gene can be prepared by adopting an artificial synthesis mode, and can also be prepared by adopting an in-vitro amplification method.

The codon of the HMGL (also known as mvaB; NCBI accession number M24016) gene derived from Pseudomonas mevalonii (the genomic information of which is derived from the national center for Biotechnology information NCBI) was optimized to facilitate its expression in E.coli. The optimized nucleic acid sequence is shown as SEQ NO: 1 is shown. The gene sequence after codon optimization is synthesized by the company Limited in the biological engineering (Shanghai), and the 5 'end and the 3' end of the synthesized gene sequence are respectively provided with Sal I restriction enzyme sites and Pac I restriction enzyme sites.

6. Preparation of hydroxymethylglutaryl coenzyme A lyase gene ADC and secondary alcohol dehydrogenase gene SADH

The preparation can be carried out by adopting an artificial synthesis mode, and the ADC and SADH genes can also be prepared by adopting an in vitro amplification method.

The codons of the ADC (aka ADC; NCBI accession No. KT362059) and SADH (aka adh; NCBI accession No. AF157307) genes derived from Clostridium butyricum Clostridium Beijerinckii NRRL B593 (the genomic information of which is derived from the national center for Biotechnology information NCBI) are optimized to facilitate the expression of the codons in Escherichia coli. The nucleic acid sequence of the optimized ADC and SADH tandem sequence is shown as SEQ NO: 2, respectively. The gene sequence after codon optimization is synthesized by the company of bioengineering GmbH, and the 5 'end and the 3' end of the synthesized gene sequence are respectively provided with Xba I enzyme cutting sites and Sal I enzyme cutting sites.

Example 2: construction of expression vector pT-ISOP1

The isopropanol anabolic pathway related genes are constructed on expression vectors, such as pTrc99A vector. The respective related genes may be arranged in an arbitrary order on the expression vector. In this example 5 '-SADH-ADC-HMGL-HMGS-atoB-3' was placed in the order of the multiple cloning enzyme cleavage sites on pTrc99A vector to form pT-ISOP 1. The specific implementation steps are as follows:

the purified PCR products (each of the PCR products prepared in steps 3, 4, 5 and 6 of example 1) and the vector plasmid pTrc99A were double-digested with restriction enzymes Pme I/Xho I, Pac I/Pme I, Sal I/Pac I and Xba I/Sal I, respectively, which correspond to the restriction sites introduced by PCR; the restriction enzyme PCR and the large vector fragment are recovered by agarose electrophoresis, and the gene fragment after restriction enzyme is connected with the corresponding restriction enzyme products of pTrc99A at 16 ℃ in sequence by DNA ligase. Coli DH 5. alpha. was transformed with each ligation product, and plated on a petri dish containing 100. mu.g/mL of Amp (ampicillin) and incubated at 37 ℃ for 10-12 h. And selecting a single colony on the next day, and extracting plasmids by using a Shanghai biological medium particle small quantity extraction kit. And carrying out double enzyme digestion verification on the obtained plasmid and sequencing the obtained recombinant plasmid. The sequencing result showed that the final expression vector pT-ISOP1 was constructed completely correctly. A plasmid map of pT-ISOP1 in the present invention is shown in FIG. 3.

Example 3 construction of acetate CoA transferase Gene deletion mutant Strain

The host escherichia coli used by the isopropanol-producing escherichia coli engineering bacteria is an acetate CoA transferase gene deletion mutant strain. The host Escherichia coli may be Escherichia coli BL21(DE3), BL21(DE3) pLysS, JM109, DH5 alpha, TOP10, HB101, DH10B or wild-type Escherichia coli. The genes encoding acetate CoA transferase that are deleted on the genome are atoD and atoA. The original host strain used in this example was wild-type E.coli MG1655, and the genes coding for acetate CoA transferase, atoD and atoA, were knocked out from their genomes by homologous recombination, and this mutant strain was designated MG 1655. delta. atoDA. The specific operation method comprises the following steps:

the target genes atoD and atoA are arranged adjacently and continuously on the genome, the pKD13 plasmid (purchased from Chinese plasmid vector strain cell line gene collection center) is used as a template, and primers EcatoDA KO-F of the target genes atoD and atoA

(5'-CTATTGCCTGACTGTACCCACAACGGTGTATGCAAGAGGGATAAAAAATGA TTCCGGGGATCCGTCGAC-3') and EcatoDA KO-R (5'-ACGCGTCATAAAACGCGATATGCGACCAATCATAAATCACCCCGTTGCGTTG TAGGCTGGAGCTGCTTC-3') to perform polymerase chain reaction, and amplifying to obtain a linear homologous recombination fragment which has the kanamycin resistance gene and the FRT marker in the middle and is flanked by short atoD-atoA homologous arms.

Using MG1655 as a starting strain, transferring the pKD46 plasmid carrying the Red recombinase into cells, and screening on an ammonia-containing benzethycin plate culture medium to obtain a transformant; inoculating the transformant into LB culture medium with Amp resistance, adding arabinose with the final concentration of 2mmol/L as an inducer, and culturing at 30 ℃ to OD₆₀₀When the cell count is 0.6, the cells were collected to prepare electroporation competence. The linear homologous recombination fragment obtained by PCR was electrically transformed into MG1655/pKD46 competent cells, and inverted and cultured at 30 ℃ for 20 hours, and transformants were selected to obtain a strain labeled MG 1655. delta. atoDA (FRTKm) with kanamycin resistance gene. The pKD46 plasmid in the E.coli with the substitution mutation was lost using a strategy of heat shock coupled antibiotic resistance negative selection at 42 ℃.

The helper plasmid pCP20 (purchased from China plasmid vector strain cell strain gene collection center) is transformed into MG1655 delta atoDA (FRTKm) to express FLP recombinase for deletion mutation of kana resistance gene, and pCP20 plasmid in escherichia coli with deletion mutation is lost by adopting a strategy of heat shock coupling antibiotic resistance negative screening at 42 ℃, so that the MG1655 delta atoDA strain is finally obtained.

Example 4: construction and fermentation of isopropanol synthesizing strain

The pT-ISOP1 plasmid in example 2 was electrically transformed into a knock-out E.coli MG 1655. delta. atoDA in example 3 to obtain an engineered E.coli strain MG 1655. delta. atoDA: pT-ISOP 1. The single colony is inoculated into 5mL LB test tube culture medium containing 100 mu g/mL ampicillin and cultured for 8 hours at 37 ℃, and is inoculated into 50mL fermentation culture medium containing 100 mu g/mL ampicillin in an inoculation amount of 1% (v/v).

Fermentation medium formula (1L): 2g glycerol, 10g peptone, 10g yeast powder and 5g sodium chloride were dissolved in 800ml 10mM MOPS buffer pH 7.0-7.5 and finally brought to 1000ml with 10mM MOPS.

Inoculating the engineering bacterium MG1655 delta atoDA of Escherichia coli in a shaker at 30 ℃ and 250 rpm: pT-ISOP1 culture was fermented to OD₆₀₀Isopropyl beta-D-thiogalactoside (IPTG) was added as an inducer at a final concentration of 0.1mM at 0.4-0.6 and cultured under this condition. Samples were taken every 12 hours of culture and used for spectrophotometric determination of bacterial growth concentration and gas chromatography determination of isopropanol production. The results of gas chromatography measurements of bacterial growth concentration and isopropanol were plotted against the sampling time points (FIG. 4). After the strain is cultured for 36 hours, the bacterial growth and the yield of isopropanol tend to plateau, and the bacterial growth concentration is OD after 48 hours₆₀₀The isopropanol yield reached a maximum of 364 mg/L15.

Example 5: synthesis detection of isopropanol

Detecting the final fermentation metabolites by gas chromatography. After the fermentation sample to be tested prepared in example 4 was centrifuged for 1min, 200. mu.L of the supernatant was put into a new EP tube (the remainder was stored in a refrigerator at-20 ℃ C. for further use), 600. mu.L of methanol was added to each of the tubes, the mixture was gently inverted and mixed, and then centrifuged for about 20 min. Finally, about 600. mu.L of the supernatant was aspirated into the sample bottle for gas chromatography. The detection instrument is Shimadzu gas chromatograph GC-2010 plus. The metabolites to be detected relate to ethanol, acetic acid, acetone and isopropanol. The gas phase detection pattern of the standard is shown in FIG. 5. Escherichia coli engineering bacterium MG 1655. delta. atoDA: a gas phase assay of the synthesis of isopropanol by pT-ISOP1 using glucose as a carbon source is shown in FIG. 6.

The operation method of the gas chromatograph comprises the following steps:

(1) and (3) temperature programming, setting the initial temperature to be 25 ℃, the retention time to be 3min, heating to 120 ℃ at the speed of 40 ℃/min, heating to 230 ℃ at the speed of 50 ℃/min, and the retention time to be 2 min.

(2) Then setting the temperature of a sample inlet to be 250 ℃, the temperature of an FID detector to be 280 ℃, the sample injection volume to be 0.2 mu L and the split ratio to be 25:1, after setting, putting the gas chromatographic columns in the gas chromatograph in sequence, and clicking start to start operation.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that. Various modifications and alterations of those details may be made in light of the overall teachings of the disclosure, and are within the scope of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Sequence listing

<110> Huaiyin institute of Industrial and research

<120> acetic acid CoA transferase defective escherichia coli engineering bacteria and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 929

<212> DNA

<213> HMGL Artificial Sequence (Artificial Sequence)

<400> 1

tatgtcgaca ggaggtaata aatatgcaag cggtaaaggt ctttgaagtc ggcccccgtg 60

acggcctgca gaacgaacgc cagccgctgt cggtggccgc ccgtgtgggc ttgatcggcg 120

aactggctgg caccggcctg cggcatatcg aagccggcgc cttcgtgtcg ccgcgctggg 180

tgccgcagat ggccggcagc gacgaggtgt tgcgccagtt gcccagcaac gacggggtca 240

gttacacggc cctggtgccc aaccggcaag gcttcgaggc cgcgcaacgg gctggctgcc 300

gcgaggtagc ggtgttcgcc gccgcctccg aggcgttttc gcgcaacaac atcaattgct 360

ccatcgatga aagcttcgag cgcttcaccc cggtgttgcg cgccgccaac gaagcctcta 420

tccgggtgcg cggttatgta tcctgcgtgc tcggttgccc gttcagtggg gccgttgcgc 480

cggaggctgt ggccaaggtc gcacgccgcc tgtacgaact gggctgctac gaaatcagcc 540

tgggtgacac cattggcgcc ggccgcccgg atgaaacggc tcaattgttc gagctctgcg 600

cacggcaact gccggtcgcg gcactggccg gccacttcca cgatacctgg ggcatggcca 660

tcgccaatgt gcatgccgca ctcgcgcagg gtgtacgcac cttcgacagc tcggtcgcgg 720

gcctcggcgg ctgcccctac tcgccgggtg ccagcggtaa cgtggccacg gaagatctgt 780

tgtacctgct gcacggcctg ggctacagca ccggtgttga cctggaggcg gtggcacagg 840

ttggtgtgcg catcagcgcg cagctgggca ccgccaaccg ctcccgtgcc ggccttgccc 900

tggcagcaag gagcgcccgc gaacactga 929

<210> 2

<211> 1839

<212> DNA

<213> Artificial Sequence for tandem ADC and SADH (Artificial Sequence)

<400> 2

ttgctctaga aggaggtaat aaatatgaaa ggttttgcaa tgcttggtat taataagtta 60

ggatggatcg aaaaagaacg tccagttgcg ggttcatatg atgctattgt acgcccatta 120

gcagtatctc cgtgtacatc agatattcat actgtttttg agggagctct tggagatcgt 180

aagaatatga ttttagggca tgaagctgta ggtgaagttg ttgaagtagg aagtgaagtg 240

aaggatttta aacctggtga cagagttatt gttccttgta caactccaga ttggagatct 300

ttggaagttc aagctggttt tcaacagcac tcaaacggta tgctcgcagg atggaaattt 360

tcaaatttca aggatggagt ttttggtgaa tattttcatg taaatgatgc ggatatgaat 420

cttgcgattc ttcctaaaga catgccatta gaaaatgctg ttatgattac agatatgatg 480

actactggat ttcatggagc agaacttgca gatattcaaa tgggttcaag tgttgtggta 540

attggcattg gagctgttgg cttaatggga attgcaggtg ctaaattacg tggagcaggt 600

agaattattg gagtggggag ccgtccgatt tgtgttgagg ctgcaaaatt ttatggagca 660

acagatattc ttaattataa aaatggtcat attgttgatc aagttatgaa attaacgaat 720

ggaaaaggcg ttgaccgcgt aattatggca ggcggtggtt ctgaaacatt atcccaagca 780

gtatctatgg ttaaaccagg aggaattatt tctaatatta attatcatgg aagtggagat 840

gctttactta ttccacgtgt agaatgggga tgtggaatgg ctcacaagac tattaaagga 900

ggtctttgtc ctgggggacg tttgagagca gaaatgttaa gagatatggt agtatataat 960

cgtgttgatc ttagtaaatt agttacacat gtatatcatg gatttgatca cattgaagaa 1020

gcactgttat taatgaaaga caagccaaaa gacttgatta aagcagtagt tattttataa 1080

aggaggtaat aaatatgtta aaggatgaag taattaaaca aattagcacg ccattaactt 1140

cgcctgcatt tcctagagga ccctataaat ttcataatcg tgagtatttt aacattgtat 1200

atcgtacaga tatggatgca cttcgtaaag ttgtgccaga gcctttagaa attgatgagc 1260

ccttagtccg ttttgaaatt atggcaatgc atgatacgag tggacttggt tgttatacag 1320

aaagcggaca ggctattccc gtaagcttta atggagttaa gggagattat cttcatatga 1380

tgtatttaga taatgagcct gcaattgcag taggacgtga attaagtgca tatcctaaaa 1440

agctcgggta tccaaagctt tttgtggatt cagatacttt agtaggaact ttagactatg 1500

gaaaacttag agttgcgaca gctacaatgg ggtacaaaca taaagcctta gatgctaatg 1560

aagcaaagga tcaaatttgt cgccctaatt atatgttgaa aattattccc aattatgatg 1620

gaagccctag aatttgtgag cttattaatg cgaaaatcac agatgttacc gtacatgaag 1680

cttggacagg accaactcgt ctgcagttat ttgatcacgc tatggcgcca cttaatgatt 1740

tgccagtaaa agagattgtt tctagctctc acattcttgc agatattatt ttgcctagag 1800

ctgaagttat ttatgattat cttaagtaag tcgacatat 1839

<210> 3

<211> 37

<212> DNA

<213> EcAtoB-F(Artificial Sequence)

<400> 3

catcatgttt aaacaacaga aggaatataa aatgaaa 37

<210> 4

<211> 30

<212> DNA

<213> EcAtoB-R(Artificial Sequence)

<400> 4

atgctcgagt taattcaacc gttcaatcac 30

<210> 5

<211> 34

<212> DNA

<213> EfMvaS-F(Artificial Sequence)

<400> 5

atattaatta aaggagttaa agaaatgaca attg 34

<210> 6

<211> 34

<212> DNA

<213> EfMvaS-R(Artificial Sequence)

<400> 6

aatcatgttt aaacagttag tttcgataag agcg 34

<210> 7

<211> 69

<212> DNA

<213> EcatoDA KO-F(Artificial Sequence)

<400> 7

ctattgcctg actgtaccca caacggtgta tgcaagaggg ataaaaaatg attccgggga 60

tccgtcgac 69

<210> 8

<211> 69

<212> DNA

<213> EcatoDA KO-R(Artificial Sequence)

<400> 8

acgcgtcata aaacgcgata tgcgaccaat cataaatcac cccgttgcgt tgtaggctgg 60

agctgcttc 69

Claims (5)

1. An engineering bacterium of Escherichia coli deficient in an acetate CoA transferase gene, which is obtained by constructing an engineering bacterium of an isopropanol synthesis pathway composed of a plurality of genes, and by knocking out genes encoding acetate CoA transferase of host Escherichia coli, wherein the genes in the isopropanol synthesis pathway composed of the genes include genes encoding acetoacetyl-CoA synthetase, hydroxymethylglutaryl-CoA lyase, acetoacetate decarboxylase and secondary alcohol dehydrogenase, the engineering bacterium of Escherichia coli is obtained by knocking out genes encoding acetate CoA transferase of host Escherichia coli, atoD and atoA, the gene encoding acetoacetyl-CoA synthetase is derived from Escherichia coli, the gene encoding hydroxymethylglutaryl-CoA synthetase is derived from enterococcus faecalis, the HMGL for coding the hydroxymethylglutaryl-CoA lyase is from pseudomonas, the ADC for coding the acetoacetate decarboxylase and the SADH for coding the secondary alcohol dehydrogenase are both from clostridium butyricum, the HMGL for coding the hydroxymethylglutaryl-CoA lyase is obtained by codon optimization, then a ribosome binding site sequence is added and artificial synthesis, and the DNA sequence of the optimized HMGL gene is shown as SEQ NO: 1, the DNA sequence of the gene ADC for coding the acetoacetate decarboxylase and the DNA sequence of the gene SADH for coding the secondary alcohol dehydrogenase which are connected in series are obtained by adding a ribosome binding site sequence after codon optimization and artificially synthesizing, and the DNA sequences of the optimized gene ADC and the optimized gene SADH are shown as SEQ NO: 2, respectively.

2. The acetate CoA transferase gene-deficient E.coli engineered bacterium of claim 1, wherein the host E.coli comprises one of Escherichia coli BL21, BL21pLysS, JM109, DH5 a, TOP10, HB101, DH10B or wild-type E.coli.

3. The acetate CoA transferase gene-deficient E.coli engineered bacterium of claim 1, wherein the vector encoding all the genes in the pathway of isopropanol synthesis is one or more of pTrc99A series expression vector, pSTV28 series expression vector, pET21 series expression vector or pBR322 series vector.

4. The acetate CoA transferase gene-deficient E.coli engineered bacterium of claim 3, wherein all the genes to which the ribosome binding site sequence is added are arranged downstream of the promoter for the polyclonal cleavage site on any one of the vectors listed in claim 3, and are arranged in combination in any order.

5. Use of the acetate CoA transferase gene deficient Escherichia coli engineering bacterium of any one of claims 1 to 4 for producing isopropanol.

Images