CN108754014B - Molecular marker for identifying navel orange, method for identifying navel orange, application and kit - Google Patents
Molecular marker for identifying navel orange, method for identifying navel orange, application and kit Download PDFInfo
- Publication number
- CN108754014B CN108754014B CN201810663997.7A CN201810663997A CN108754014B CN 108754014 B CN108754014 B CN 108754014B CN 201810663997 A CN201810663997 A CN 201810663997A CN 108754014 B CN108754014 B CN 108754014B
- Authority
- CN
- China
- Prior art keywords
- primer
- primer pair
- seq
- schr3
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular marker for identifying navel oranges, which belongs to the technical field of citrus molecular breeding, and primer pairs used for amplifying the molecular marker comprise one or more of a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair, a Schr6-20236059 primer pair, an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair and an Rchr6-20236059 primer pair. The navel orange and common sweet orange can be identified in the early seedling stage by adopting a primer pair for amplifying the molecular marker.
Description
Technical Field
The invention belongs to the technical field of citrus molecular breeding, and particularly relates to a molecular marker for identifying navel oranges, and a method, application and kit for identifying the navel oranges.
Background
Sweet orange (Citrus sinensis) is a fruit of the genus Citrus of the family Rutaceae, and can be classified into common sweet orange, navel orange, and acid-free sweet orange. The navel oranges are widely cultivated in the world, the economic value is high, the fruit meat is crisp, the flavor is unique, the sour and sweet taste is proper, the nutrition is rich, seeds are not existed, the navel oranges have the characteristics of rich varieties such as early maturity and late maturity, the fruits are transport-resistant and the like, can be produced and processed, and are deeply popular with consumers. In the seedling propagation process, the production demand of navel orange seedlings is high, and the price is high; in the seedling stage, navel oranges and common sweet oranges can not be distinguished; therefore, seedlings with various sweet oranges in the market are used as navel orange seedlings for sale, and the development of a technology capable of identifying the navel oranges in the early seedling stage has important value on the consistency and the fidelity of fine variety breeding.
The sweet oranges are asexual propagation, are strictly single-origin species, have almost the same genetic background, and the traditional molecular marker means such as SSR, RAPD and AFLP markers are difficult to stably distinguish the navel oranges from other sweet oranges at the DNA level. The main reasons are: the genetic background and DNA of navel oranges are almost completely consistent with those of other sweet oranges, the similarity reaches 99.9%, the navel oranges are derived from bud mutation (point mutation) of common sweet oranges, the genome difference with the common sweet oranges is only spontaneous mutation of individual sites, the density of the traditional molecular markers is small, the whole genome cannot be covered, and effective difference information cannot be obtained. The traditional molecular marker is used for distinguishing navel oranges from common sweet oranges, has genome randomness, cannot well find the true difference sites of the navel oranges and the common sweet oranges, and further cannot identify the navel oranges from other sweet oranges.
Disclosure of Invention
In view of the above, the present invention aims to provide a molecular marker for identifying navel oranges, wherein a primer pair used for amplifying the molecular marker can be used for identifying navel oranges from common sweet oranges.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a molecular marker for identifying navel oranges, wherein primer pairs used for amplifying the molecular marker comprise one or more of a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair, a Schr6-20236059 primer pair, an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair and an Rchr6-20236059 primer pair;
the Schr3-5163123 primer pair comprises a Schr3-5163123 upstream primer and a Schr3-5163123 downstream primer, the Schr3-5163123 upstream primer has a nucleotide sequence shown as SEQ ID No.1, and the Schr3-5163123 downstream primer has a nucleotide sequence shown as SEQ ID No. 2;
the Schr3-7185873 primer pair comprises a Schr3-7185873 upstream primer and a Schr3-7185873 downstream primer, the Schr3-7185873 upstream primer has a nucleotide sequence shown as SEQ ID No.3, and the Schr3-7185873 downstream primer has a nucleotide sequence shown as SEQ ID No. 4;
the Schr4-16844636 primer pair comprises a Schr4-16844636 upstream primer and a Schr4-16844636 downstream primer, the Schr4-16844636 upstream primer has a nucleotide sequence shown as SEQ ID No.5, and the Schr4-16844636 downstream primer has a nucleotide sequence shown as SEQ ID No. 6;
the Schr7-2452525 primer pair comprises a Schr7-2452525 upstream primer and a Schr7-2452525 downstream primer, the Schr7-2452525 upstream primer has a nucleotide sequence shown as SEQ ID No.7, and the Schr7-2452525 downstream primer has a nucleotide sequence shown as SEQ ID No. 8;
the Schr2-19158899 primer pair comprises a Schr2-19158899 upstream primer and a Schr2-19158899 downstream primer, the Schr2-19158899 upstream primer has a nucleotide sequence shown as SEQ ID No.9, and the Schr2-19158899 downstream primer has a nucleotide sequence shown as SEQ ID No. 10;
the Schr6-20236059 primer pair comprises a Schr6-20236059 upstream primer and a Schr6-20236059 downstream primer, the Schr6-20236059 upstream primer has a nucleotide sequence shown as SEQ ID No.11, and the Schr6-20236059 downstream primer has a nucleotide sequence shown as SEQ ID No. 12;
the Rchr3-5163123 primer pair comprises an Rchr3-5163123 upstream primer and an Rchr3-5163123 downstream primer, the Rchr3-5163123 upstream primer has a nucleotide sequence shown in SEQ ID No.13, and the Rchr3-5163123 downstream primer has a nucleotide sequence shown in SEQ ID No. 14;
the Rchr3-7185873 primer pair comprises an Rchr3-7185873 upstream primer and an Rchr3-7185873 downstream primer, the Rchr3-7185873 upstream primer has a nucleotide sequence shown in SEQ ID No.15, and the Rchr3-7185873 downstream primer has a nucleotide sequence shown in SEQ ID No. 16;
the Rchr4-16844636 primer pair comprises an Rchr4-16844636 upstream primer and an Rchr4-16844636 downstream primer, the Rchr4-16844636 upstream primer has a nucleotide sequence shown in SEQ ID No.17, and the Rchr4-16844636 upstream primer has a nucleotide sequence shown in SEQ ID No. 18;
the Rchr7-2452525 primer pair comprises an Rchr7-2452525 upstream primer and an Rchr7-2452525 downstream primer, the Rchr7-2452525 upstream primer has a nucleotide sequence shown in SEQ ID No.19, and the Rchr7-2452525 downstream primer has a nucleotide sequence shown in SEQ ID No. 20;
the Rchr2-19158899 primer pair comprises an Rchr2-19158899 upstream primer and an Rchr2-19158899 downstream primer, the Rchr2-19158899 upstream primer has a nucleotide sequence shown in SEQ ID No.21, and the Rchr2-19158899 downstream primer has a nucleotide sequence shown in SEQ ID No. 22;
the Rchr6-20236059 primer pair comprises an Rchr6-20236059 upstream primer and an Rchr6-20236059 downstream primer, wherein the Rchr6-20236059 upstream primer has a nucleotide sequence shown in SEQ ID No.23, and the Rchr6-20236059 downstream primer has a nucleotide sequence shown in SEQ ID No. 24.
The invention also provides a method for identifying navel oranges, which comprises the following steps:
1) extracting sample genome DNA, performing PCR amplification by using a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair and a Schr6-20236059 primer pair which are described in the technical scheme, performing Sanger sequencing on the obtained Schr3-5163123 product, a Schr3-7185873 product, a Schr4-16844636 product, a Schr7-2452525 product, a Schr2-19158899 product and a Schr6-20236059 product, introducing the obtained sequencing result into a Mutation Suryor V4.0.9 software, and respectively obtaining a Schr 3-3 peak map, a Schr3 peak map and a Schr 3-3 peak map;
2) extracting sample genome DNA and common sweet orange genome DNA, and performing high-resolution melting curve analysis on the sample genome DNA and the common sweet orange genome DNA by using an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair and an Rchr6-20236059 primer pair which are described in the technical scheme to respectively obtain an Rchr3-5163123 peak map, an Rchr3-7185873 peak map, an Rchr4-16844636 peak map, an Rchr7-2452525 peak map, an Rchr2-19158899 peak map and an Rchr6-20236059 peak map;
when the nucleotide at the chr3:5163123 site in the Schr3-5163123 peak diagram of the step 1) is GA,
and/or when the nucleotide at the chr3:7185873 site in the Schr3-7185873 peak diagram is GA,
and/or when the nucleotide at the chr4:16844636 site in the Schr4-16844636 peak diagram is TA,
and/or when the nucleotide at the chr7-2452525 site in the Schr7-2452525 peak diagram is GC,
and/or when the nucleotide at the chr2:19158899 site in the Schr2-19158899 peak diagram is A,
and/or when the nucleotide at the chr6:20236059 site in the Schr6-20236059 peak diagram is CT;
and/or when there is an upper curve at the chr3:5163123 site in the step 2) Rchr3-5163123 peak diagram,
and/or when there is an upper curve at the chr3:7185873 site in the diagram of the peaks of the Rchr3-7185873,
and/or when there is an upper curve at the chr4:16844636 site in the diagram of the peaks of the Rchr4-16844636,
and/or when there is a lower curve at the chr7-2452525 site in the diagram of the peaks of the Rchr7-2452525,
and/or when there is a lower curve at the chr2:19158899 site in the diagram of the peaks of the Rchr2-19158899,
and/or when the upper curve exists at the chr6:20236059 site in the Rchr6-20236059 peak diagram
When the current is over; the sample is identified as navel orange;
the step 1) and the step 2) are not limited in time sequence.
Preferably, the PCR amplification system of step 1) comprises, per 20. mu.l: 80ng of sample genomic DNA, 10. mu.l of 2 XPPhantaMax Buffer, 0.4. mu.l of dNTP, 0.4. mu.l of PhantaMax Super-Fidelity DNApolymerase, at a concentration of 10. mu. mol/L of upstream primer 0.5. mu.l, at a concentration of 10. mu. mol/L of downstream primer 0.5. mu.l, and the balance ddH2O。
Preferably, the conditions for the PCR amplification in step 1) include: 3min at 95 ℃; 34 cycles of: annealing at 95 ℃ for 15s, annealing at 49-55 ℃ for 15s, and annealing at 72 ℃ for 1 min; 5min at 72 ℃.
Preferably, the annealing temperature is 53 ℃ when using a Schr3-7185873 primer pair, a Schr2-19158899 primer pair, a Schr6-20236059 primer pair or a Schr3-5163123 primer pair.
Preferably, the annealing temperature is 49 ℃ when using the Schr7-2452525 primer pair.
Preferably, the annealing temperature is 55 ℃ when using the Schr4-16844636 primer pair.
Preferably, the step 2) of high resolution melting curve analysis uses a PCR reaction system comprising, per 20 μ l: 25ng sample genomic DNA or common sweet orange genomic DNA, 10. mu.l Mastermix, 2.4. mu.l MgCl2The concentration of the upstream primer is 10 mu mol/L and the concentration of the downstream primer is 10 mu mol/L, the concentration of the upstream primer is 0.4 mu L, the rest is ddH2O。
The invention also provides a kit which comprises the primer pair used for the molecular marker amplification in the technical scheme.
The invention also provides application of the molecular marker or the kit in the technical scheme in identifying navel oranges and common sweet oranges.
According to the molecular marker for identifying navel oranges, provided by the invention, the primer pair used for amplifying the molecular marker can cover the whole genome of the navel oranges, and the site difference between the navel oranges and common sweet oranges can be identified, so that the navel oranges and the common sweet oranges can be identified.
The results of the embodiments of the present invention show that: according to the molecular marker provided by the invention, the navel orange and common sweet orange can be identified by adopting a primer pair for amplifying the molecular marker.
Drawings
FIG. 1-1 is a graph of Sanger sequencing peaks of amplified fragments of navel orange and common sweet orange at chr3: 5163123;
FIGS. 1-2 are high resolution melting curve difference plots of amplified fragments of navel orange and common sweet orange at chr3: 5163123;
FIG. 2-1 is a graph of Sanger sequencing peaks of amplified fragments of navel orange and common sweet orange at chr3: 7185873;
FIG. 2-2 is a graph showing the difference between the melting curves of the amplified fragments of navel orange and common sweet orange at chr3: 7185873;
FIG. 3-1 is a graph of Sanger sequencing peaks of amplified fragments of navel orange and common sweet orange at chr4: 16844636;
FIG. 3-2 is a graph of the difference in high resolution melting curves of amplified fragments of navel orange and common sweet orange at chr4: 16844636;
FIG. 4-1 is a graph of Sanger sequencing peaks of amplified fragments of navel orange and common sweet orange at chr7: 2452525;
FIG. 4-2 is a graph of the difference in high resolution melting curves of amplified fragments of navel orange and common sweet orange at chr7: 2452525;
FIG. 5-1 is a graph of Sanger sequencing peaks of amplified fragments of navel orange and common sweet orange at chr2: 19158899;
FIG. 5-2 is a graph of the difference in high resolution melting curves of amplified fragments of navel orange and common sweet orange at chr2: 19158899;
FIG. 6-1 is a graph of Sanger sequencing peaks of amplified fragments of navel orange and common sweet orange at chr6: 20236059;
fig. 6-2 shows navel orange and common sweet orange at chr6:20236059 high resolution melting curve difference plot of amplified fragments.
Detailed Description
The invention provides a molecular marker for identifying navel oranges, wherein primer pairs used for amplifying the molecular marker comprise one or more of a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair, a Schr6-20236059 primer pair, an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair and an Rchr6-20236059 primer pair;
the Schr3-5163123 primer pair comprises a Schr3-5163123 upstream primer and a Schr3-5163123 downstream primer, the Schr3-5163123 upstream primer has a nucleotide sequence shown as SEQ ID No.1, and the Schr3-5163123 downstream primer has a nucleotide sequence shown as SEQ ID No. 2;
the Schr3-7185873 primer pair comprises a Schr3-7185873 upstream primer and a Schr3-7185873 downstream primer, the Schr3-7185873 upstream primer has a nucleotide sequence shown as SEQ ID No.3, and the Schr3-7185873 downstream primer has a nucleotide sequence shown as SEQ ID No. 4;
the Schr4-16844636 primer pair comprises a Schr4-16844636 upstream primer and a Schr4-16844636 downstream primer, the Schr4-16844636 upstream primer has a nucleotide sequence shown as SEQ ID No.5, and the Schr4-16844636 downstream primer has a nucleotide sequence shown as SEQ ID No. 6;
the Schr7-2452525 primer pair comprises a Schr7-2452525 upstream primer and a Schr7-2452525 downstream primer, the Schr7-2452525 upstream primer has a nucleotide sequence shown as SEQ ID No.7, and the Schr7-2452525 downstream primer has a nucleotide sequence shown as SEQ ID No. 8;
the Schr2-19158899 primer pair comprises a Schr2-19158899 upstream primer and a Schr2-19158899 downstream primer, the Schr2-19158899 upstream primer has a nucleotide sequence shown as SEQ ID No.9, and the Schr2-19158899 downstream primer has a nucleotide sequence shown as SEQ ID No. 10;
the Schr6-20236059 primer pair comprises a Schr6-20236059 upstream primer and a Schr6-20236059 downstream primer, the Schr6-20236059 upstream primer has a nucleotide sequence shown as SEQ ID No.11, and the Schr6-20236059 downstream primer has a nucleotide sequence shown as SEQ ID No. 12;
the Rchr3-5163123 primer pair comprises an Rchr3-5163123 upstream primer and an Rchr3-5163123 downstream primer, the Rchr3-5163123 upstream primer has a nucleotide sequence shown in SEQ ID No.13, and the Rchr3-5163123 downstream primer has a nucleotide sequence shown in SEQ ID No. 14;
the Rchr3-7185873 primer pair comprises an Rchr3-7185873 upstream primer and an Rchr3-7185873 downstream primer, the Rchr3-7185873 upstream primer has a nucleotide sequence shown in SEQ ID No.15, and the Rchr3-7185873 downstream primer has a nucleotide sequence shown in SEQ ID No. 16;
the Rchr4-16844636 primer pair comprises an Rchr4-16844636 upstream primer and an Rchr4-16844636 downstream primer, the Rchr4-16844636 upstream primer has a nucleotide sequence shown in SEQ ID No.17, and the Rchr4-16844636 upstream primer has a nucleotide sequence shown in SEQ ID No. 18;
the Rchr7-2452525 primer pair comprises an Rchr7-2452525 upstream primer and an Rchr7-2452525 downstream primer, the Rchr7-2452525 upstream primer has a nucleotide sequence shown in SEQ ID No.19, and the Rchr7-2452525 downstream primer has a nucleotide sequence shown in SEQ ID No. 20;
the Rchr2-19158899 primer pair comprises an Rchr2-19158899 upstream primer and an Rchr2-19158899 downstream primer, the Rchr2-19158899 upstream primer has a nucleotide sequence shown in SEQ ID No.21, and the Rchr2-19158899 downstream primer has a nucleotide sequence shown in SEQ ID No. 22;
the Rchr6-20236059 primer pair comprises an Rchr6-20236059 upstream primer and an Rchr6-20236059 downstream primer, wherein the Rchr6-20236059 upstream primer has a nucleotide sequence shown in SEQ ID No.23, and the Rchr6-20236059 downstream primer has a nucleotide sequence shown in SEQ ID No. 24.
In the invention, the primer pair used for amplifying the molecular marker can cover the whole genome of navel oranges, can identify the site difference between the navel oranges and common sweet oranges, and further can identify the navel oranges and the common sweet oranges.
In the invention, the Schr3-5163123 primer pair comprises a Schr3-5163123 upstream primer and a Schr3-5163123 downstream primer, and the Schr3-5163123 upstream primer has a nucleotide sequence shown in SEQ ID No.1, and is specifically shown as follows:
ACAACTTTTCAACTCCCTCTACCA；
the downstream primer of the Schr3-5163123 has a nucleotide sequence shown as SEQ ID No.2, and is specifically shown as follows:
AGCAACAATCTCCAACGCCTG。
in the invention, the Schr3-5163123 primer pair is designed according to sequences of 500bp before and after single-base variation at the 5163123 position on the chr3 of the navel orange.
In the invention, the Schr3-7185873 primer pair comprises a Schr3-7185873 upstream primer and a Schr3-7185873 downstream primer, wherein the Schr3-7185873 upstream primer has a nucleotide sequence shown in SEQ ID No.3, and the specific sequence is as follows:
TCAACCAGAGACACCAGGGAC；
the downstream primer of the Schr3-7185873 has a nucleotide sequence shown as SEQ ID No.4, and the specific sequence is shown as follows:
CGCCTTCCAAGTTTTGTTCTA。
in the invention, the Schr3-7185873 primer pair is designed according to sequences of 500bp before and after single-base variation at the 7185873 position on the chr3 of the navel orange.
In the invention, the Schr4-16844636 primer pair comprises a Schr4-16844636 upstream primer and a Schr4-16844636 downstream primer, wherein the Schr4-16844636 upstream primer has a nucleotide sequence shown in SEQ ID No.5, and the specific sequence is as follows:
TTTATGCGAACGAGGGCTTTG；
the downstream primer of the Schr4-16844636 has a nucleotide sequence shown as SEQ ID No.6, and the specific sequence is as follows:
GCCACAAATTAATGGGCTTCTCA。
in the invention, the Schr4-16844636 primer pair is designed according to sequences of 500bp before and after single-base variation at the 16844636 position on the chr4 of the navel orange.
In the invention, the Schr7-2452525 primer pair comprises a Schr7-2452525 upstream primer and a Schr7-2452525 downstream primer, wherein the Schr7-2452525 upstream primer has a nucleotide sequence shown as SEQ ID No.7, and the specific sequence is shown as follows:
CAATTATCAAGTAGGTAACTTTTA；
the downstream primer of the Schr7-2452525 has a nucleotide sequence shown as SEQ ID No.8, and the specific sequence is shown as follows:
TGACCCTATAGTGTAATGTGTG。
in the invention, the Schr7-2452525 primer pair is designed according to sequences of 500bp before and after single-base variation at the 2452525 position on the chr7 of the navel orange.
In the invention, the Schr2-19158899 primer pair comprises a Schr2-19158899 upstream primer and a Schr2-19158899 downstream primer, wherein the Schr2-19158899 upstream primer has a nucleotide sequence shown in SEQ ID No.9, and the specific sequence is shown as follows:
AAAGAATGTGTTGTACGGGAT；
the downstream primer of the Schr2-19158899 has a nucleotide sequence shown as SEQ ID No.10, and the specific sequence is shown as follows:
TATGGCAGTTAGGGAGAAGTC。
in the invention, the Schr2-19158899 primer pair is designed according to sequences of 500bp before and after single-base variation at the 19158899 position on the chr2 of the navel orange.
In the invention, the Schr6-20236059 primer pair comprises a Schr6-20236059 upstream primer and a Schr6-20236059 downstream primer, wherein the Schr6-20236059 upstream primer has a nucleotide sequence shown as SEQ ID No.11, and the sequence is specifically shown as follows:
AATAGTTCTTTTTTACCCCCTC；
the downstream primer of the Schr6-20236059 has a nucleotide sequence shown as SEQ ID No.12, and the specific sequence is shown as follows:
ACCCTTACACTTTACTCCTTCC。
in the invention, the Schr6-20236059 primer pair is designed according to sequences of 500bp before and after single-base variation at the 20236059 position on the chr6 of the navel orange.
In the invention, the Rchr3-5163123 primer pair comprises an Rchr3-5163123 upstream primer and an Rchr3-5163123 downstream primer, wherein the Rchr3-5163123 upstream primer has a nucleotide sequence shown in SEQ ID No.13, and the specific sequence is shown as follows:
GGAGCATCGCGAATTTGGAG；
the downstream primer of the Rchr3-5163123 has a nucleotide sequence shown as SEQ ID No.14, and the specific sequence is shown as follows:
TTTCCTTGCCATATAATTTCTGCA。
in the invention, the Rchr3-5163123 primer pair is designed according to sequences of 100bp before and after single-base variation at the 5163123 position on the cord orange chromosome chr 3.
In the invention, the Rchr3-7185873 primer pair comprises an Rchr3-7185873 upstream primer and an Rchr3-7185873 downstream primer, wherein the Rchr3-7185873 upstream primer has a nucleotide sequence shown in SEQ ID No.15, and the specific sequence is shown as follows:
CCCCAGGAATGATGATGCCA；
the downstream primer of the Rchr3-7185873 has a nucleotide sequence shown as SEQ ID No.16, and the specific sequence is shown as follows:
CCTGGAACGCTTTCTTTCACG。
in the invention, the Rchr3-7185873 primer pair is designed according to sequences of 100bp before and after single-base variation at the 7185873 position on the cord orange chromosome chr 3.
In the invention, the Rchr4-16844636 primer pair comprises an Rchr4-16844636 upstream primer and an Rchr4-16844636 downstream primer, wherein the Rchr4-16844636 upstream primer has a nucleotide sequence shown in SEQ ID No.17, and the specific sequence is shown as follows:
ATAGCAGAATGCCTACCCTGC；
the upstream primer of the Rchr4-16844636 has a nucleotide sequence shown as SEQ ID No.18, and the specific sequence is shown as follows:
GGAGGCAATAAGTGGGAGCTT。
in the invention, the Rchr4-16844636 is designed according to 100bp sequences before and after single-base variation at the 16844636 position on the cord orange chromosome chr 4.
In the invention, the Rchr7-2452525 primer pair comprises an Rchr7-2452525 upstream primer and an Rchr7-2452525 downstream primer, wherein the Rchr7-2452525 upstream primer has a nucleotide sequence shown in SEQ ID No.19, and the specific sequence is shown as follows:
GGTTGAGATGGAGGAGTAGGAATT；
the downstream primer of the Rchr7-2452525 has a nucleotide sequence shown as SEQ ID No.20, and the specific sequence is shown as follows:
ACAACACTACCCACTTTGCG。
in the invention, the Rchr7-2452525 primer pair is designed according to a sequence of 100bp before and after single-base variation at the position 2452525 on the chromosome Chr7 of the navel orange.
In the invention, the Rchr2-19158899 primer pair comprises an Rchr2-19158899 upstream primer and an Rchr2-19158899 downstream primer, wherein the Rchr2-19158899 upstream primer has a nucleotide sequence shown in SEQ ID No.21, and the specific sequence is shown as follows:
ACATAAATGCTGACCTTGGACG；
the downstream primer of the Rchr2-19158899 has a nucleotide sequence shown as SEQ ID No.22, and the specific sequence is shown as follows:
TCAATGGGGCCACAACAAGA。
in the invention, the Rchr2-19158899 primer pair is designed according to sequences of 100bp before and after single-base variation at the 19158899 position on the cord orange chromosome chr 2.
In the invention, the Rchr6-20236059 primer pair comprises an Rchr6-20236059 upstream primer and an Rchr6-20236059 downstream primer, wherein the Rchr6-20236059 upstream primer has a nucleotide sequence shown in SEQ ID No.23, and the specific sequence is shown as follows:
TGATTGCAGTTGAGACGGGC；
the downstream primer of the Rchr6-20236059 has a nucleotide sequence shown as SEQ ID No.24, and the specific sequence is shown as follows:
AGTCTCTGCTCTTCAGGAGT。
in the invention, the Rchr6-20236059 is designed according to 100bp sequences before and after single-base variation at the 20236059 position on the cord orange chromosome chr 6.
The invention also provides a method for identifying navel oranges, which comprises the following steps:
1) extracting sample genome DNA, performing PCR amplification by using a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair and a Schr6-20236059 primer pair which are described in the technical scheme, performing Sanger sequencing on the obtained Schr3-5163123 product, a Schr3-7185873 product, a Schr4-16844636 product, a Schr7-2452525 product, a Schr2-19158899 product and a Schr6-20236059 product, introducing the obtained sequencing result into a Mutation Suryor V4.0.9 software, and respectively obtaining a Schr 3-3 peak map, a Schr3 peak map and a Schr 3-3 peak map;
2) extracting sample genome DNA and common sweet orange genome DNA, and performing high-resolution melting curve analysis on the sample genome DNA and the common sweet orange genome DNA by using an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair and an Rchr6-20236059 primer pair which are described in the technical scheme to respectively obtain an Rchr3-5163123 peak map, an Rchr3-7185873 peak map, an Rchr4-16844636 peak map, an Rchr7-2452525 peak map, an Rchr2-19158899 peak map and an Rchr6-20236059 peak map;
when the nucleotide at the chr3:5163123 site in the Schr3-5163123 peak diagram of the step 1) is GA,
and/or when the nucleotide at the chr3:7185873 site in the Schr3-7185873 peak diagram is GA,
and/or when the nucleotide at the chr4:16844636 site in the Schr4-16844636 peak diagram is TA,
and/or when the nucleotide at the chr7-2452525 site in the Schr7-2452525 peak diagram is GC,
and/or when the nucleotide at the chr2:19158899 site in the Schr2-19158899 peak diagram is A,
and/or when the nucleotide at the chr6:20236059 site in the Schr6-20236059 peak diagram is CT;
and/or when there is an upper curve at the chr3:5163123 site in the step 2) Rchr3-5163123 peak diagram,
and/or when there is an upper curve at the chr3:7185873 site in the diagram of the peaks of the Rchr3-7185873,
and/or when there is an upper curve at the chr4:16844636 site in the diagram of the peaks of the Rchr4-16844636,
and/or when there is a lower curve at the chr7-2452525 site in the diagram of the peaks of the Rchr7-2452525,
and/or when there is a lower curve at the chr2:19158899 site in the diagram of the peaks of the Rchr2-19158899,
and/or when there is an upper curve at the chr6:20236059 site in the Rchr6-20236059 peak pattern; the sample is identified as navel orange;
the step 1) and the step 2) are not limited in time sequence.
According to the invention, a sample genome DNA is extracted, PCR amplification is carried out by using a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair and a Schr6-20236059 primer pair which are described in the technical scheme, the obtained Schr3-5163123 product, a Schr3-7185873 product, a Schr4-16844636 product, a Schr7-2452525 product, a Schr2-19158899 product and a Schr6-20236059 product are subjected to Sanger sequencing, and the obtained sequencing result is introduced into a Mutation Surver V4.0.9 software to respectively obtain a Schr 3-3 peak map, a Schr3 peak map and a Schr 3-3 peak map.
The method for extracting the sample genome DNA is not particularly limited, and a conventional method for extracting the plant genome is adopted, and in the embodiment of the invention, the extraction is preferably carried out by adopting an improved CTAB method.
In the present invention, the PCR amplification system preferably comprises, per 20. mu.l: 80ng of sample genomic DNA, 10. mu.l of 2 XPPhantaMax Buffer, 0.4. mu.l of dNTP, 0.4. mu.l of PhantaMax Super-Fidelity DNApolymerase, at a concentration of 10. mu. mol/L of upstream primer 0.5. mu.l, at a concentration of 10. mu. mol/L of downstream primer 0.5. mu.l, and the balance ddH2O。
In the present invention, the PCR conditions preferably include: 3min at 95 ℃; 34 cycles of: annealing at 95 ℃ for 15s, annealing at 49-55 ℃ for 15s, and annealing at 72 ℃ for 1 min; 5min at 72 ℃; .
In the present invention, when a Schr3-7185873 primer pair, a Schr2-19158899 primer pair, a Schr6-20236059 primer pair or a Schr3-5163123 primer pair is used, the annealing temperature is preferably 53 ℃.
In the present invention, when the primer set of Schr7-2452525 is used, the annealing temperature is preferably 49 ℃.
In the present invention, when the primer set of Schr4-16844636 is used, the annealing temperature is preferably 55 ℃.
The method for Sanger sequencing used in the invention is not particularly limited, and the method for sequencing by adopting the routine sequencing method of the technicians in the field can be adopted.
The method extracts sample genome DNA and common sweet orange genome DNA, and performs high-resolution melting curve analysis on the sample genome DNA and the common sweet orange genome DNA by using an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair and an Rchr6-20236059 primer pair which are described in the technical scheme to respectively obtain an Rchr3-5163123 peak diagram, an Rchr3-7185873 peak diagram, an Rchr4-16844636 peak diagram, an Rchr7-2452525 peak diagram, an Rchr2-19158899 peak diagram and an Rchr6-20236059 peak diagram;
when the nucleotide at the chr3:5163123 site in the Schr3-5163123 peak diagram of the step 1) is GA,
and/or when the nucleotide at the chr3:7185873 site in the Schr3-7185873 peak diagram is GA,
and/or when the nucleotide at the chr4:16844636 site in the Schr4-16844636 peak diagram is TA,
and/or when the nucleotide at the chr7-2452525 site in the Schr7-2452525 peak diagram is GC,
and/or when the nucleotide at the chr2:19158899 site in the Schr2-19158899 peak diagram is A,
and/or when the nucleotide at the chr6:20236059 site in the Schr6-20236059 peak diagram is CT;
and/or when there is an upper curve at the chr3:5163123 site in the step 2) Rchr3-5163123 peak diagram,
and/or when there is an upper curve at the chr3:7185873 site in the diagram of the peaks of the Rchr3-7185873,
and/or when there is an upper curve at the chr4:16844636 site in the diagram of the peaks of the Rchr4-16844636,
and/or when there is a lower curve at the chr7-2452525 site in the diagram of the peaks of the Rchr7-2452525,
and/or when there is a lower curve at the chr2:19158899 site in the diagram of the peaks of the Rchr2-19158899,
and/or when there is an upper curve at the chr6:20236059 site in the Rchr6-20236059 peak pattern; the sample was identified as navel orange.
The method for extracting the sample genomic DNA and the common sweet orange genomic DNA is not particularly limited, and a method for extracting the plant genomic DNA by a person skilled in the art is adopted, and in the embodiment of the invention, the modified CTAB method is specifically adopted for extraction, if the primer pairs of Rchr3-5163123, Rchr3-7185873, Rchr4-16844636, Rchr7-2452525, Rchr2-19158899 or Rchr6-20236059 are used, the concentration of the genomic DNA is adjusted to be consistent, the error is not more than 3 ng/mul, and the concentration of the genomic DNA is preferably 25 ng/ul.
In the present invention, the high resolution melting curve analysis preferably uses a system comprising, per 20. mu.l: 25ng sample genomic DNA or common sweet orange genomic DNA, 10. mu.l Mastermix, 2.4. mu.l MgCl2The concentration of the upstream primer is 10 mu mol/L and the concentration of the downstream primer is 10 mu mol/L, the concentration of the upstream primer is 0.4 mu L, the rest is ddH2O。
In the present invention, the high resolution melting curve analysis is preferably performed in a LightCycler480 II real-time fluorescent quantitative PCR instrument (Roche, USA).
In the present invention, the high resolution melting curve analysis uses the procedure shown in table 1:
TABLE 1 procedure used for high resolution melting curve analysis
In the invention, the annealing temperature of the Rchr3-7185873 primer pair and the Rchr4-16844636 primer pair is preferably 57 ℃; the annealing temperature of the Rchr7-2452525 primer pair, the Rchr3-5163123 primer pair, the Rchr2-19158899 primer pair and the Rchr6-20236059 primer pair is preferably 55 ℃.
The invention also provides a kit which comprises the primer pair used for the molecular marker amplification in the technical scheme. The volume of the primer pair placed in the kit is not particularly limited, and the conventional kit is adopted to place the volume of the primer pair. The concentration of the primer pair is not particularly limited in the present invention, and the concentration of the primer pair is determined by adopting the conventional placement method, and in the embodiment of the present invention, the concentration of the upstream primer and the concentration of the downstream primer of the primer pair are preferably 10 μmol/L independently.
The invention also provides application of the molecular marker or the kit in the technical scheme in identifying navel oranges and common sweet oranges.
In the invention, the variety of the navel orange is preferably luoqin, huaqin, qingjia, red flesh navel orange, long red, powell, xiajin, mengqin, nuhel or long red.
In the present invention, the variety of the common sweet orange is preferably red sweet orange, summer orange, early gold, eula, new orange, peach leaf orange, desert orange XP2 or orange in Jing county.
The molecular marker for identifying navel orange and the method, application and kit for identifying navel orange provided by the invention are described in detail in the following with reference to the examples, but they should not be construed as limiting the scope of the invention.
Example 1
1. Extracting the genomic DNA of navel oranges (Roots, Huaqin, Qingjia, red flesh navel orange, Changhong, Baoweer, Xiajin, dream navel, Newhall and Changhong red), the genomic DNA of common sweet oranges (scarlet sweet orange, Valencia orange, Zaijin, Eula, Xinhui orange, brocade orange, peach leaf orange, desert pedicel, Hunan sweet orange XP2 and Jing county blood orange), and the genomic DNA of varieties to be identified, wherein in the embodiment, the modified CTAB method is adopted to extract the genomic DNA;
2. amplifying genomic DNA by using a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair or a Schr6-20236059 primer pair to analyze the genomic DNA of navel oranges, common sweet oranges and varieties to be identified;
PCR amplification and identification of navel oranges using Sanger sequencing:
PCR amplification was performed using a 20. mu.l reaction: comprising 80ng of template DNA, 10ul of 2X Phanta Max Buffer, 0.4. mu.l dNTP (10 mmol. multidot.L each)-1) 0.4. mu.l of Phanta Max Super-Fidelity DNApolymerase (1U/. mu.l), 0.5. mu.l of forward primer (10. mu. mol. L)-1) 0.5. mu.l reverse primer (10. mu. mol. L)-1) Filling sterilized ultrapure water to 20 mul; the amplification reaction was performed in a PTC-200 PCR instrument (mj. research inc., USA);
the specific steps of PCR amplification are as follows: pre-denaturation at 95 ℃ for 3 min; followed by 34 cycles: denaturation at 95 ℃ for 15s, annealing for 15s (chr3-7185873, chr2-19158899, chr6-20236059, chr3-5163123 primer at 53 ℃, chr7-2452525 primer at 49 ℃, chr4-16844636 primer at 55 ℃), and extension at 72 ℃ for 1 min; finally, final extension is carried out at 72 ℃ for 5 min; the amplified products are directly sequenced to obtain a sequencing peak image, the sequencing peak images of the navel orange and the common sweet orange are introduced into MutationSurveyor V4.0.9 software, and the single nucleotide variation of the target position of the sequence is checked, and the results are shown in figures 1-1, 2-1, 3-1, 4-1, 5-1 and 6-1.
From FIG. 1-1, it can be concluded that the Sanger sequencing peak pattern of the amplified fragments at chr3:5163123 for navel orange and common sweet orange, the navel orange is GA bimodal at the target site, and the common sweet orange is unimodal G at the target site; from FIG. 2-1, it can be derived that the Sanger sequencing peak patterns of the amplified fragments at chr3:7185873 of navel orange and common sweet orange, the navel orange is GA bimodal at the target site, and the common sweet orange is unimodal G at the target site; from FIG. 3-1, it can be derived that the Sanger sequencing peak patterns of the amplified fragments at chr4:16844636 of navel orange and common sweet orange, the navel orange is TA bimodal at the target site, and the common sweet orange is T unimodal at the target site; from FIG. 4-1, it can be concluded that the Sanger sequencing peak pattern of the amplified fragments at chr7:2452525 for navel orange and common sweet orange, where navel orange is GC, bimodal at the target site, and common sweet orange is C, unimodal at the target site; from FIG. 5-1, it can be concluded that the Sanger sequencing peak pattern of the amplified fragments at chr2:19158899 for navel orange and common sweet orange, navel orange is unimodal A at the target site, and common sweet orange is unimodal G at the target site; from fig. 6-1, it can be concluded that Sanger sequencing peak patterns of amplified fragments at chr6:20236059 of navel orange and common sweet orange are CT doublet at target site, while common sweet orange is singlet C at target site. If the sequencing result of the genomic DNA of the variety to be identified is consistent with that of the common sweet orange, the variety is the common sweet orange, and if the sequencing result is consistent with that of the navel orange, the variety is the navel orange.
Example 2
1. In this example, genomic DNA of navel oranges (Roots, Huaqin, Qingjia, red flesh navel orange, Chanhong, Bawell, Xiajin, dream navel, Newhall, Changhou, Chanhong), general sweet oranges (red sweet orange, Valencia, Zaojin, Eula, Xinhui orange, Jinzhou, peach leaf orange, desert pedicel, Hunan sweet orange XP2, blood orange in Jing county), and sweet orange varieties to be identified were prepared, and genomic DNA was extracted by a modified CTAB method and the DNA concentration was adjusted to be uniform (25ng/ul) with an error of not more than 3 ng/ul.
2. Genomic DNA is amplified by using an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair or an Rchr6-20236059 primer pair, a high-resolution melting curve of an amplification product is obtained, and genomic DNA of navel oranges, common sweet oranges (without navel) and varieties to be identified is analyzed.
The method for identifying navel oranges by using a high-resolution melting curve system comprises the following steps:
PCR amplification was performed using a 20. mu.l reaction system containing 25ng of template DNA, 10. mu.l of Mastermix (Roche, USA), 2.4. mu.l of MgCl2(kit of Roche Co., Ltd.), 0.4. mu.l of a forward primer (10. mu. mol. L.)-1) 0.4. mu.l reverse primer (10. mu. mol. L)-1) The amount of water (available from Roche) was adjusted to 20. mu.l;
the amplification reaction was carried out in a LightCycler480 II real-time fluorescent quantitative PCR instrument (Roche, USA) with the specific procedure set up as shown in Table 1 or with reference to the instructions of LightCycler480 II, and the results are shown in FIGS. 1-2, 2-2, 3-2, 4-2, 5-2 and 6-2.
1-2, the difference graph of the high-resolution melting curves of the amplified fragments of the navel orange and the common sweet orange at chr3:5163123 is shown, wherein the upper layer clustering curve is the navel orange, and the lower layer clustering curve is the common sweet orange; from FIG. 2-2, it can be seen that the melting curves of the amplified fragments of navel orange and common sweet orange at chr3:7185873 are shown, the upper clustering curve is navel orange, and the lower clustering curve is common sweet orange; 3-2, the difference graph of the high-resolution melting curves of the amplified fragments of the navel orange and the common sweet orange at chr4:16844636 is shown, the upper clustering curve is the navel orange, and the lower clustering curve is the common sweet orange; 4-2, the difference graph of the high-resolution melting curves of the amplified fragments of the navel orange and the common sweet orange at chr7:2452525 is shown, the upper clustering curve is the common sweet orange, and the lower clustering curve is the navel orange; 5-2, the difference graph of the high-resolution melting curves of the amplified fragments of the navel orange and the common sweet orange at chr2:19158899 is shown, wherein the upper clustering curve is the common sweet orange, and the lower clustering curve is the navel orange; from fig. 6-2, it can be seen that the difference between the high-resolution melting curves of the amplified fragments of navel orange and common sweet orange at chr6:20236059 shows that the upper clustering curve is navel orange and the lower clustering curve is common sweet orange. And (3) determining that the high-resolution melting curve of the genomic DNA of the variety to be identified is the common sweet orange if the high-resolution melting curve is consistent with the common sweet orange, and determining that the high-resolution melting curve is the navel orange if the high-resolution melting curve is consistent with the navel orange.
The above embodiments show that the molecular marker provided by the invention can cover the genome of navel orange, and the primers for amplifying the molecular marker can be used for identifying the DNA of the navel orange and common sweet orange as well as early seedling stage.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of agriculture in Huazhong
<120> molecular marker for identifying navel orange, and method, application and kit for identifying navel orange
<160>24
<170>SIPOSequenceListing 1.0
<210>1
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
acaacttttc aactccctct acca 24
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
agcaacaatc tccaacgcct g 21
<210>3
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tcaaccagag acaccaggga c 21
<210>4
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cgccttccaa gttttgttct a 21
<210>5
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tttatgcgaa cgagggcttt g 21
<210>6
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gccacaaatt aatgggcttc tca 23
<210>7
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
caattatcaa gtaggtaact ttta 24
<210>8
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tgaccctata gtgtaatgtg tg 22
<210>9
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
aaagaatgtg ttgtacggga t 21
<210>10
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
tatggcagtt agggagaagt c 21
<210>11
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
aatagttctt ttttaccccc tc 22
<210>12
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
acccttacac tttactcctt cc 22
<210>13
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
ggagcatcgc gaatttggag 20
<210>14
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
tttccttgcc atataatttc tgca 24
<210>15
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
ccccaggaat gatgatgcca 20
<210>16
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
cctggaacgc tttctttcac g 21
<210>17
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
atagcagaat gcctaccctg c 21
<210>18
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
ggaggcaata agtgggagct t 21
<210>19
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
ggttgagatg gaggagtagg aatt 24
<210>20
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
acaacactac ccactttgcg 20
<210>21
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
<210>22
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>22
tcaatggggc cacaacaaga 20
<210>23
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>23
tgattgcagt tgagacgggc 20
<210>24
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>24
agtctctgct cttcaggagt 20
Claims (4)
1. Identifying a molecular marker combination of navel oranges, wherein a primer pair combination used for amplifying the molecular marker combination comprises a Schr3-5163123 primer pair, a Schr3-7185873 primer pair, a Schr4-16844636 primer pair, a Schr7-2452525 primer pair, a Schr2-19158899 primer pair, a Schr6-20236059 primer pair, an Rchr3-5163123 primer pair, an Rchr3-7185873 primer pair, an Rchr4-16844636 primer pair, an Rchr7-2452525 primer pair, an Rchr2-19158899 primer pair and an Rchr6-20236059 primer pair;
the primer pair of the Schr3-5163123 comprises an upstream primer of the Schr3-5163123 and a downstream primer of the Schr3-5163123, the nucleotide sequence of the upstream primer of the Schr3-5163123 is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer of the Schr3-5163123 is shown as SEQ ID No. 2;
the primer pair of the Schr3-7185873 comprises an upstream primer of the Schr3-7185873 and a downstream primer of the Schr3-7185873, the nucleotide sequence of the upstream primer of the Schr3-7185873 is shown as SEQ ID No.3, and the nucleotide sequence of the downstream primer of the Schr3-7185873 is shown as SEQ ID No. 4;
the primer pair of the Schr4-16844636 comprises an upstream primer of the Schr4-16844636 and a downstream primer of the Schr4-16844636, the nucleotide sequence of the upstream primer of the Schr4-16844636 is shown as SEQ ID No.5, and the nucleotide sequence of the downstream primer of the Schr4-16844636 is shown as SEQ ID No. 6;
the primer pair of the Schr7-2452525 comprises an upstream primer of the Schr7-2452525 and a downstream primer of the Schr7-2452525, the nucleotide sequence of the upstream primer of the Schr7-2452525 is shown as SEQ ID No.7, and the nucleotide sequence of the downstream primer of the Schr7-2452525 is shown as SEQ ID No. 8;
the primer pair of the Schr2-19158899 comprises an upstream primer of the Schr2-19158899 and a downstream primer of the Schr2-19158899, the nucleotide sequence of the upstream primer of the Schr2-19158899 is shown as SEQ ID No.9, and the nucleotide sequence of the downstream primer of the Schr2-19158899 is shown as SEQ ID No. 10;
the primer pair of the Schr6-20236059 comprises an upstream primer of the Schr6-20236059 and a downstream primer of the Schr6-20236059, the nucleotide sequence of the upstream primer of the Schr6-20236059 is shown as SEQ ID No.11, and the nucleotide sequence of the downstream primer of the Schr6-20236059 is shown as SEQ ID No. 12;
the Rchr3-5163123 primer pair comprises an Rchr3-5163123 upstream primer and an Rchr3-5163123 downstream primer, the nucleotide sequence of the Rchr3-5163123 upstream primer is shown as SEQ ID No.13, and the nucleotide sequence of the Rchr3-5163123 downstream primer is shown as SEQ ID No. 14;
the primer pair of the Rchr3-7185873 comprises an Rchr3-7185873 upstream primer and an Rchr3-7185873 downstream primer, the nucleotide sequence of the Rchr3-7185873 upstream primer is shown as SEQ ID No.15, and the nucleotide sequence of the Rchr3-7185873 downstream primer is shown as SEQ ID No. 16;
the primer pair of the Rchr4-16844636 comprises an Rchr4-16844636 upstream primer and an Rchr4-16844636 downstream primer, the nucleotide sequence of the Rchr4-16844636 upstream primer is shown as SEQ ID No.17, and the nucleotide sequence of the Rchr4-16844636 upstream primer is shown as SEQ ID No. 18;
the primer pair of the Rchr7-2452525 comprises an Rchr7-2452525 upstream primer and an Rchr7-2452525 downstream primer, the nucleotide sequence of the Rchr7-2452525 upstream primer is shown as SEQ ID No.19, and the nucleotide sequence of the Rchr7-2452525 downstream primer is shown as SEQ ID No. 20;
the primer pair of the Rchr2-19158899 comprises an Rchr2-19158899 upstream primer and an Rchr2-19158899 downstream primer, the nucleotide sequence of the Rchr2-19158899 upstream primer is shown as SEQ ID No.21, and the nucleotide sequence of the Rchr2-19158899 downstream primer is shown as SEQ ID No. 22;
the primer pair of the Rchr6-20236059 comprises an upstream primer of the Rchr6-20236059 and a downstream primer of the Rchr6-20236059, wherein the nucleotide sequence of the upstream primer of the Rchr6-20236059 is shown as SEQ ID No.23, and the nucleotide sequence of the downstream primer of the Rchr6-20236059 is shown as SEQ ID No. 24.
2. A method for identifying navel oranges comprises the following steps:
1) extracting genomic DNA of a sample, and respectively carrying out PCR amplification and sequencing analysis by using the primer pair Schr3-5163123, the primer pair Schr3-7185873, the primer pair Schr4-16844636, the primer pair Schr7-2452525, the primer pair Schr2-19158899 and the primer pair Schr6-20236059 as described in claim 1, wherein each 20 microliter of PCR amplification system comprises: 80ng of sample genomic DNA, 10. mu.l of 2 XPphanta Max Buffer, 0.4. mu.l of dNTP, 0.4. mu.l of Phanta Max Super-Fidelity DNA Polymerase at a concentration of 10. mu. mol/L of upstream primer 0.5. mu.l, 10. mu. mol/L of downstream primer 0.5. mu.l, and the balance ddH2O; the PCR amplification conditions include: 3min at 95 ℃; 34 cycles of: annealing at 95 ℃ for 15s, annealing at 49-55 ℃ for 15s, and annealing at 72 ℃ for 1 min; 5min at 72 ℃;
the annealing temperature is 53 ℃ when a Schr3-7185873 primer pair, a Schr2-19158899 primer pair, a Schr6-20236059 primer pair or a Schr3-5163123 primer pair is used; the annealing temperature was 49 ℃ when using the Schr7-2452525 primer pair; the annealing temperature was 55 ℃ when using the Schr4-16844636 primer pair;
carrying out Sanger sequencing on the obtained Schr3-5163123 product, Schr3-7185873 product, Schr4-16844636 product, Schr7-2452525 product, Schr2-19158899 product and Schr6-20236059 product, and introducing the obtained sequencing result into Mutation Surveyor V4.0.9 software to respectively obtain a Schr3-5163123 peak diagram, a Schr3-7185873 peak diagram, a Schr4-16844636 peak diagram, a Schr7-2452525 peak diagram, a Schr2-19158899 peak diagram and a Schr6-20236059 peak diagram;
2) extracting sample genome DNA and common sweet orange genome DNA, and performing high-resolution dissolution curve analysis on the sample genome DNA and the common sweet orange genome DNA by using the Rchr3-5163123 primer pair, the Rchr3-7185873 primer pair, the Rchr4-16844636 primer pair, the Rchr7-2452525 primer pair, the Rchr2-19158899 primer pair and the Rchr6-20236059 primer pair of claim 1 respectively, wherein a PCR reaction system comprises 25ng of sample genome DNA or common sweet orange genome DNA, 10 mul Master mix and 2.4 mul MgCl2The concentration is 0.4 mu L of the upstream primer of 10 mu mol/L, the concentration is 0.4 mu L of the downstream primer of 10 mu mol/L, and the rest is ddH2O；
Performing high-resolution melting curve analysis on the obtained product to respectively obtain an Rchr3-5163123 peak diagram, an Rchr3-7185873 peak diagram, an Rchr4-16844636 peak diagram, an Rchr7-2452525 peak diagram, an Rchr2-19158899 peak diagram and an Rchr6-20236059 peak diagram;
when the nucleotide at the chr3:5163123 site in the Schr3-5163123 peak diagram of the step 1) is GA,
and when the nucleotide at the chr3:7185873 site in the Schr3-7185873 peak diagram is GA,
and when the nucleotide at the chr4:16844636 site in the Schr4-16844636 peak diagram is TA,
and when the nucleotide at the chr7-2452525 site in the Schr7-2452525 peak diagram is GC,
and when the nucleotide at the chr2:19158899 site in the Schr2-19158899 peak diagram is A,
and when the nucleotide at the chr6:20236059 site in the Schr6-20236059 peak diagram is CT;
and when there is an upper curve at the chr3:5163123 site in the step 2) Rchr3-5163123 peak pattern,
and when there is an upper curve at the chr3:7185873 site in the chart of the peaks of the Rchr3-7185873,
and when there is an upper curve at the chr4:16844636 site in the chart of the peaks of the Rchr4-16844636,
and when there is a lower curve at the chr7-2452525 site in the diagram of the peaks of the Rchr7-2452525,
and when there is a lower curve at the chr2:19158899 site in the diagram of the peaks of the Rchr2-19158899,
and when there is an upper curve at the chr6:20236059 site in the diagram of the peaks of the Rchr 6-20236059; the sample is identified as navel orange;
the step 1) and the step 2) are not limited in time sequence.
3. A kit comprising a primer pair combination for the combined amplification of molecular markers according to claim 1.
4. Use of the molecular marker combination of claim 1 or the kit of claim 3 for identifying navel oranges from common sweet oranges.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663997.7A CN108754014B (en) | 2018-06-25 | 2018-06-25 | Molecular marker for identifying navel orange, method for identifying navel orange, application and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663997.7A CN108754014B (en) | 2018-06-25 | 2018-06-25 | Molecular marker for identifying navel orange, method for identifying navel orange, application and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108754014A CN108754014A (en) | 2018-11-06 |
| CN108754014B true CN108754014B (en) | 2020-10-30 |
Family
ID=63977378
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810663997.7A Active CN108754014B (en) | 2018-06-25 | 2018-06-25 | Molecular marker for identifying navel orange, method for identifying navel orange, application and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108754014B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946765A (en) * | 2015-06-25 | 2015-09-30 | 华中农业大学 | Somatic mutation site excavation method based on genomic sequencing |
-
2018
- 2018-06-25 CN CN201810663997.7A patent/CN108754014B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946765A (en) * | 2015-06-25 | 2015-09-30 | 华中农业大学 | Somatic mutation site excavation method based on genomic sequencing |
Non-Patent Citations (3)
| Title |
|---|
| NCBI Reference Sequence: NC_023048.1;Xu,Q.et al;《NCBI》;20180516;全文 * |
| QTL mapping for fruit quality in Citrus using DArTseq markers;Maiara Curtolo et al;《Curtolo et al. BMC Genomics》;20170412;摘要、图5 * |
| 柑橘CAPS 标记和AS-PCR 引物的开发;雷天刚;《园 艺 学 报》;20121231;第39卷(第6期);1027–1034 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108754014A (en) | 2018-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN112980999B (en) | SSR molecular marker of mulberry variety Yuehei 74 and core primer group, kit and application thereof | |
| CN113430300B (en) | SSR molecular marker of mulberry variety Yuehen 123, core primer group and kit thereof, and application of SSR molecular marker | |
| CN107557434A (en) | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method | |
| CN114262748B (en) | Molecular marker for identifying variety 'Yueshi 143', identifying primer group, kit and application | |
| CN112342310A (en) | Internal reference gene PP2A of glehnia littoralis as well as screening method and application thereof | |
| CN106591460B (en) | Method for identifying variety of 'Zhongcha 302' tea tree by SSR molecular marker and application | |
| CN110734996B (en) | Molecular markers linked with caffeine content of tea tree and application thereof | |
| CN108754014B (en) | Molecular marker for identifying navel orange, method for identifying navel orange, application and kit | |
| CN108977563B (en) | SSR core primer group developed based on radish whole genome sequence and application thereof | |
| CN113403417B (en) | SSR molecular marker AerM01 for sex identification of actinidia arguta and application thereof | |
| CN106755526B (en) | Functional molecular marker related to lipped and petal sepal character of cymbidium and identification method thereof | |
| KR101802585B1 (en) | Primer set for Discrimination of Aromatic Rice and Use Thereof | |
| CN110408723B (en) | SNP molecular marker linked with caffeine content of tea tree and application thereof | |
| KR101326333B1 (en) | SNP Primers for Yunpoong Distinction of Korean Ginseng (Panax ginseng C.A.Meyer) and Method for Yunpoong Distinciton Using the Same | |
| Swain et al. | Molecular diversity study on dessert banana genotypes (Musa spp.) from Odisha using ISSR markers | |
| CN108330164B (en) | Characteristic sequence, primer and identification method of apocarya variety Moore | |
| CN114438239B (en) | Molecular marker for identifying large 10 of mulberry variety Yuehong, identification primer group, kit and application | |
| CN116179748B (en) | Molecular marker primer group and kit for identifying fruit Sang Pinchong 'Yue mulberry 33' and application thereof | |
| CN114438254B (en) | InDel marker for identifying perfume coconuts and application thereof | |
| CN114438253B (en) | InDel marker for identifying Cocois malayi and application thereof | |
| Xuan | Identifying European pear (Pyrus communis L.) cultivars at the KOB by using apple SSRs | |
| CN116179736B (en) | SSR (simple sequence repeat) marker primer group for identifying strawberry varieties and application thereof | |
| CN116814839B (en) | Molecular marker AhyCs1 closely linked with peanut seed coat color speckles and application thereof | |
| CN114438249B (en) | Primer group, kit and identification method for identifying cultivation types of valium odoratum honey pomelos |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |