CN108728537A - A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene - Google Patents
A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene Download PDFInfo
- Publication number
- CN108728537A CN108728537A CN201810546743.7A CN201810546743A CN108728537A CN 108728537 A CN108728537 A CN 108728537A CN 201810546743 A CN201810546743 A CN 201810546743A CN 108728537 A CN108728537 A CN 108728537A
- Authority
- CN
- China
- Prior art keywords
- mgb
- primer
- wild
- seq
- taqman
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of primer, kit and the methods of 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene.The present invention is based on digital pcr technology platforms, it designs specific primer and specific amplified is carried out to L858R gene locis region, design marks the specificity T aqMan MGB probes of different fluorescence that saltant type, wild type DNA profiling is identified, it is analyzed by the intensity to fluorescence signal, ratio of the judgement sample with the presence or absence of mutation and mutation.The present invention is compared with quantitative PCR technique, and independent of standard items and standard curve, the copy number of target sequence is directly detected by the way of absolute quantitation, has higher sensitivity and accuracy.The present invention provides targeted therapy related gene loci abrupt information for Patients with Non-small-cell Lung, and important reference frame is provided for the accurate medication guide of lung cancer and curative effect monitoring.
Description
Technical field
The invention belongs to molecular biology fields, especially field of nucleic acid detection, and in particular to a kind of detection Human epidermal growth factor receptor base
Because of primer, kit and the method for 21 exon L858R site mutations.
Background technology
Lung cancer is the general designation of various pulmonary malignant tumours, is the highest malignant tumour of morbidity and mortality in world wide
One of, it occupies first of China's urban population Death Cause for Malignant Tumors.Lung cancer is divided into Small Cell Lung Cancer (small cell lung
Carcinoma, SCLC) and non-small cell lung cancer (non-small cell lung carcinoma, NSCLC) two classes, it is non-small thin
Born of the same parents' lung cancer accounts for about 80% or more of all cases of lung cancer, including two major classes：1) non-squamous carcinoma (including gland cancer, large cell carcinoma and other
Hypotype)；2) squamous cell (epiderm-like) cancer.
The treatment of advanced lung cancer includes chemotherapy, radiotherapy and targeted therapy, and traditional chemotherapy radiotherapy, which exists, targets indefinite, choosing
The features such as selecting property is not strong causes to bring larger side effect while reaching therapeutic effect.Targeted therapy of lung cancer refers to anti-swollen
Tumor medicine has an effect with lung carcinoma cell specificity target spot and kills tumour cell, and normal tissue influences smaller.Targeting at present
Treatment is one of the main method that lung cancer is precisely treated.
EGF-R ELISA (epidermal growth factor receptor, EGFR) is a kind of cross-film junket ammonia
Acid kinase receptor, EGFR gene are located at No. 7 regions the short arm of a chromosome 7p12~14 of the mankind, are made of 28 exons, opposite point
Protonatomic mass is 170KD.Activate related with signal paths such as tumor cell proliferation, transfers in kinase activation region.EGFR is mutated
It occurs mainly on the first four exon in the region intracellular tyrosine kinase (TK) (18~21), presently found TK region mutagenesis
There is more than 30 kinds.Asian ancestry crowd's patients with lung adenocarcinoma EGFR gene sensitizing mutation rate is higher than Caucasia crowd.The table clinically used
Skin growth factor receptor tyrosine kinase inhibitors (epidermal growth factor receptor tyrosine
Kinase inhibitors, EGFR-TKIs) Gefitinib, Tarceva, angstrom can replace Buddhist nun, Afatinib, for there are EGFR
Advanced Non-small cell lung (non-small cell lung cancer, the NSCLC) patient of gene sensitizing mutation, and it is traditional
Treatment is compared, and Progression free survival (progressionfree survival, the PFS) time of patient can be significantly extended, simultaneously because
The smaller side effect of targeted therapy can improve the life quality and curative compliance of patient.On 21 exon of Human epidermal growth factor receptor gene
L858R is common one of EGFR-TKIs sensitizing mutations, and EGFR- can be predicted in the quantitative detection for EGFR gene L858R mutation
Validity of the TKIs in patients with lung cancer, the mutation abundance and EGFR-TKI curative effects of L858R is related with prognosis, therefore EGFR gene
The important indicator that L858R abrupt climatic changes have become the guidance of NSCLC patient medications and curative effect monitoring must refer to.
The detection technique of gene mutation at present mainly has generation sequencing, the sequencing of two generations, ARMS-PCR detections, digital pcr inspection
Survey etc..Generation sequencing, ARMS-PCR are detected as qualitative detection, and sensitivity is poor；High-flux sequence is quantitatively detection, but operation stream
Journey is complicated, and higher to personnel and instrument requirements, testing cost is more expensive；Digital pcr is by the way of absolute quantitation, independent of mark
Quasi- product and standard curve, directly detect the copy number of target sequence, and this detection mode has higher sensitivity, accuracy and warp
Ji property.
Invention content
A kind of detection Human epidermal growth factor receptor gene is provided it is an object of the invention to overcome the shortcomings of the prior art place
The primer of 21 exon L858R site mutations, the present invention provides a kind of 21 exons of detection Human epidermal growth factor receptor gene L858R
The kit of point mutation, the present invention also provides a kind of methods of 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene.
To achieve the above object, the technical solution taken：A kind of 21 sites exon L858R of detection Human epidermal growth factor receptor gene
The primer of mutation, including forward primer and reverse primer；The forward primer includes such as SEQ ID NO:1~SEQ ID NO:3
Shown at least one of nucleotide sequence；Shown reverse primer includes such as SEQ ID NO:4,SEQ ID NO:Shown in 5
At least one of nucleotide sequence.
The forward primer includes at least one of following nucleotide sequence：
SEQ ID NO:1F1:GCAGCATGTCAAGATCACAGATT；
SEQ ID NO:2F2:ACACCGCAGCATGTCAAGATC；
SEQ ID NO:3F3:GAAAACACCGCAGCATGTCA。
The reverse primer contains at least one of following nucleotide sequence：
SEQ ID N O:4R1：CCTCCTTCTGCATGGTATTCTTTCT；
SEQ ID N O:5R2：CATGGTATTCTTTCTCTTCCGCA.
Preferably, the nucleotide sequence of the forward primer such as SEQ ID NO:Shown in 3, the nucleotide of shown reverse primer
Sequence such as SEQ ID NO:Shown in 5.
The present invention provides a kind of kit of 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene, including it is upper
The primer is stated, further includes the TaqMan MGB saltant type probes combined with Human epidermal growth factor receptor gene L858R mutant DNA templates,
And the TaqMan MGB wild-type probes combined with Human epidermal growth factor receptor gene L858R wild type DNA profilings, the TaqMan MGB are prominent
5 ' ends of modification probe and TaqMan MGB wild-type probes carry fluorescent reporter group, and the TaqMan MGB saltant types are visited
3 ' ends of needle and TaqMan MGB wild-type probes carry minor groove binders MGB and non-fluorescence quenching group, the TaqMan
MGB saltant types probe 5 ' holds the fluorescent reporter group carried and TaqMan MGB wild-type probes 5 ' to hold the fluorescence report base carried
Group is different.The present invention marks different fluorescence for Human epidermal growth factor receptor gene L858R site mutations type, wild-type DNA-sequence design
TaqMan MGB probes.
Preferably, the nucleotide segment of the TaqMan MGB saltant type probes contains such as SEQ ID NO:6,SEQ ID
NO:The nucleotide segment of one kind in nucleotide sequence shown in 7, the TaqMan MGB wild-type probes contains such as SEQ ID
NO:8,SEQ ID NO:One kind in nucleotide sequence shown in 9.
Preferably, the TaqMan MGB saltant type probes are：5'-FAM-CAGTTTGGCCCGCCCA-MGB-NFQ-3'
(SEQ ID NO:6), the TaqMan MGB wild-type probes are：5'-VIC-CAGTTTGGCCAGCCCA-MGB-NFQ-3'
(SEQ ID NO:8)；
Or the TaqMan MGB saltant type probes are：5'-FAM-TTGGCCCGCCCAAAC-MGB-NFQ-3'(SEQ
ID NO:7), the TaqMan MGB wild-type probes are：5'-VIC-TTGGCCAGCCCAAAC-MGB-NFQ-3'(SEQ ID
NO:9)。
It is highly preferred that the TaqMan MGB saltant type probes are：5'-FAM-CAGTTTGGCCCGCCCA-MGB-NFQ-
3'(SEQ ID NO:6), the TaqMan MGB wild-type probes are：5'-VIC-CAGTTTGGCCAGCCCA-MGB-NFQ-3'
(SEQ ID NO:8)。
Preferably, the kit further includes PCR premixed liquids, and the premixed liquid includes dNTPs, Taq enzyme and PCR bufferings
Liquid.
The present invention provides a kind of sides based on 21 exon L858R site mutations of digital pcr detection Human epidermal growth factor receptor gene
Method, the method are to detect 21 exon of Human epidermal growth factor receptor gene using primer described above or kit described above
L858R site mutations.
Preferably, method described above specifically includes following steps：
(1) genomic DNA is extracted from sample to be checked；
(2) using the genomic DNA of step (1) extraction as template, forward primer in kit described above, instead is added
Digital pcr amplification reaction system is prepared to primer, TaqMan MGB saltant types probes and TaqMan MGB wild-type probes；
(3) PCR amplification is carried out after digital pcr reaction system being divided into independent reaction system；
(4) fluorescence signal of independent reaction system is detected using detector, according to mutant egf R nucleic acid molecules
The droplet signal detecting and measuring apparatus of the fluorescence signal that the droplet signal detecting and measuring apparatus of template provides and Wild type EGFR nucleic acid templates to
The fluorescence signal gone out is different and Poisson distribution principle, calculating provide saltant type and the concentration or copy of Wild type EGFR molecule
Number and mutant egf R molecules account for the ratio of total EGFR molecules.
Preferably, every 20 μ l digital pcr amplification reaction systems include in the step (2)：10 μ l of PCR premixed liquids, 20 μM/
1.8 μ l of L forward primers, 20 μM/L reverse primers, 1.8 μ l, 10 μM/L TaqMan MGB saltant types probe, 0.5 μ l, 10 μM/L
0.5 μ l of TaqMan MGB wild-type probes, 2 μ l of template, ddH2O 3.4μl。
Preferably, the response procedures of PCR amplification are in the step (3)：95 DEG C, 10 minutes 1 cycles；94 DEG C, 30 seconds
Denaturation, 60 DEG C, annealing in 60 seconds extends 40 cycles of progress altogether；98 DEG C, 10 minutes 1 cycles；4 DEG C of holdings.
Preferably, template quality is 1ng~100ng in digital pcr amplification reaction system in the step (2).
Preferably, in the step (3) by digital pcr reaction system be divided into independent reaction system be using chip or
After droplet is split.
The beneficial effects of the present invention are：
1, the present invention uses TaqMan MGB probes, the quenching group of MGB probes to use non-fluorescence quenching group (Non-
Fluorescent Quencher), itself does not generate fluorescence, can substantially reduce the intensity of background signal, while on probe also
MGB modification groups are connected with, the Tm values of probe can be improved 10 DEG C or so so that the success rate of probe design greatly improves,
Reduce cost.
2, compared with fluorescent quantitative PCR technique, digital pcr is by the way of absolute quantitation, independent of standard items and mark
Directrix curve, directly detects the copy number of target sequence, and this detection mode has higher sensitivity and accuracy.It is accurate for lung cancer
Medication guide and curative effect monitoring provide important reference frame.
3, the present invention is suitable for the Fresh Frozen tissue of patients with lung cancer, paraffin-embedded tissue and peripheral blood free nucleic acid
The detection of EGFR gene L858R mutation.For NSCLC patient's clear EGFR-TKIs sensitive genes mutational site, EGFR- is instructed
TKIs is used.
4, the present invention is based on digital pcr technology platform, design specific primer carries out L858R gene locis region special
Amplification, design mark the specificity T aqMan MGB probes of different fluorescence that saltant type, wild type DNA profiling is identified, and lead to
It crosses and the intensity of fluorescence signal is analyzed, ratio of the judgement sample with the presence or absence of mutation and mutation.
Description of the drawings
Fig. 1 is EGFR gene L858R site primer result figures in normal human gene group DNA in the embodiment of the present invention 2；
Fig. 2 is EGFR gene L858R site primer result figures in H1975 cell strains DNA in the embodiment of the present invention 2.
Specific implementation mode
To better illustrate the object, technical solutions and advantages of the present invention, below in conjunction with specific embodiment to the present invention
It is described further.
Embodiment 1
To compare the amplification efficiency for not having to primer in PCR reactions, under conditions of fixed other parameters, using quantitative
PCR compares the corresponding cycle threshold of different primers system, and the results are shown in Table 1, display F3R2 primer pairs in 50% mutation rate and
5% mutation rate has lower cycle threshold, illustrates that the primer pair has more excellent amplification efficiency.
Table 1 does not have to amplification efficiency of the primer in PCR reactions
To compare susceptibility of the different probe combination in PCR reactions, under conditions of fixed other parameters, using fixed
Amount PCR compares different probe and combines corresponding cycle threshold, and the results are shown in Table 2, display SEQ ID NO:6,SEQ ID NO:8
With lower cycle threshold, illustrate that the primer pair has more excellent sensibility.
Susceptibility of 2 different probe of the table combination in PCR reactions
Embodiment 2
(1) sample：Gene containing Wild type EGFR, through ARMS-PCR and high-flux sequence detection verification EGFR L858R genes
Sport the genomic DNA of negative normal person's whole blood；Through ARMS-PCR and high-flux sequence detection verification EGFR L858R bases
Because sporting positive H1975 cell strains DNA.
(2) extracting genome DNA：Using Qiagen DNeasy Blood&Tissue Kit, with reference to kit specification
Carry out the extraction of genomic DNA.The genomic DNA of acquisition is carried out gel electrophoresis and is quantified using NanoDrop 100.
(3) EGFR gene L858R is mutated being formulated as follows for the PCR reaction solution of digital pcr detection：PCR premixed liquids Master
10 μ l of Mix, 20 μm/L sense primers, 1.8 μ l, 20 μm/L downstream primers, 1.8 μ l, 10 μm/L saltant types probe, 0.5 μ l, 10 μm/L
0.5 μ l of wild-type probe, ddH2O 3.4 μ l, the generally 18 μ l of a reaction.
(4) EGFR gene L858R is mutated the preparation of the PCR amplification system of digital pcr detection：18 μ lPCR reaction solutions are taken to add
Enter 2 μ l DNA profilings, gently vortex mixed is uniform.
(5) droplet generates：The droplet that prepared 20 μ l digital pcr amplification systems are added to 8 generates in chip, then
80 μ l droplets are added and generate preparation PCR in oil to Creator droplets generation instrument (bio tech ltd Shunde Yong Nuo)
Micro- reaction drop.
(6) the micro- reaction drops of the PCR prepared are carefully transferred on 96 hole reaction plates, are sealed with sealing plate film.
(7) 96 orifice plates sealed are put into PCR instrument, setting response procedures carry out PCR amplification, pcr amplification reaction journey
Sequence is：95 DEG C, 10 minutes 1 cycles；It 94 DEG C, is denaturalized within 30 seconds, 60 DEG C, annealing in 60 seconds extends 40 cycles of progress altogether；98 DEG C,
10 minutes 1 cycles；4 DEG C of holdings.
(8) 96 orifice plates are placed in Detector droplets detector after pcr amplification reaction (promise biotechnology has Shunde forever
Limit company) in be detected fluorescence signal, provided according to the droplet signal detecting and measuring apparatus of mutant egf R nucleic acid templates glimmering
Optical signal is different from the fluorescence signal that the droplet signal detecting and measuring apparatus of Wild type EGFR nucleic acid templates provides and Poisson distribution
Principle, using MicroDropTMThe mating Data Analysis Software of digital pcr instrument (MD Plotter Data Analysis Software) calculates prominent
The concentration or copy number and mutant egf R molecules of modification and Wild type EGFR molecule account for the ratio of total EGFR molecules.As a result
As shown in Figure 1, Figure 2.
Finally, it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention rather than is protected to the present invention
The limitation of range is protected, although being explained in detail to the present invention with reference to preferred embodiment, those skilled in the art should
Understand, technical scheme of the present invention can be modified or replaced equivalently, without departing from the essence of technical solution of the present invention
And range.
Sequence table
<110>The Guangzhou bio tech ltd Yong Nuo
The bio tech ltd Shunde Yong Nuo
<120>A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene
<130> 2018
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213>Artificial sequence
<400> 1
gcagcatgtc aagatcacag att 23
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
acaccgcagc atgtcaagat c 21
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
gaaaacaccg cagcatgtca 20
<210> 4
<211> 25
<212> DNA
<213>Artificial sequence
<400> 4
cctccttctg catggtattc tttct 25
<210> 5
<211> 23
<212> DNA
<213>Artificial sequence
<400> 5
catggtattc tttctcttcc gca 23
<210> 6
<211> 16
<212> DNA
<213>Artificial sequence
<400> 6
cagtttggcc cgccca 16
<210> 7
<211> 15
<212> DNA
<213>Artificial sequence
<400> 7
ttggcccgcc caaac 15
<210> 8
<211> 16
<212> DNA
<213>Artificial sequence
<400> 8
cagtttggcc agccca 16
<210> 9
<211> 15
<212> DNA
<213>Artificial sequence
<400> 9
ttggccagcc caaac 15
Claims (10)
1. a kind of primer of 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene, which is characterized in that including forward primer
And reverse primer；The forward primer includes such as SEQ ID NO:1~SEQ ID NO:In nucleotide sequence shown in 3 at least
It is a kind of；Shown reverse primer includes such as SEQ ID NO:4,SEQ ID NO:At least one of nucleotide sequence shown in 5.
2. primer according to claim 1, which is characterized in that the nucleotide sequence of the forward primer such as SEQ ID NO:
Shown in 3, the nucleotide sequence such as SEQ ID NO of shown reverse primer:Shown in 5.
3. a kind of kit of 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene, which is characterized in that including such as right
It is required that any primers of 1-2, further include that the TaqMan MGB combined with Human epidermal growth factor receptor gene L858R mutant DNA templates dash forward
Modification probe, and the TaqMan MGB wild-type probes that are combined with Human epidermal growth factor receptor gene L858R wild type DNA profilings, it is described
5 ' ends of TaqMan MGB saltant types probes and TaqMan MGB wild-type probes carry fluorescent reporter group, the TaqMan
3 ' ends of MGB saltant types probe and TaqMan MGB wild-type probes carry minor groove binders MGB and non-fluorescence quenching group,
The TaqMan MGB saltant types probe 5 ' holds the fluorescent reporter group carried and the end of TaqMan MGB wild-type probes 5 ' to carry
Fluorescent reporter group it is different.
4. kit according to claim 3, which is characterized in that the portions of the TaqMan MGB saltant type probes
Divide containing such as SEQ ID NO:6,SEQ ID NO:One kind in nucleotide sequence shown in 7, the TaqMan MGB wild types
The nucleotide segment of probe contains such as SEQ ID NO:8,SEQ ID NO:One kind in nucleotide sequence shown in 9.
5. kit according to claim 3, which is characterized in that the TaqMan MGB saltant type probes are：5'-FAM-
CAGTTTGGCCCGCCCA-MGB-NFQ-3 ', the TaqMan MGB wild-type probes are：5'-VIC-
CAGTTTGGCCAGCCCA-MGB-NFQ-3'；
Or the TaqMan MGB saltant type probes are：
5 '-FAM-TTGGCCCGCCCAAAC-MGB-NFQ-3 ', the TaqMan MGB wild-type probes are：5'-VIC-
TTGGCCAGCCCAAAC-MGB-NFQ-3’。
6. kit according to claim 3, which is characterized in that the kit further includes PCR premixed liquids, the premix
Liquid includes dNTPs, Taq enzyme and PCR buffer solutions.
7. a kind of method based on 21 exon L858R site mutations of digital pcr detection Human epidermal growth factor receptor gene, which is characterized in that
The method be using the primer as described in claim 1-2 is any or the kit as described in claim 3-6 is any come
Detect 21 exon L858R site mutations of Human epidermal growth factor receptor gene.
8. the method according to the description of claim 7 is characterized in that specifically including following steps：
(1) genomic DNA is extracted from sample to be checked；
(2) using the genomic DNA of step (1) extraction as template, the forward direction in any kits of claim 3-6 is added
Primer, reverse primer, TaqMan MGB saltant types probes and TaqMan MGB wild-type probes prepare digital pcr amplified reaction
System；
(3) PCR amplification is carried out after digital pcr reaction system being divided into independent reaction system；
(4) fluorescence signal of independent reaction system is detected using detector, according to mutant egf R nucleic acid templates
The droplet signal detecting and measuring apparatus fluorescence signal that provides and the droplet signal detecting and measuring apparatus of Wild type EGFR nucleic acid templates provide
Fluorescence signal difference and Poisson distribution principle, calculate saltant type and the concentration or copy number of Wild type EGFR molecule, and
Mutant egf R molecules account for the ratio of total EGFR molecules.
9. the method according to the description of claim 7 is characterized in that every 20 μ l digital pcr amplified reaction bodies in the step (2)
System includes：10 μ l of PCR premixed liquids, 20 μM/L forward primers, 1.8 μ l, 20 μM/L reverse primers, 1.8 μ l, 10 μM/L TaqMan
0.5 μ l of MGB saltant types probe, 10 μM/L TaqMan MGB wild-type probes, 0.5 μ l, 2 μ l of template, ddH2O 3.4μl。
10. the method according to the description of claim 7 is characterized in that the response procedures of PCR amplification are in the step (3)：95
DEG C, 10 minutes 1 cycles；It 94 DEG C, is denaturalized within 30 seconds, 60 DEG C, annealing in 60 seconds extends 40 cycles of progress altogether；98 DEG C, 10 minutes 1
A cycle；4 DEG C of holdings.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810546743.7A CN108728537A (en) | 2018-05-30 | 2018-05-30 | A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810546743.7A CN108728537A (en) | 2018-05-30 | 2018-05-30 | A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108728537A true CN108728537A (en) | 2018-11-02 |
Family
ID=63931308
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810546743.7A Pending CN108728537A (en) | 2018-05-30 | 2018-05-30 | A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728537A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110066873A (en) * | 2019-03-26 | 2019-07-30 | 德路通（石家庄）生物科技有限公司 | Specific primer, probe and kit based on the detection EGFR gene L858R mutation of digital pcr technology |
| CN111206099A (en) * | 2020-02-28 | 2020-05-29 | 宁波胤瑞生物医学仪器有限责任公司 | Kit for detecting L858R site mutation of EGFR gene |
| CN113373224A (en) * | 2021-06-08 | 2021-09-10 | 王旭耀 | EGFR gene typing detection method and kit based on nucleic acid tetrahedral probe modified printed gold electrode |
-
2018
- 2018-05-30 CN CN201810546743.7A patent/CN108728537A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| GEOFFREY R. OXNARD等: "Noninvasive detection of response and resistance in EGFR-mutant lung cancer using quantitative next-generation genotyping of cell-free plasma DNA", 《CLIN CANCER RES.》 * |
| J MADIC等: "Three-color crystal digital PCR", 《BIOMOL DETECT QUANTIF.》 * |
| 佚名: "Homo sapiens epidermal growth factor receptor (EGFR), RefSeqGene (LRG_304) on chromosome 7", 《NCBI》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110066873A (en) * | 2019-03-26 | 2019-07-30 | 德路通（石家庄）生物科技有限公司 | Specific primer, probe and kit based on the detection EGFR gene L858R mutation of digital pcr technology |
| CN111206099A (en) * | 2020-02-28 | 2020-05-29 | 宁波胤瑞生物医学仪器有限责任公司 | Kit for detecting L858R site mutation of EGFR gene |
| CN113373224A (en) * | 2021-06-08 | 2021-09-10 | 王旭耀 | EGFR gene typing detection method and kit based on nucleic acid tetrahedral probe modified printed gold electrode |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN104531854B (en) | Kit for detecting drug resistance of cetuximab used for metastatic colorectal cancer treatment by | |
| CN101608241B (en) | Primers and probes for detecting human K-ras gene mutation as well as reagent kit thereof | |
| CN103710460A (en) | Kit for quantitatively detecting EGFR (Epidermal Growth Factor Receptor) gene mutation and application thereof | |
| CN108728537A (en) | A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN101608240A (en) | Be used to detect primer, probe and the using method thereof of human EGFR gene sudden change | |
| CN109457018A (en) | A kind of EGFR mutated gene detection method based on multiple fluorescence PCR | |
| Yu et al. | Somatic DNA mutation analysis in targeted therapy of solid tumours | |
| CN110951843A (en) | Kit and method for detecting HER2 copy number variation of CTCs based on ddPCR | |
| CN110863051A (en) | Primer, system and kit for MET gene amplification detection | |
| CN110863053A (en) | Primer, probe and method for detecting EGFR vIII mutant | |
| CN109609645A (en) | The reagent of detection IncRNA LNC_004208 expression quantity is preparing the application in diagnosis of glioma reagent | |
| CN107937524A (en) | Mankind's KRAS gene mutation detection kit and detection method | |
| CN108728536A (en) | Primer, probe, PCR reaction solution and the kit of Human epidermal growth factor receptor gene T790M site primers | |
| CN111235240A (en) | PCR reaction solution and kit for detecting mutation at V600E locus of human BRAF gene | |
| Shen et al. | Genomic alterations identification and resistance mechanisms exploration of NSCLC With Central nervous system metastases using liquid biopsy of cerebrospinal fluid: a real-World study | |
| CN109593856A (en) | A kind of kit and preparation method thereof of detection 2 codon 12/13 of KRAS gene extron mutation | |
| CN109112187A (en) | A kind of kit for the ARMS-ddPCR detection gene mutation that closing probe mediates | |
| CN104805178A (en) | TACC3-FGFR3 fused gene sequence and its detection method and use in bladder cancer detection | |
| CN107488727A (en) | 3D digital pcrs detect primer combination of probe thing, kit and the method for KRAS and BRAF gene mutation | |
| CN105505924A (en) | Specific primer, probe and kit for detecting EGFR gene L858R locus | |
| CN113718020A (en) | Primer-probe combination and kit for detecting internal tandem repeat mutation of human leukemia FLT3 gene and application of primer-probe combination and kit | |
| Amemiya et al. | Deep targeted sequencing of cytological tumor cells using whole genome amplification | |
| CN109811041A (en) | A kind of specific primer detecting the site PIK3CA gene H1047R is to, probe and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181102 |
|
| RJ01 | Rejection of invention patent application after publication |