CN108676901A - It is a kind of to detect the method and detection kit of cow dung just - Google Patents
It is a kind of to detect the method and detection kit of cow dung just Download PDFInfo
- Publication number
- CN108676901A CN108676901A CN201810490721.3A CN201810490721A CN108676901A CN 108676901 A CN108676901 A CN 108676901A CN 201810490721 A CN201810490721 A CN 201810490721A CN 108676901 A CN108676901 A CN 108676901A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- seq
- faecalibacterium bacterium
- faecalibacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of biological technology detection, and in particular to a kind of to detect the method and detection kit of cow dung just.First, the present invention, which demonstrates, to detect cow dung just by detecting ox Faecalibacterium bacterium.Secondly, the present invention provides the detection primer and detection kit of cow dung just.The detection primer of the present invention can specificity generation band is reacted with ox Faecalibacterium bacterium, and chicken, duck, people, dog and pig Faecalibacterium bacterium cannot react, and in 6 species, primer specificity is up to 100%.When the primer of the present invention is detected for ox Faecalibacterium bacterium, minimum detection limit (LOQs) is 3273 copies/μ l, sensitivity excellent；Same species for ox fecal specimens detect, and for positive rate up to 95.8% (46/48), stability is preferable.When the detection primer and detection kit of the present invention are detected for water pollution, it can quickly judge to whether there is ox fecal pollution in water body, and position pollution sources.
Description
Technical field
The invention belongs to field of biological technology detection, and in particular to a kind of to detect the method and detection kit of cow dung just.
Background technology
Ox be distributed in the world the most extensively, most one of the large-scale livestocks of breeding stock, and beef be also audience most
One of big meat kind.International market increasingly increases the demand of beef, beef market continue it is well sold and in short supply etc. due to, generation
Boundary's cattle on the hoof feeding quantity shows a rising trend, and the livestock on hand quantity of cattle on the hoof 2010 is 10.12 hundred million, has increased to 10.27 hundred million within 2013
Head.What the increasing of cattle on the hoof quantity brought is the just pollution problem of serious cow dung, and drinking water pollution is to human body caused by excrement
Health and natural environment bring high risks.
Most of enteric infectious disease can be infected by water environment, but pollution sources are difficult to determine.Existing technology can not
Distinguish several fecal pollutions in water source, if it is possible to solve the problems, such as the tracer in fecal pollution source, it will to water pollution control
It is significant.It is traditional tracer microorganism Escherichia coli (E.coli), enterococcus faecalis category (Enterococcus spp.), double
Discrimination bacillus (Bifidobacterium), perfringens bacillus (Clostridium perfringens), melaninogenicus
(Prevotella), there are more limitations in water quality Tracing detection for Animal enterovirus etc., it is difficult to which accurate tracer water body is dirty
Dye degree.The Biological indicators of water quality monitoring can not monitor water pollution in real time, can not also position pollution source of water body.Newest research
Show：Faecalibacterium bacterium are the dominant microfloras in humans and animals enteron aisle, in different hosts enteron aisle
There are significant differences on Faecalibacterium bacterium genes.Excrement source can be distinguished according to these gene differences, it can be very big
The defect for making up traditional fecal pollution tracer microorganism.
Has mechanism using the Faecalibacterium bacterium 16S rRNA gene orders in the enteron aisles such as the mankind, dog and poultry
Otherness studies fecal pollution source in water, and determines the use of the technology and can distinguish people source excrement and dog source excrement
Caused by water pollution.However the complicated fecal pollution situation for being likely to occur in water, it only so distinguishes and is examined in water pollution
It is inadequate in survey.
Currently, there is no the report about ox Faecalibacterium bacterium, there are no for ox Faecalibacterium bacterium
The method for detecting ox fecal pollution in water body.
Therefore a kind of method and reagent detecting ox fecal pollution in water body for ox Faecalibacterium bacterium is developed
Box, primer of the invention can occur specific bond with the ox stool extract in water body, monitor water pollution in real time, and quickly
The accurate pollution sources determined in water body.The defect that traditional fecal pollution tracer microorganism can greatly be made up, carries for water environment treatment
For foundation.
Invention content
In view of this, the purpose of the present invention is to provide a kind of method of detection ox fecal pollution, it can quickly, accurately
Whether there is cow dung just in detection sample, for monitoring pollution and determines that pollution sources are significant.
To achieve the above object, the technical scheme is that：
A method of detection cow dung just, cow dung is detected just by detecting ox Faecalibacterium bacterium.
The Sequence Detection of 16S rRNA (rDNA) gene has been a kind of standard side of identification Faecalibacterium bacterium
Method.The Faecalibacterium bacterium 16S rRNA in humans and animals enteron aisle have a certain difference simultaneously.And it there is no needle at present
To the report of ox Faecalibacterium bacterium 16SrDNA gene orders, if can utilize cow dung just in
Faecalibacterium bacterium 16S rRNA gene order differences distinguish cow dung, and just it is even more impossible to true with the excrement of other frequent origins
It is fixed.
The present invention obtains bacterial 16 S rDNA sequences by the high-flux sequence to chicken, duck, people, dog, pig, ox stool extract
Row select Faecalibacterium bacterium 16SrDNA gene orders in all samples, while ox and other five kinds being come
The fecal specimens Faecalibacterium bacterium 16SrDNA gene orders in source are compared, and find specific sequence segment, and with
This devise can specific aim amplification ox Faecalibacterium bacterium 16S rDNA specific primer, and primer effect is carried out
Verification.
The present invention by high-flux sequence to six kinds of animal wastes samples (chicken, duck, people, dog, pig, ox) and analysis,
Obtain can by detect ox Faecalibacterium bacterium 16SrDNA come distinguish pollution whether the conclusion containing cow dung just, and
The conclusion is verified in subsequent experimental.
As a preferred option, above-mentioned detection ox Faecalibacterium bacterium specifically by specific primer to carry out
PCR amplification.
Further, the specific primer to sequence as shown in SEQ ID NO.1 and SEQ ID NO.2.
Those skilled in the art acquire 224 parts of animal wastes samples (chicken, duck, people, dog, pig, ox), through high-flux sequence
Obtain 984224 bacterial 16 S rDNA sequences.Database comparison is carried out as the sequence by obtained by, is picked out in all fecal specimens
Faecalibacterium bacterium 16SrDNA gene orders, and the detailed comparisons between species are, design two couples of DNA primer CFY-1
And CFY-2, CFY-1 sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2, CFY-2 sequences such as SEQ ID NO.3 and SEQ
Shown in ID NO.4.Examined through PCR, primer CFY-1 can unique identification cow dung just, primer CFY-2 do not have specificity.In 6 objects
In kind (chicken, duck, people, dog, pig, ox), up to 100%, the real-time quantitative PCR result display present invention's draws primer CFY-1 specificity
The minimum detection limit (LOQs) of object CFY is 3273copies/ μ l, and sensitivity excellent is detected with species, and positive rate reaches
95.8% (46/48) illustrates that primer CFY-1 has preferable stability.
Therefore, primer pair CFY-1 of the invention can be used for the detection of ox Faecalibacterium bacterium, have specificity
By force, the strong advantage of high sensitivity, stability.
As a preferred option, the method for detecting ox Faecalibacterium bacterium by specific primer, feature exist
In including the following steps：
1) measuring samples genomic DNA is extracted, DNA solution is obtained；
2) by the DNA solution of step 1) and ox Faecalibacterium bacterium specific primer to pcr amplification reaction is added
In liquid, PCR amplification is carried out, amplified production is obtained；
3) amplified production of electrophoresis detection step 2), has seen whether amplified band.
As a preferred option, above-mentioned pcr amplification reaction liquid includes Taq enzyme, PCR reaction buffers, MgCl2, dNTPs etc.
Common PCR reaction reagents, content are also conventional.
Further, above-mentioned pcr amplification reaction liquid includes commercially available general 2 × Taq PCR Master Mix.
As a preferred option, the specific primer of step 2) the ox Faecalibacterium bacterium is to sequence such as SEQ
Shown in ID NO.1 and SEQ ID NO.2, the PCR amplification process is：96 DEG C, 300s；96 DEG C of 30s, 54 DEG C of 30s, 32 are followed
Ring.
The second object of the present invention is to provide a kind of specific primer pair of detection ox Faecalibacterium bacterium,
Sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2.
The third object of the present invention is to provide a kind of application of primer ox fecal pollution in detecting water of purpose two,
Water pollution can be monitored in real time, and quick and precisely determines the pollution sources in water body.
To achieve the above object, the technical scheme is that：
For the present invention using ox Faecalibacterium bacterium as tracer microorganism, the primer CFY-1 of design can specificity expansion
Increase the DNA fragmentation of ox Faecalibacterium bacterium, therefore the primer of the present invention can be used just to feel for detecting cow dung in sample
Contaminate situation.
For the method for above-mentioned detection ox fecal pollution for detecting ox fecal pollution in water, primer can be with the cow dung in water body
Just specific bond occurs for extract, to which quickly whether judgement water body is contaminated, and positions pollution sources.For monitoring water body in real time
Pollution, positioning pollution source of water body are significant.
As a preferred option, above-mentioned sample is the water bodys such as drinking water, sanitary sewage, lake, river.
The fourth object of the present invention is to provide the detection kit of cow dung just in a kind of real-time monitoring water source, with group
It is easy to get at object, it is at low cost, using advantage simple, that detection efficiency is high, accuracy rate is high, there is important meaning in water pollution detection
Justice.
To achieve the above object, the technical scheme is that：
A kind of detection kit of cow dung just, it includes the specific primers pair of ox Faecalibacterium bacterium.
The kit of the present invention carries out the inspection of cow dung just Faecalibacterium bacterium using the round pcr of high sensitivity
It surveys, using specific primer to carrying out PCR amplification, can be analyzed according to amplification situation to judge cow dung just Faecalibacterium
Bacterium infection conditions.Therefore, the design of primer pair is the key that kit of the present invention.Above-mentioned specific primer is to can be with ox
The DNA specific bindings of Faecalibacterium bacterium, and ox Faecalibacterium bacterium DNA fragmentations are obtained by PCR amplification.
As a preferred option, above-mentioned specific primer to sequence as shown in SEQ ID NO.1 and SEQ ID NO.2.
Just pollution detection specificity is up to 100% to the primer pair CFY-1 cow dungs of the present invention, and minimum detection limit (LOQs) is
3273copies/ μ l, positive rate are up to 95.8%.The cow dung prepared using the primer pair is just detected product and can quickly judged
Whether detection sample is contaminated, and positions pollution sources.
As a preferred option, above-mentioned detection kit also includes Faecalibacterium bacterium universal primers pair.It is general
Control primer of the primer pair as kit.
Further, above-mentioned universal primer is to for FUP, sequence is as shown in SEQ ID NO.5 and SEQ ID NO.6.
The kit of the present invention is detected using round pcr, so can also include some other PCR institutes in kit
The conventional reagent needed, such as：Taq enzyme, PCR reaction buffers, MgCl2, dNTPs etc. it is one or more.Since such PCR is normal
It can individually be bought through market approach with reagent or voluntarily be configured, therefore specifically need which reagent being fitted into kit,
It can be actually needed and be configured according to client, can also all be fitted into kit.
In pcr amplification reaction, primer, Taq enzyme, PCR reaction buffers, MgCl2, dNTPs are usual ingredients, content
Also it is conventional.
Pcr amplification reaction system can be configured voluntarily, also can direct universal PC R amplification reaction solutions without primer with commercially available
Primer pair is added to obtain.
Thus, as a preferred option, mentioned reagent box includes 2 × Taq PCR Master Mix.
The detection kit of the present invention also may include positive control or negative control.
The positive control contains Faecalibacterium bacterium conserved sequences.Including containing Faecalibacterium bacterium
The plasmid of conserved sequence or Faecalibacterium bacterium inactivation freeze-dried powder etc..
The negative control is the solution without containing Faecalibacterium bacterium, such as ultra-pure water.
The fifth object of the present invention is to provide a kind of high-throughput detection chip of the specific primer pair comprising purpose two.
The beneficial effects of the present invention are：
1) just contamination detection method confirms that ox Faecalibacterium bacterium can conduct to cow dung provided by the invention for the first time
Cow dung just tracer microorganism in water body；
2) the specific primer CTF-1 of yoke of oxen Faecalibacterium bacterium is devised, the primer is just dirty for cow dung
Dye detection has the advantages that high specificity, high sensitivity, stability are good, when for water pollution detection, can quickly judge water body
In whether there is ox fecal pollution, and position pollution sources；
3) just detection kit is significant for Water Contamination Monitor and positioning for cow dung of the invention.
Description of the drawings
Fig. 1 is that primer CTF-1 specificity is verified in six species animal wastes.
Fig. 2 is that primer CTF-2 specificity is verified in six species animal wastes.
Fig. 3 is the quantitative PCR standard curve of primer CTF-1.
Fig. 4 is primer CTF-1 positive rate experimental section figures.
Specific implementation mode
The preferred embodiment of the present invention will be described in detail (with reference to attached drawing) below.Tool is not specified in preferred embodiment
The experimental method of concrete conditions in the establishment of a specific crime, usually according to normal condition, illustrated embodiment are to preferably be said to present disclosure
It is bright, but be not that present disclosure is only limitted to illustrated embodiment.So those skilled in the art are according to foregoing invention
Content carries out nonessential modifications and adaptations to embodiment, still falls within protection scope of the present invention.
1 design of primers of embodiment
224 parts of animal wastes samples (chicken, duck, people, dog, pig, ox) are acquired, 984224 bacteriums are obtained through high-flux sequence
16SrDNA sequences.Database comparison is carried out as the sequence by obtained by, picks out Faecalibacterium in all fecal specimens
Bacterium 16SrDNA gene orders, and the detailed comparisons between species are, obtain ox Faecalibacterium bacterium specific sequences.Cause
This supposition can be detected using ox Faecalibacterium bacterium as tracer microorganism and distinguish cow dung just, and in subsequent experimental
Verification is made to this.
Two couples of DNA primers CFY-1 and CFY-2, primer are designed for ox Faecalibacterium bacterium specific sequences
Sequence is as shown in table 1, and wherein FUP is Faecalibacterium bacterium universal primers.
1 primer sequence of table
Above-mentioned primer is synthesized, primer synthesis is completed by Mei Ji biological medicines Science and Technology Ltd..
2 specific detection of embodiment
The fecal specimens of chicken, duck, people, dog, pig, this six species of ox are detected, specific detecting step is as follows：
1) extraction sample gene group DNA：
Take chicken, duck, people, dog, pig, ox this six species totally 224 parts of fecal specimens, using MO-BIO
DNAIsolation kit extraction sample gene groups DNA；
2) specificity verification：
The genomic DNA in step 1) is taken, infraspecific DNA sample is mixed, respectively with CFY-1, CFY-2, FUP
(universal primer) is used as primer, and 7.5 microlitres of Taq PCR Master Mix (2 ×) are added, 0.5 microlitre of forward primer, reversely draw
0.5 microlitre of object, 1 microlitre of genomic DNA；And sterile water is added to 15 microlitres；PCR reacts, and reaction temperature is as follows：
①CFY-1：96 DEG C/300s of pre-degeneration, 1 cycle；96 DEG C/30s, 54 DEG C/30s, 32 cycles.
②CFY-2：96 DEG C/300s of pre-degeneration, 1 cycle；96 DEG C/30s, 54 DEG C/30s, 32 cycles.
③FUP：95 DEG C/300s of pre-degeneration, 1 cycle；94 DEG C/30s, 60 DEG C/30s, 32 cycles.
Electrophoresis detection amplified production, the result is shown in Figure 1 (CFY-1) and Fig. 2 (CFY-2).
Primer specificity figure as shown in Figure 1, just middle Faecalibacterium bacterium react generation to primer CFY-1 with cow dung
Band, other species illustrate primer CFY-1 and chicken without band, duck, people, and the Faecalibacterium bacterium in dog and swine excrement are not
It can react, and FUP has band, shows no operating error, illustrates that primer has specificity.Fig. 2 shows primer CFY-2 without spy
It is anisotropic.
Therefore, the primer CFY-1 specificity for detecting ox Faecalibacterium bacterium of the invention is 100%.
3 minimum detection limit of embodiment
1) quantitative PCR standard curve is drawn
1. target fragment expands：It using CFY-1 as primer, is expanded using regular-PCR, amplification system is 100 μ l.
2. PCR product purifies：1% agarose gel electrophoresis is configured, 100ul PCR products are added to a big well
In, after waiting for electrophoresis, gel extraction electrophoresis product under ultraviolet visualization, and PCR product is purified using QIAquick Gel Extraction Kit.
3. target fragment connect with carrier, converts：Target fragment is connected with pMD 19-T vector, and pours into DH5
In α competent escherichia coli cells.
4. screening recombinant plasmid：Blue hickie screening step 4. in Escherichia coli, select white single bacterium colony fluid nutrient medium
Expand culture.
5. extracting recombinant plasmid：Recombinant plasmid is extracted using plasmid extraction kit, detectable concentration simultaneously records.
6. diluting recombinant plasmid：Recombinant plasmid is diluted with sterile water, dilution gradient 10-1-10-9。
7. drawing standard curve：According to recombinant plasmid concentration, pMD 19-T sequences, target fragment sequence, recombination matter is calculated
Grain copy number, formula are as follows：
For required recurring number as abscissa, corresponding lg (copy number) is ordinate, and it is bent to draw standard when reaching baseline
Line.
2) minimum detection limit
Quantitative PCR standard curve as shown in Figure 3, is computed, and the minimum detection limit (LOQs) of CFY-1 is
3273copies/ μ l show that the primer of the present invention has very high sensitivity.
4 positive rate of embodiment
48 ox fecal specimens, extraction DNA carry out PCR amplification as template, according to the PCR reaction process of embodiment 2.
As a result：Experiments Results Section figure is shown in Fig. 4.There are 46 samples that can be carried out by primer CFY-1 in 48 DNA samples
Simultaneously apparent band can be seen in PCR amplification, and positive rate 95.8% illustrates that primer CFY-1 has preferable stability.
According to the above experimental result, the present invention demonstrates ox Faecalibacterium bacterium can be as cow dung in water body just
Tracer microorganism.
Further, good with high specificity, high sensitivity, stability the present invention provides cow dung just detection primer
Advantage can quickly judge to whether there is ox fecal pollution in water body, and position pollution sources when for water pollution detection.For
Water Contamination Monitor and positioning are significant.And it can be used for preparing cow dung just detection kit, and water quality is detected using it
It pollutes more convenient.
Finally illustrate, the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although with reference to compared with
Good embodiment describes the invention in detail, it will be understood by those of ordinary skill in the art that, it can be to the skill of the present invention
Art scheme is modified or replaced equivalently, and without departing from the objective and range of technical solution of the present invention, should all be covered at this
In the right of invention.
<110>Wenzhou University
<120>It is a kind of to detect the method and detection kit of cow dung just
<160> 6
<170> PatentIn version 2.1
<210> 1
<211> 22
<212> DNA
<213>Engineer's primer
<220>
<223>CFY-1 primer pair forward primers
<400> 1
TCTGTTATAAAGGAAGAAACAA 22
<210> 2
<211> 20
<212> DNA
<213>Engineer's primer
<220>
<223>CFY-1 primer pair reverse primers
<400> 2
AGTTCCGGAGTTGAGCCCCG 20
<210> 3
<211> 20
<212> DNA
<213>Engineer's primer
<220>
<223>CFY-2 primer pair forward primers
<400> 3
GGCGGAGCGGCAAGTTGGAG 20
<210> 4
<211> 21
<212> DNA
<213>Engineer's primer
<220>
<223>CFY-2 primer pair reverse primers
<400> 4
CCTCTACACCACTCAAGACCG 21
<210> 5
<211> 20
<212> DNA
<213>Engineer's primer
<220>
<223>FUP primer pair forward primers
<400> 5
CTAACTACGTGCCAGCAGCC 20
<210> 6
<211> 20
<212> DNA
<213>Engineer's primer
<220>
<223>FUP primer pair reverse primers
<400> 6
GCCTTCGCCACTGGTGTTCC 20
Claims (10)
1. a kind of detection cow dung method just, which is characterized in that the method by detect ox Faecalibacterium bacterium come
Detect ox fecal pollution.
2. according to the method described in claim 1, it is characterized by comprising the following steps：
1) measuring samples genomic DNA is extracted, DNA solution is obtained；
2) by the DNA solution of step 1) and the specific primer of ox Faecalibacterium bacterium to pcr amplification reaction liquid is added
In, PCR amplification is carried out, amplified production is obtained；
3) amplified production of electrophoresis detection step 2), has seen whether amplified band, if any being then for the positive.
3. according to the method described in claim 2, it is characterized in that, step 2) the ox Faecalibacterium bacterium it is special
As shown in SEQ ID NO.1 and SEQ ID NO.2, the PCR amplification process is property primer pair sequence：96 DEG C, 300s；96℃
30s, 54 DEG C of 30s, 32 cycles.
4. a kind of specific primer pair of detection ox Faecalibacterium bacterium, which is characterized in that the specific primer pair
Sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2.
5. application of the specific primer described in claim 4 to the ox fecal pollution in detecting water.
6. the kit of ox fecal pollution in a kind of real-time monitoring water source, which is characterized in that the kit includes ox
The specific primer pair of Faecalibacterium bacterium.
7. kit according to claim 6, which is characterized in that the specific primer is to sequence such as SEQ ID NO.1
Shown in SEQ ID NO.2.
8. kit according to claim 6, which is characterized in that the kit also includes Faecalibacterium bacterium
Universal primer pair.
9. kit according to claim 8, which is characterized in that the sequence of the universal primer pair such as SEQ ID NO.5
Shown in SEQ ID NO.6.
10. a kind of high-throughput detection chip including specific primer pair described in claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810490721.3A CN108676901A (en) | 2018-05-21 | 2018-05-21 | It is a kind of to detect the method and detection kit of cow dung just |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810490721.3A CN108676901A (en) | 2018-05-21 | 2018-05-21 | It is a kind of to detect the method and detection kit of cow dung just |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108676901A true CN108676901A (en) | 2018-10-19 |
Family
ID=63807361
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810490721.3A Pending CN108676901A (en) | 2018-05-21 | 2018-05-21 | It is a kind of to detect the method and detection kit of cow dung just |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108676901A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110129464A (en) * | 2019-05-21 | 2019-08-16 | 重庆大学 | A kind of duck excrement just pollution detection kit and its preparation and application |
| CN111455078A (en) * | 2020-04-28 | 2020-07-28 | 重庆大学 | Gene marker for monitoring water pollution source in real time and application thereof |
| WO2022032282A1 (en) * | 2020-08-06 | 2022-02-10 | Alfred E. Mann Institute For Biomedical Engineering At The University Of Southern California | Methods and reagents for microbiome analysis |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274246A (en) * | 2015-11-20 | 2016-01-27 | 华中农业大学 | Reagent kit for bovine-derived component identification and detection of multi-species provenance components in products of bovine-derived components |
| CN105603066A (en) * | 2016-01-13 | 2016-05-25 | 金锋 | Mental disorder related intestinal tract microbial marker and application thereof |
| CN105648097A (en) * | 2016-03-22 | 2016-06-08 | 重庆大学 | Dog feces pollution detection kit and preparation and application thereof |
| WO2016201053A1 (en) * | 2015-06-09 | 2016-12-15 | Regents Of The University Of Minnesota | Methods for detecting risk of having a bloodstream infection and compositions for reducing the risk |
| CN107345213A (en) * | 2017-06-07 | 2017-11-14 | 中国科学院上海高等研究院 | A kind of lysine bacillus of cow manure acid sordes of degrading and its application |
-
2018
- 2018-05-21 CN CN201810490721.3A patent/CN108676901A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016201053A1 (en) * | 2015-06-09 | 2016-12-15 | Regents Of The University Of Minnesota | Methods for detecting risk of having a bloodstream infection and compositions for reducing the risk |
| CN105274246A (en) * | 2015-11-20 | 2016-01-27 | 华中农业大学 | Reagent kit for bovine-derived component identification and detection of multi-species provenance components in products of bovine-derived components |
| CN105603066A (en) * | 2016-01-13 | 2016-05-25 | 金锋 | Mental disorder related intestinal tract microbial marker and application thereof |
| CN105648097A (en) * | 2016-03-22 | 2016-06-08 | 重庆大学 | Dog feces pollution detection kit and preparation and application thereof |
| CN107345213A (en) * | 2017-06-07 | 2017-11-14 | 中国科学院上海高等研究院 | A kind of lysine bacillus of cow manure acid sordes of degrading and its application |
Non-Patent Citations (3)
| Title |
|---|
| CHUANREN DUAN等: "Evaluation of Faecalibacterium 16S rDNA genetic markers for accurate identification of swine faecal waste by quantitative PCR", 《JOURNAL OF ENVIRONMENTAL MANAGEMENT》 * |
| GEORGIOS OIKONOMOU等: "Fecal Microbial Diversity in Pre-Weaned Dairy Calves as Described by Pyrosequencing of Metagenomic 16S rDNA. Associations of Faecalibacterium Species with Health and Growth", 《PLOS ONE》 * |
| 佚名: "GenBank:KR492859.1", 《NCBI》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110129464A (en) * | 2019-05-21 | 2019-08-16 | 重庆大学 | A kind of duck excrement just pollution detection kit and its preparation and application |
| CN111455078A (en) * | 2020-04-28 | 2020-07-28 | 重庆大学 | Gene marker for monitoring water pollution source in real time and application thereof |
| WO2022032282A1 (en) * | 2020-08-06 | 2022-02-10 | Alfred E. Mann Institute For Biomedical Engineering At The University Of Southern California | Methods and reagents for microbiome analysis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146466B (en) | Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method | |
| Higgins et al. | Genotyping of Escherichia coli from environmental and animal samples | |
| Suchodolski et al. | Application of molecular fingerprinting for qualitative assessment of small-intestinal bacterial diversity in dogs | |
| Rodrigues et al. | The Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) identification versus biochemical tests: a study with enterobacteria from a dairy cattle environment | |
| Mikulić et al. | Prevalence of thermotolerant Campylobacter spp. in chicken meat in Croatia and multilocus sequence typing of a small subset of Campylobacter jejuni and Campylobacter coli isolates | |
| CN108048588B (en) | Detection primer and detection kit for cryptococcus pyogenes | |
| CN108676901A (en) | It is a kind of to detect the method and detection kit of cow dung just | |
| CN102453762B (en) | Kit and method for detecting porcine proliferative enteropathy (PPE) pathogenic bacteria Lawsonia Intracellularis | |
| Motiwala et al. | Rapid detection and typing of strains of Mycobacterium avium subsp. paratuberculosis from broth cultures | |
| Ballesté et al. | Bifidobacterial diversity and the development of new microbial source tracking indicators | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN114774563B (en) | Detection reagent for brucellosis in dog and application | |
| CN108411015A (en) | Detect the primer and detection kit of ox fecal pollution | |
| CN113186312B (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| CN103014174B (en) | MPS (Macoplasmal Pneumoniae of Swine) PCR (Polymerase Chain Reaction) diagnostic kit | |
| CN104988233B (en) | A kind of LAMP detection method for differentiating dog meats in beef and mutton using mitochondrial DNA | |
| CN105969855A (en) | Toxoplasma gondii fluorogenic quantitative PCR (polymerase chain reaction) specific primer, kit and detecting method of toxoplasma gondii fluorogenic quantitative PCR specific primer | |
| CN106834525B (en) | Multiplex PCR detection kit for diagnosing poultry tuberculosis and detection method thereof | |
| CN104651518A (en) | Streptococcus iniae loop-mediated isothermal amplification kit and application thereof | |
| CN104946782A (en) | Dual Tem-PCR quick detection method for salmonella and escherichia coli O78 | |
| KR101437389B1 (en) | Primer set for Brucella canis strain-specific identification and method for detecting Brucella canis strain using the same | |
| CN106636394A (en) | Isothermal amplication detection kit for nucleic acid of aeromonas and detection method of isothermal amplication detection kit | |
| CN105200044A (en) | Nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 as well as application of nucleotides | |
| CN111996268A (en) | Vibrio alginolyticus double TaqMan probe real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181019 |
|
| RJ01 | Rejection of invention patent application after publication |