CN108660255A - A kind of circular rna and its application for diagnosing rsv infection - Google Patents
A kind of circular rna and its application for diagnosing rsv infection Download PDFInfo
- Publication number
- CN108660255A CN108660255A CN201810554871.6A CN201810554871A CN108660255A CN 108660255 A CN108660255 A CN 108660255A CN 201810554871 A CN201810554871 A CN 201810554871A CN 108660255 A CN108660255 A CN 108660255A
- Authority
- CN
- China
- Prior art keywords
- rsv infection
- rna
- circ
- hsa
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of molecular marker for diagnosing rsv infection, the molecular marker is the circular rna from ZC3HAV1 genes, and circBase ID are hsa_circ_0082626.The purposes and the reagent that the invention also discloses the circular rnas in screening or preparing reagent for diagnosing rsv infection are being prepared for diagnosing the purposes in rsv infection kit.The application has found that expression quantity of the circular rna in rsv infection cell significantly increases, the molecular indexes that can be detected as rsv infection, has many advantages, such as that easy, quick, sensitivity and specificity are high.
Description
Technical field
The invention belongs to technical field of biological, and in particular to it is a kind of for diagnose rsv infection circular rna and its answer
With.
Background technology
Respiratory Syncytial Virus(RSV) (Respiratory Syncytial Virus, RSV) is to cause infant, immunity low
One of lower crowd and the main viral pathogen of senile patients with lower respiratory tract infection are the primary causes of disease for leading to infants in hospital, entirely
There are about 160,000 infants to die of the relevant lower respiratory tract infection of RSV every year for ball, and health care costs are huge.Currently, removing supportive treatment
In addition, the therapeutic scheme that there is no specific RSV diseases, preventing of also the not succeeding in developing RSV vaccines that the virus infects can be with
Effectively reduce disease incident.
With the rapid development of high throughput sequencing technologies, ten hundreds of non-coding transcription products is constantly found.Research
Show that the genome sequence that the mankind only have 1%~2% has encoding histone function, without having the non-of protein coding capacity
Code area is up to 98% or more unexpectedly, has a large amount of non-coding RNAs to generate in prompter's body.Circular rna (circular RNA,
CircRNA it is) one kind characterized by covalently closed circle, the non-coding RNA point without containing 5 ' end cap and 3 ' end poly A tails
Son.Since circRNA does not have free-end, making them, there are certain repellences to RNA exonucleases.Current research is sent out
Existing, newcomers of the circRNA as non-coding RNA is closely related with the occurrence and development of a variety of diseases, is a kind of full of foreground
Biomarker and therapy target.
The study found that the zinc finger antiviral protein (ZAP) of antiviral gene ZC3HAV1 gene codes synthesis, also known as more
Polymerase -13 (PARP13) is important component of the cell to stress reaction;ZAP with the ZAP in viral RNA by reacting
Element (ZRE) interacts, and by mobilizing excretion body come degradation of rna substrate, inhibits a variety of RNA virus (including reverse transcription
Virus, α virus and filamentous virus) duplication.Currently, yet there are no for human anti-viral's gene ZC3HAV1 circular rnas generated
The expression variation of report, circular rna caused by the infection of RSV viruses also has not been reported.
Invention content
Based on this, provided a kind of for diagnosing it is an object of the invention to overcome above-mentioned the deficiencies in the prior art place
The kit of rsv infection, energy quick diagnosis rsv infection have many advantages, such as that easy, quick, sensitivity and specificity are high.
To achieve the above object, the technical solution adopted by the present invention is:A kind of kit for diagnosing rsv infection, packet
The circBase ID containing detection are the reagent of the expression quantity of the circular rna of hsa_circ_0082626.
Preferably, the reagent includes the primer for expanding the circular rna.
Preferably, the nucleotide sequence of the primer is as shown in SEQ ID NO.2 and SEQ ID NO.3.
Preferably, the kit also includes RNA extracts reagents, cDNA reverse transcription reagents and fluorescent dye.
Mankind ZC3HAV1 genes can flip Trim generate multiple circular rnas (having included 15), including institute of the present invention
The circular rna of the circBase IDhsa_circ_0082626 stated.The circular rna length is the circular rna of 1564bp, sequence
Row are as shown in SEQ ID NO.1.
SEQ ID NO.1:5’-GAATTTATGCAAATATTCTCATGAGGTTCTCTCAGAAGAGAACTTCAAAGTCCT
GAAAAATCACGAACTCTCTGGACTGAACAAAGAGGAATTAGCAGTGCTCCTCCTCCAAAGTGATCCTTTTTTTATGC
CCGAGATATGCAAAAGTTATAAGGGAGAGGGTCGGCAGCAGATTTGTAACCAGCAGCCACCGTGTTCAAGACTCCAC
ATCTGTGACCACTTCACCCGAGGGAACTGTCGTTTTCCCAACTGCCTCCGGTCCCATAACCTGATGGACAGAAAGGT
GCTGGCCATCATGAGGGAGCACGGGCTGAACCCCGACGTGGTCCAGAACATCCAGGACATCTGCAACAGCAAGCACA
TGCAGAAGAATCCCCCAGGGCCCAGAGCTCCTTCTTCACATCGTAGAAACATGGCATATAGGGCTAGAAGCAAGAGT
AGAGATCGGTTCTTTCAGGGCAGCCAAGAATTTCTTGCGTCTGCTTCAGCGTCTGCTGAGAGGTCCTGCACACCTAG
TCCAGATCAGATCAGCCACAGGGCTTCCCTGGAGGACGCGCCTGTGGACGATCTCACCCGCAAGTTCACGTATCTGG
GGAGTCAGGATCGCGCTCGGCCTCCCTCAGGCTCGTCCAAGGCTACTGATCTTGGAGGAACAAGTCAGGCCGGGACA
AGCCAGAGGTTTTTAGAGAACGGCAGTCAAGAGGACCTCTTGCATGGAAATCCAGGCAGCACTTACCTTGCTTCCAA
TTCAACATCAGCCCCCAACTGGAAGAGCCTCACATCCTGGACGAATGACCAAGGCGCCAGGAGAAAGACTGTGTTTT
CTCCCACGCTACCTGCCGCCCGCTCTTCTCTTGGCTCTCTGCAAACACCTGAAGCTGTGACCACCAGAAAGGGCACA
GGCTTGCTTTCCTCAGACTACAGGATCATCAATGGCAAAAGTGGAACTCAGGACATCCAGCCTGGCCCTCTTTTTAA
TAATAATGCTGATGGAGTGGCCACAGATATAACTTCTACCAGATCCTTAAATTACAAAAGCACTAGCAGCGGTCACA
GAGAAATATCATCACCTAGGATTCAGGATGCTGGACCTGCTTCCCGAGATGTCCAGGCCACTGGCAGAATCGCAGAT
GATGCTGACCCAAGAGTAGCACTTGTTAACGATTCTTTATCTGATGTCACAAGTACCACATCTTCTAGGGTGGATGA
TCATGACTCAGAGGAAATTTGTCTTGACCATCTGTGTAAGGGTTGTCCGCTTAATGGTAGCTGCAGCAAAGTCCACT
TCCATCTGCCTTACCGGTGGCAGATGCTTATTGGTAAAACCTGGACGGACTTTGAGCACATGGAGACGATCGAGAAA
GGCTACTGTAACCCCGGAATCCACCTCTGTTCTGTAGGAAGTTATACAATCAATTTTCGGGTAATGAGTTGTGATTC
CTTTCCCATCCGACGCCTCTCCACTCCTTCTTCTGTCACCAAGCCAGCCAATTCTGTCTTCACCACCAAATGGATTT
GGTATTGGAAGAATGAATCTGGCACATGGATTCAGTATGGAGAAGAG-3’。
The present invention also provides the circular rnas that circBase ID are hsa_circ_0082626 to exist as molecular marker
Purposes in the reagent of screening or preparation for diagnosing rsv infection.
Circular rna of the present invention can be used for screening as molecular marker or prepare the reagent for diagnosing rsv infection.
The present invention also provides the reagents of the detection circBase ID circular rnas for being hsa_circ_0082626 to prepare
The purposes in kit for diagnosing rsv infection.
The reagent for detecting the circular rna can be used for preparing kit for diagnosing rsv infection.
Preferably, the reagent for detecting the circular rna includes the primer for expanding the circular rna.
Preferably, the nucleotide sequence of the primer is as shown in SEQ ID NO.2 and SEQ ID NO.3.
SEQ ID NO.2:5’-CAGTATGGAGAAGAGGAATT-3’.
SEQ ID NO.3:5’-TTTTGCATATCTCGGGCATA-3’.
Compared with the existing technology, beneficial effects of the present invention are:(1) present invention demonstrates from ZC3HAV1 genes,
CircBase ID are the presence of the circular rna of hsa_circ_0082626, and are studied its feature;(2) the application is sent out
A person of good sense has found that expression quantity of the circular rna in the cell of rsv infection that circBase ID are hsa_circ_0082626 is aobvious for the first time
It writes and increases, the molecular indexes that can be detected as rsv infection have many advantages, such as that easy, quick, sensitivity and specificity are high;(3)
The primer of the detection circular rna provided by the invention has many advantages, such as that high sensitivity and specificity are good.
Description of the drawings
Fig. 1 is that hsa_circ_0082626 generates schematic diagram.
Fig. 2 is hsa_circ_0082626 flip Trims site qualification result figure, wherein A:Electrophoresis result figure;B:Sequence
Analysis chart.
Fig. 3 is that hsa_circ_0082626 resists RNase R processing experimental result pictures.
Fig. 4 is distribution experiments result figures of the hsa_circ_0082626 in cell.
Fig. 5 be rsv infection A549 cells in hsa_circ_0082626 expression of results figure.
Specific implementation mode
To better illustrate the object, technical solutions and advantages of the present invention, below in conjunction with specific embodiment to the present invention
It is described further.
Embodiment 1
The present embodiment provides a kind of kit for diagnosing rsv infection, the kit includes detection circBase ID
For the primer of the expression quantity of the circular rna of hsa_circ_0082626, the primer sequence such as SEQ ID NO.2 and SEQ ID
Shown in NO.3.
The primer is synthesized by this field routine techniques, is illustratively configured to mother liquor, using ddH2O is diluted to work
Concentration.
The method that the expression quantity of the circular rna is detected using the kit is included the following steps:
(1) Total RNAs extraction:With Trizol method extracted total RNAs.
(2) reverse transcription:Utilize reverse transcription reagent box PrimeScript RT reagent Kit with gDNA Eraser
Synthesize cDNA.Reaction system is 20ul (wherein step 1 reaction solution 10ul:5×gDNA Eraser Buffer 2ul、gDNA
Eraser 1ul, RNA and the total 7ul of water;PrimeScript RT Enzyme Mix 1ul;RT Primer Mix 1ul;5×
PrimeScript Buffer 4ul;RNase Free dH2O 4ul);Reaction condition is:RNase Free dH2O 4ul;Instead
The condition is answered to be:37 DEG C, 15min;85 DEG C, 5sec;4 DEG C, ∞.
(3)qPCR:Utilize kit TB GreenTMPremix Ex TaqTMII carries out qPCR, reaction system 20ul
(wherein TB Green Premix Ex Taq II 10ul, ROX Reference Dye II 0.4ul, forward and reverse primer are each
0.8ul、ddH2O 6ul、cDNA 2ul);Reaction condition is:95 DEG C of pre-degeneration 30s;95 DEG C of denaturation 5s, 60 DEG C of annealing/extensions
34s, totally 40 recycle.
Embodiment 2
The present embodiment confirms that antiviral gene ZC3HAV1 generates circular rna hsa_circ_ by high-flux sequence
0082626。
Method:Using lung cell A549 cell sample, total serum IgE is extracted, removes rRNA, then uses RNase R enzymes
Drop, further builds library.The library built carries out RNA-Seq sequencings with Illumina HiSeq 2500, and analysis is for anti-
The relevant circular rnas of viral gene ZC3HAV1.
As a result:It is found by analysis, the circular rna derived from ZC3HAV1 genes is detected in A549 cells, sequence is such as
Shown in SEQ ID NO.1, which is 1564bp, and the indexed number in circBase databases is hsa_circ_
0082626。
Embodiment 3
The present embodiment studies the feature of hsa_circ_0082626.
(1) the PCR amplification verification in hsa_circ_0082626 flip Trims site and sequence verification.
Method:According to hsa_circ_0082626 sequences, a pair of two-way primer is designed to expand comprising flip Trim site
Sequence, used primer pair includes SEQ ID NO.2 and SEQ ID NO.3.PCR expansions are carried out by template of the cDNA of cell
Increase, reaction system is 20ul (wherein Takara LA Taq 0.2ul, 10 × LA Taq Buffer 2ul, 25mM MgCl2
Each 1.0ul of 2ul, dNTP Mixture 3.2ul, cDNA Template 1ul, forward and reverse primer, ddH2O 9.6ul);Reaction
Program is:94 DEG C of pre-degeneration 5min;98 DEG C of denaturation 10s, 56 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 34 recycle;72 DEG C are prolonged
Stretch 10min.After PCR product is detected with 2.0% agarose gel electrophoresis, Guangzhou Ai Ji Bioisystech Co., Ltd is sent to be sequenced.
As a result:It includes 13 exons, circular rna hsa_circ_ that sequence analysis, which shows mankind ZC3HAV1 genes altogether,
0082626 is to be reversely connected to 3 exons 5 ' end by 6 exon, 3 ' end to be formed (Fig. 1).Agarose gel electrophoresis table
Bright, Successful amplification goes out the segment (Fig. 2) that the size comprising reverse splicing site is 150bp.Sequencing result further confirms hsa_
Circ_0082626 is formed by ZC3HAV1 genes 6 exon flip Trim to 3 exons, and arrow left end is 6 exons
End sequence, arrow right end are the homing sequence (Fig. 2) of 3 exons.
(2) hsa_circ_0082626 resists RNase R digestion
Method:(1) RNA is extracted:Cell total rna is extracted with Trizol methods;(2) RNase R processing:RNA dosages are
10ug uses 2U RNase R (negative control group ddH per microgram RNA2O polishings), 37 DEG C of incubation 10min;(3) RNA is purified:
It is dense to measure RNA later for RNase R treated RNA products RNeasy MinElute Cleanup Kit kits
Degree;(4) RNA reverse transcriptions:It is synthesized with reverse transcription reagent box PrimeScript RT reagent Kit with gDNA Eraser
CDNA, reaction condition is the same as embodiment 1;(5) real-time quantitative PCR:With kit TB GreenTMPremix Ex TaqTMII is carried out
QPCR, the total 20ul of reaction system, reaction condition is the same as embodiment 1.
As a result:CircRNA does not have free-end, therefore circRNA is to RNA exonucleases that there are certain repellences.This
In research, cell total rna further carries out RT-qPCR, testing result is as shown in figure 3, GAPDH genes after RNase R processing
Linear mRNA degradations it is most severe the 1/50 of primary quantity (about), in contrast, hsa_circ_0082626 there is no by
Degradation shows hsa_circ_0082626 tolerance RNase R digestion.In this experiment, circular rna CDR1as as positive control,
Similar with hsa_circ_0082626, circular rna CDR1as is also resistant to RNase R digestion.
(3) caryoplasm distribution experiments show that hsa_circ_0082626 is distributed mainly on cytoplasm
Method:(1) RNA is extracted:Cell is collected, kit (PARIS is usedTMKit) RNA in cytoplasm, karyon is detached
And extract, RNA concentration mensurations are carried out later;(2) RNA reverse transcriptions:Cytoplasm rna 500ng and nucleus RNA are taken respectively
500ng carries out reverse transcription, is synthesized with reverse transcription reagent box PrimeScript RT reagent Kit with gDNA Eraser
CDNA, reaction condition is the same as embodiment 1;(3) real-time quantitative PCR:With kit TB GreenTMPremix Ex TaqTMII is carried out
QPCR, the total 20ul of reaction system, reaction condition is the same as embodiment 1.
As a result:After dividing cellifugal karyon, cytoplasm RNA, karyon and hsa_circ_ in cytoplasm are detected respectively with qPCR
0082626, the Relative distribution amount of U1 snRNA (U1), GAPDH and CDR1as.Known U1 RNA are primarily targeted for karyon, GAPDH
RNA is primarily targeted for born of the same parents' cytoplasm, the reference positioned using U1 and GAPDH as karyon and cytoplasm.Experimental result such as Fig. 4 institutes
Show:U1 and GAPDH are predominantly located at nucleus and cytoplasm respectively, this experiment karyon, cytoplasm RNA is prompted to detach successfully;hsa_
Expression quantity of the circ_0082626 in cytoplasm is significantly higher than nucleus (cytoplasm and karyon rna content ratio are about 8);With
Hsa_circ_0082626 is similar, and control circular rna CDR1as is also distributed mainly on cytoplasm, is consistent with other research reports.
Embodiment 4
The expression of hsa_circ_0082626 in the lung carcinoma cell of the present embodiment research rsv infection.
(1) experimental method
1, RSV viruses are prepared and titrated with Hep2 cells, and the RSV virus titers of preparation are 1.9*108PFU/ML:RSV diseases
Poison infection can cause Hep2 lytic lesions, therefore be titrated to virus using Plaque Technique Detected.
2, with the RSV viruses infection A549 cells (MOI=1) titrated:I.e. the ratio of virus quantity and cell number is 1.
3, cell sample was collected respectively at 24 hours of infection and 48 hours, is examined using 1 kit of implementation and method
Survey the expression of hsa_circ_0082626 in cell.
(2) experimental result
The results are shown in Figure 5, and group (Mock) is uninfected by compared to control, in the cell of rsv infection group, hsa_circ_
0082626 expression is significantly raised;Wherein, the expression quantity of rsv infection 24 hours and 48 hours hsa_circ_0082626 difference
About 5 times and 10 times of control group.The result shows that rsv infection can significantly raise the expression of hsa_circ_0082626, prompt
Hsa_circ_0082626 can be used as the molecular marker of diagnosis rsv infection.
Finally, it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention rather than is protected to the present invention
The limitation of range is protected, although being explained in detail to the present invention with reference to preferred embodiment, those skilled in the art should
Understand, technical scheme of the present invention can be modified or replaced equivalently, without departing from the essence of technical solution of the present invention
And range.
SEQUENCE LISTING
<110>Attached 5th hospital of Guangzhou medical university
<120>A kind of circular rna and its application for diagnosing rsv infection
<130> 2018.5.25
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 1564
<212> DNA
<213>Homo sapiens(Homo sapiens)
<400> 1
gaatttatgc aaatattctc atgaggttct ctcagaagag aacttcaaag tcctgaaaaa 60
tcacgaactc tctggactga acaaagagga attagcagtg ctcctcctcc aaagtgatcc 120
tttttttatg cccgagatat gcaaaagtta taagggagag ggtcggcagc agatttgtaa 180
ccagcagcca ccgtgttcaa gactccacat ctgtgaccac ttcacccgag ggaactgtcg 240
ttttcccaac tgcctccggt cccataacct gatggacaga aaggtgctgg ccatcatgag 300
ggagcacggg ctgaaccccg acgtggtcca gaacatccag gacatctgca acagcaagca 360
catgcagaag aatcccccag ggcccagagc tccttcttca catcgtagaa acatggcata 420
tagggctaga agcaagagta gagatcggtt ctttcagggc agccaagaat ttcttgcgtc 480
tgcttcagcg tctgctgaga ggtcctgcac acctagtcca gatcagatca gccacagggc 540
ttccctggag gacgcgcctg tggacgatct cacccgcaag ttcacgtatc tggggagtca 600
ggatcgcgct cggcctccct caggctcgtc caaggctact gatcttggag gaacaagtca 660
ggccgggaca agccagaggt ttttagagaa cggcagtcaa gaggacctct tgcatggaaa 720
tccaggcagc acttaccttg cttccaattc aacatcagcc cccaactgga agagcctcac 780
atcctggacg aatgaccaag gcgccaggag aaagactgtg ttttctccca cgctacctgc 840
cgcccgctct tctcttggct ctctgcaaac acctgaagct gtgaccacca gaaagggcac 900
aggcttgctt tcctcagact acaggatcat caatggcaaa agtggaactc aggacatcca 960
gcctggccct ctttttaata ataatgctga tggagtggcc acagatataa cttctaccag 1020
atccttaaat tacaaaagca ctagcagcgg tcacagagaa atatcatcac ctaggattca 1080
ggatgctgga cctgcttccc gagatgtcca ggccactggc agaatcgcag atgatgctga 1140
cccaagagta gcacttgtta acgattcttt atctgatgtc acaagtacca catcttctag 1200
ggtggatgat catgactcag aggaaatttg tcttgaccat ctgtgtaagg gttgtccgct 1260
taatggtagc tgcagcaaag tccacttcca tctgccttac cggtggcaga tgcttattgg 1320
taaaacctgg acggactttg agcacatgga gacgatcgag aaaggctact gtaaccccgg 1380
aatccacctc tgttctgtag gaagttatac aatcaatttt cgggtaatga gttgtgattc 1440
ctttcccatc cgacgcctct ccactccttc ttctgtcacc aagccagcca attctgtctt 1500
caccaccaaa tggatttggt attggaagaa tgaatctggc acatggattc agtatggaga 1560
agag 1564
<210> 2
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 2
cagtatggag aagaggaatt 20
<210> 3
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 3
ttttgcatat ctcgggcata 20
Claims (8)
1. a kind of kit for diagnosing rsv infection, which is characterized in that include to detect circBase ID as hsa_circ_
The reagent of the expression quantity of 0082626 circular rna.
2. the kit according to claim 1 for diagnosing rsv infection, which is characterized in that the reagent includes amplification
The primer of the circular rna.
3. the kit according to claim 2 for diagnosing rsv infection, which is characterized in that the nucleotide of the primer
Sequence is as shown in SEQ ID NO.2 and SEQ ID NO.3.
4. according to claim 3 for diagnosing the kit of rsv infection, which is characterized in that the kit also includes
RNA extracts reagents, cDNA reverse transcription reagents and fluorescent dye.
The circular rna that 5.circBase ID are hsa_circ_0082626 is being screened or is being prepared for examining as molecular marker
Purposes in the reagent of disconnected rsv infection.
6. the reagent for detecting the circular rna that circBase ID are hsa_circ_0082626 is being prepared for diagnosing rsv infection
Purposes in kit.
7. purposes according to claim 6, which is characterized in that the reagent for detecting the circular rna includes expanding the ring
The primer of shape RNA.
8. purposes according to claim 7, which is characterized in that the nucleotide sequence of the primer such as SEQ ID NO.2 and
Shown in SEQ ID NO.3.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810554871.6A CN108660255A (en) | 2018-05-31 | 2018-05-31 | A kind of circular rna and its application for diagnosing rsv infection |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810554871.6A CN108660255A (en) | 2018-05-31 | 2018-05-31 | A kind of circular rna and its application for diagnosing rsv infection |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108660255A true CN108660255A (en) | 2018-10-16 |
Family
ID=63774347
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810554871.6A Pending CN108660255A (en) | 2018-05-31 | 2018-05-31 | A kind of circular rna and its application for diagnosing rsv infection |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108660255A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114085901A (en) * | 2021-12-21 | 2022-02-25 | 中国医学科学院输血研究所 | Application of circular RNA as Zika virus infection biomarker |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106434953A (en) * | 2016-10-27 | 2017-02-22 | 宁波大学 | Detection and application of novel molecular marker hsa-circ-0074362 for gastric cancer |
CN107937529A (en) * | 2017-12-28 | 2018-04-20 | 中南大学湘雅医院 | Diagnosis of glioma marker hsa_circ_0135404 and application |
-
2018
- 2018-05-31 CN CN201810554871.6A patent/CN108660255A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106434953A (en) * | 2016-10-27 | 2017-02-22 | 宁波大学 | Detection and application of novel molecular marker hsa-circ-0074362 for gastric cancer |
CN107937529A (en) * | 2017-12-28 | 2018-04-20 | 中南大学湘雅医院 | Diagnosis of glioma marker hsa_circ_0135404 and application |
Non-Patent Citations (2)
Title |
---|
RINY JANSSEN ET AL.: "Host Transcription Profiles upon Primary Respiratory Syncytial Virus Infection", 《JOURNAL OF VIROLOGY》 * |
樊代明: "《肿瘤研究前沿第16卷》", 31 December 2016, 西安:西安交通大学出版社 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114085901A (en) * | 2021-12-21 | 2022-02-25 | 中国医学科学院输血研究所 | Application of circular RNA as Zika virus infection biomarker |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6830496B2 (en) | Multi-positioning double tag adapter set for detecting gene mutations, and its preparation method and application | |
WO2017028753A1 (en) | Multiplex pcr primer and application thereof | |
WO2017028752A1 (en) | Multiplex pcr primer and application thereof | |
CN105734679B (en) | Nucleic acid target sequence captures the preparation method of sequencing library | |
CN111454942A (en) | Construction method for simultaneously establishing sequencing library by transcriptome and genome of same sample | |
CN108504649B (en) | Coding PCR second-generation sequencing database building method, kit and detection method | |
CN107955832A (en) | It is a set of while detect poor, deaf, phenylketonuria, the primer sets of hepatolenticular degeneration and method | |
Park et al. | Isolation of Middle East respiratory syndrome coronavirus from a patient of the 2015 Korean outbreak | |
CN110317864A (en) | A method of it is sequenced by macro transcript profile to detect pathogen | |
CN108660255A (en) | A kind of circular rna and its application for diagnosing rsv infection | |
CN109735659A (en) | A kind of primer and kit and detection method using RPA detection Procambius clarkii picornavirus | |
CN107177676B (en) | Use of long-chain non-coding RNA NONHSAT113026 as molecular marker for diagnosing kidney cancer | |
CN110734974B (en) | SNP locus combination and detection primer for cancer chemotherapy drugs | |
CN108754020A (en) | It is a kind of to be used to diagnose circular rna of rsv infection and application thereof | |
Li et al. | Comprehensive analysis of circRNAs expression profiles in different periods of MDBK cells infected with bovine viral diarrhea virus | |
CN109402269B (en) | Application of reagent for detecting miRNA-217-5p in preparation of duck intestinal stress detection reagent | |
CN108624589B (en) | Circular RNA circ-ERBB2, detection reagent and application thereof | |
Li et al. | Characterization of MicroRNA cargo of extracellular vesicles isolated from the plasma of Schistosoma japonicum-infected mice | |
WO2022134225A1 (en) | Marker gene for identifying and classifying dpc cell, screening method therefor and use thereof | |
CN116042610A (en) | Detection probe combination of dynamic mutation STR locus and sequencing analysis method | |
CN108384785A (en) | Circular rna circ-GPC3 and its detection reagent and application | |
CN108486230B (en) | Kit for noninvasive detection of MITF gene mutation and preparation method thereof | |
CN108103173B (en) | Method for constructing mouse miRNA sequencing library for high-throughput sequencing | |
CN109811052A (en) | A kind of kit and gene panel detecting idiopathic azoospermatism | |
CN110714097A (en) | Method for simultaneously detecting A, B, C three groups of rotaviruses |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181016 |
|
RJ01 | Rejection of invention patent application after publication |