CN108754020A - It is a kind of to be used to diagnose circular rna of rsv infection and application thereof - Google Patents
It is a kind of to be used to diagnose circular rna of rsv infection and application thereof Download PDFInfo
- Publication number
- CN108754020A CN108754020A CN201810554782.1A CN201810554782A CN108754020A CN 108754020 A CN108754020 A CN 108754020A CN 201810554782 A CN201810554782 A CN 201810554782A CN 108754020 A CN108754020 A CN 108754020A
- Authority
- CN
- China
- Prior art keywords
- rsv infection
- rna
- circ
- hsa
- circular rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of molecular marker for diagnosing rsv infection, the molecular marker is the circular rna from HERC5 genes, and circBase ID are hsa_circ_0001426.The purposes and the reagent that the invention also discloses the circular rnas in screening or preparing reagent for diagnosing rsv infection are being prepared for diagnosing the purposes in rsv infection kit.The application has found that expression quantity of the circular rna in rsv infection cell significantly increases, the molecular indexes that can be detected as rsv infection, has many advantages, such as that easy, quick, sensitivity and specificity are high.
Description
Technical field
The invention belongs to technical field of biological, and in particular to a kind of circular rna and its use for diagnosing rsv infection
On the way.
Background technology
Respiratory Syncytial Virus(RSV) (Respiratory Syncytial Virus, RSV) is to cause infant, immunity low
One of lower crowd and the main viral pathogen of senile patients with lower respiratory tract infection are the primary causes of disease for leading to infants in hospital, entirely
There are about 160,000 infants to die of the relevant lower respiratory tract infection of RSV every year for ball, and health care costs are huge.Currently, removing supportive treatment
In addition, the therapeutic scheme that there is no specific RSV diseases, preventing of also the not succeeding in developing RSV vaccines that the virus infects can be with
Effectively reduce disease incident.
With the rapid development of high throughput sequencing technologies, ten hundreds of non-coding transcription products is constantly found.Research
Show that the genome sequence that the mankind only have 1%~2% has encoding histone function, without having the non-of protein coding capacity
Code area is up to 98% or more unexpectedly, has a large amount of non-coding RNAs to generate in prompter's body.Circular rna (circular RNA,
CircRNA it is) one kind characterized by covalently closed circle, the non-coding RNA point without containing 5 ' end cap and 3 ' end poly A tails
Son.Since circRNA does not have free-end, making them, there are certain repellences to RNA exonucleases.Current research is sent out
Existing, newcomers of the circRNA as non-coding RNA is closely related with the occurrence and development of a variety of diseases, is a kind of full of foreground
Biomarker and therapy target.
It has proven convenient that HERC5 genes have played important function in antiviral response, antivirus action is main for many researchs
It is to be realized by ISG15 and ISGization.HERC5 can connect ubiquitin-like protein molecule ISG15 and specific proteins substrate；With general
Plainization process is similar, and ISG15 is covalently bound on target protein, modifies target protein, and this combination is known as ISGization,
ISG15 and ISGization play a significant role in antiviral response.Currently, the ring-type generated for human anti-viral's gene HERC5
RNA has not been reported, and the expression variation of circular rna caused by the infection of RSV viruses also has not been reported.
Invention content
Based on this, provided a kind of for diagnosing it is an object of the invention to overcome above-mentioned the deficiencies in the prior art place
The kit of rsv infection, energy quick diagnosis rsv infection have many advantages, such as that easy, quick, sensitivity and specificity are high.
To achieve the above object, the technical solution adopted by the present invention is：A kind of kit for diagnosing rsv infection, packet
The circBase ID containing detection are the reagent of the expression quantity of the circular rna of hsa_circ_0001426.
Preferably, the reagent includes the primer for expanding the circular rna.
Preferably, the nucleotide sequence of the primer is as shown in SEQ ID NO.2 and SEQ ID NO.3.
Preferably, the kit also includes RNA extracts reagents, cDNA reverse transcription reagents and fluorescent dye.
Mankind HERC5 genes can flip Trim generate multiple circular rnas (having included 9), including of the present invention
CircBase IDhsa_circ_0001426 circular rna.The circular rna length is the circular rna of 1052bp, sequence
As shown in SEQ ID NO.1.
SEQ ID NO.1:5’-ATAACCACCTGCCTCAAAGATAATCTGCTCAAAAGACTTCCATTTCATTCTCCA
CCCCAAGAAGCTTTAGAAATTTTCTTCCTTCTCCCAGAATGTCCTATGATGCATATTTCCAACAACTGGGAGAGCCT
TGTGGTTCCATTTGCAAAGGTTGTTTGTAAAATGAGTGACCAGTCTTCACTGGTTCTGGAAGAGTATTGGGCAACTC
TGCAAGAATCCACTTTCAGCAAACTGGTCCAGATGTTTAAAACAGCCGTCATATGCCAGTTGGATTACTGGGATGAA
AGTGCTGAGGAGAATGGTAATGTTCAAGCTCTCCTAGAAATGTTGAAGAAGCTGCACAGGGTAAACCAGGTGAAATG
TCAACTACCTGAAAGTATTTTCCAAGTAGACGAACTCTTGCACCGTCTCAATTTTTTTGTAGAAGTATGCAGAAGGT
ACTTGTGGAAAATGACTGTGGACGCTTCAGAAAATGTACAATGCTGCGTCATATTCAGTCACTTTCCATTTATCTTT
AATAATCTGTCGAAAATTAAACTACTACATACAGACACACTTTTAAAAATAGAGAGTAAAAAACATAAAGCTTATCT
TAGGTCGGCAGCAATTGAGGAAGAAAGAGAGTCTGAATTCGCTTTGAGGCCCACGTTTGATCTAACAGTCAGAAGGA
ATCACTTGATTGAGGATGTTTTGAATCAGCTAAGTCAATTTGAGAATGAAGACCTGAGGAAAGAGTTATGGGTTTCA
TTTAGTGGAGAAATTGGGTATGACCTCGGAGGAGTCAAGAAAGAGTTCTTCTACTGTCTGTTTGCAGAGATGATCCA
GCCGGAATATGGGATGTTCATGTATCCTGAAGGGGCTTCCTGCATGTGGTTTCCTGTCAAGCCTAAATTTGAGAAGA
AAAGATACTTCTTTTTTGGGGTTCTATGTGGACTTTCCCTGTTCAATTGCAATGTTGCCAACCTTCCTTTCCCACTG
GCACTGTTTAAGAAACTTTTGGACCAAATGCCATCATTGGAAGACTTGAAAGAACTCAGTCCTGATTTGGGAAA-
3’。
The present invention also provides the circular rnas that circBase ID are hsa_circ_0001426 to exist as molecular marker
Purposes in the reagent of screening or preparation for diagnosing rsv infection.
Circular rna of the present invention can be used for screening as molecular marker or prepare the reagent for diagnosing rsv infection.
The present invention also provides the reagents of the detection circBase ID circular rnas for being hsa_circ_0001426 to prepare
The purposes in kit for diagnosing rsv infection.
The reagent for detecting the circular rna can be used for preparing kit for diagnosing rsv infection.
Preferably, the reagent for detecting the circular rna includes the primer for expanding the circular rna.
Preferably, the nucleotide sequence of the primer is as shown in SEQ ID NO.2 and SEQ ID NO.3.
SEQ ID NO.2：5'-CTATGTGGACTTTCCCTGTTC-3'.
SEQ ID NO.3：5'-CTTTGAGGCAGGTGGTTATTTTC-3'.
Compared with the existing technology, beneficial effects of the present invention are：(1) present invention demonstrates from HERC5 genes,
CircBase ID are the presence of the circular rna of hsa_circ_0001426, and are studied its feature；(2) the application is sent out
A person of good sense has found that expression quantity of the circular rna in the cell of rsv infection that circBase ID are hsa_circ_0001426 is aobvious for the first time
It writes and increases, the molecular indexes that can be detected as rsv infection have many advantages, such as that easy, quick, sensitivity and specificity are high；(3)
The primer of the detection circular rna provided by the invention has many advantages, such as that high sensitivity and specificity are good.
Description of the drawings
Fig. 1 is hsa_circ_0001426 flip Trims site qualification result figure, wherein A：Electrophoresis result figure；B：Sequence
Analysis chart.
Fig. 2 is that hsa_circ_0001426 resists RNase R processing experimental result pictures.
Fig. 3 is distribution experiments result figures of the hsa_circ_0001426 in cell.
Fig. 4 be rsv infection A549 cells in hsa_circ_0001426 expression of results figure.
Specific implementation mode
To better illustrate the object, technical solutions and advantages of the present invention, below in conjunction with specific embodiment to the present invention
It is described further.
Embodiment 1
The present embodiment provides a kind of kit for diagnosing rsv infection, the kit includes detection circBase ID
For the primer of the expression quantity of the circular rna of hsa_circ_0001426, the primer sequence such as SEQ ID NO.2 and SEQ ID
Shown in NO.3.
The primer is synthesized by this field routine techniques, is illustratively configured to mother liquor, using ddH2O is diluted to work
Concentration.
The method that the expression quantity of the circular rna is detected using the kit is included the following steps：
(1) Total RNAs extraction：With Trizol method extracted total RNAs.
(2) reverse transcription：Utilize reverse transcription reagent box PrimeScript RT reagent Kit with gDNA Eraser
Synthesize cDNA.Reaction system is 20ul (wherein step 1 reaction solution 10ul：5×gDNA Eraser Buffer 2ul,gDNA
Eraser 1ul, RNA and the total 7ul of water；PrimeScript RT Enzyme Mix 1ul；RT Primer Mix 1ul；5×
PrimeScript Buffer 4ul；RNase Free dH2O 4ul；Reaction condition is：37 DEG C, 15min；85 DEG C, 5sec；4
DEG C, ∞.
(3)qPCR：Utilize kit TB GreenTM Premix Ex TaqTMII carries out qPCR, reaction system 20ul
(wherein TB Green Premix Ex Taq II 10ul, ROX Reference Dye II 0.4ul, forward and reverse primer are each
0.8ul、ddH2O 6ul,cDNA 2ul)；Reaction condition is：95 DEG C of pre-degeneration 30s；95 DEG C of denaturation 5s, 60 DEG C of annealing/extensions
34s, totally 40 recycle.
Embodiment 2
The present embodiment confirms that antiviral gene HERC5 generates circular rna hsa_circ_ by high-flux sequence
0001426。
Method：Using lung cell A549 cell sample, total serum IgE is extracted, removes rRNA, then uses RNase R enzymes
Drop, further builds library.The library built carries out RNA-Seq sequencings with Illumina HiSeq 2500, and analysis is for anti-
The relevant circular rnas of viral gene HERC5.
As a result：It is found by analysis, the circular rna derived from HERC5 genes is detected in A549 cells, sequence is such as
Shown in SEQ ID NO.1, which is 1052bp, and the indexed number in circBase databases is hsa_circ_
0001426。
Embodiment 3
The present embodiment studies the feature of hsa_circ_0001426.
(1) the PCR amplification verification in hsa_circ_0001426 flip Trims site and sequence verification.
Method：According to hsa_circ_0001426 sequences, a pair of two-way primer is designed to expand comprising flip Trim site
Sequence, used primer pair includes SEQ ID NO.2 and SEQ ID NO.3.PCR expansions are carried out by template of the cDNA of cell
Increase, reaction system is 20ul (wherein Takara LA Taq 0.2ul, 10 × LA Taq Buffer 2ul, 25mM MgCl2
Each 1.0ul of 2ul, dNTP Mixture 3.2ul, cDNA Template 1ul, forward and reverse primer, ddH2O 9.6ul)；Reaction
Program is：94 DEG C of pre-degeneration 5min；98 DEG C of denaturation 10s, 56 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 34 recycle；72 DEG C are prolonged
Stretch 10min.After PCR product is detected with 2.0% agarose gel electrophoresis, Guangzhou Ai Ji Bioisystech Co., Ltd is sent to be sequenced.
As a result：Electrophoresis result shows that Successful amplification goes out the size comprising hsa_circ_0001426 reverse splicings site and is
The segment (Fig. 1) of 147bp.It includes 23 exons, hsa_circ_0001426 that sequence analysis, which shows mankind HERC5 genes altogether,
It is to be formed by the 18th exon flip Trim to the 12nd exon, includes 7 exons (Exon 12to 18) (figure altogether
1).Sequencing result further confirms that this conclusion, arrow left end are 18 exon end sequence of HERC5 genes, right end 12
The homing sequence (Fig. 1) of exon.
(2) hsa_circ_0001426 resists RNase R digestion
Method：(1) RNA is extracted：Cell total rna is extracted with Trizol methods；(2) RNase R processing：RNA dosages are
10ug uses 2U RNase R (negative control group ddH per microgram RNA2O polishings), 37 DEG C of incubation 10min；(3) RNA is purified：
It is dense to measure RNA later for RNase R treated RNA products RNeasy MinElute Cleanup Kit kits
Degree；(4) RNA reverse transcriptions：It is synthesized with reverse transcription reagent box PrimeScript RT reagent Kit with gDNA Eraser
CDNA, reaction condition is the same as embodiment 1；(5) real-time quantitative PCR：With kit TB GreenTM Premix Ex TaqTMII into
Row qPCR, the total 20ul of reaction system, reaction condition is the same as embodiment 1.
As a result：Since circular rna does not have free-end, making them, there are certain repellences to RNA exonucleases.This
In research, cell total rna further carries out RT-qPCR, testing result is as shown in Figure 2 after RNase R processing, the results showed that,
The linear mRNA degradations of GAPDH genes are most severe (about the 1/50 of primary quantity), and in contrast, hsa_circ_0001426 is basic
On be not degraded, show hsa_circ_0001426 tolerance RNase R digestion.In this experiment, circular rna CDR1as conducts
Positive control, similar with hsa_circ_0001426, circular rna CDR1as is also resistant to RNase R digestion.
(3) caryoplasm distribution experiments show that hsa_circ_0001426 is distributed mainly on cytoplasm
Method：(1) RNA is extracted：Cell is collected, kit (PARIS is usedTMKit) RNA in cytoplasm, karyon is detached
And extract, RNA concentration mensurations are carried out later；(2) RNA reverse transcriptions：Cytoplasm rna 500ng and nucleus RNA are taken respectively
500ng carries out reverse transcription, is synthesized with reverse transcription reagent box PrimeScript RT reagent Kit with gDNA Eraser
CDNA, reaction condition is the same as embodiment 1；(3) real-time quantitative PCR：With kit TB GreenTM Premix Ex TaqTMII into
Row qPCR, the total 20ul of reaction system, reaction condition is the same as embodiment 1.
As a result：After dividing cellifugal karyon, cytoplasm RNA, karyon and hsa_circ_ in cytoplasm are detected respectively with qPCR
0001426, the Relative distribution amount of U1snRNA (U1), GAPDH and CDR1as.Known U1RNA is primarily targeted for karyon, GAPDH
RNA is primarily targeted for born of the same parents' cytoplasm, the reference positioned using U1 and GAPDH as karyon and cytoplasm.Experimental result such as Fig. 3 institutes
Show：U1 and GAPDH are predominantly located at nucleus and cytoplasm respectively, this experiment karyon, cytoplasm RNA is prompted to detach successfully；hsa_
Expression quantity of the circ_0001426 in cytoplasm is significantly higher than nucleus (cytoplasm and karyon rna content ratio are about 10)；With
Hsa_circ_0001426 is similar, and positive control circular rna CDR1as (also referred to as ciRS-7) is also distributed mainly on cell
Matter is consistent with report before.
Embodiment 4
The expression of hsa_circ_0001426 in the lung carcinoma cell of the present embodiment research rsv infection.
(1) experimental method
1, RSV viruses are prepared and titrated with Hep2 cells, and the RSV virus titers of preparation are 1.9*108PFU/ML：RSV diseases
Poison infection can cause Hep2 lytic lesions, therefore be titrated to virus using Plaque Technique Detected.
2, with the RSV viruses infection A549 cells (MOI=1) titrated：I.e. the ratio of virus quantity and cell number is 1.
3, cell sample was collected respectively at 24 hours of infection and 48 hours, is examined using 1 kit of implementation and method
Survey the expression of hsa_circ_0001426 in cell.
(2) experimental result
The results are shown in Figure 4, compared to control group (being uninfected by group, Mock), in the cell of rsv infection group, and hsa_circ_
0001426 expression is significantly raised；Wherein, rsv infection 24 hours (RSV-24h) and 48 hours (RSV-48h) hsa_circ_
0001426 expression quantity is respectively 32 times and 106 times of control group.The result shows that rsv infection can significantly raise hsa_circ_
0001426 expression illustrates that hsa_circ_0001426 can be used as the molecular marker of diagnosis rsv infection.
Finally, it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention rather than is protected to the present invention
The limitation of range is protected, although being explained in detail to the present invention with reference to preferred embodiment, those skilled in the art should
Understand, technical scheme of the present invention can be modified or replaced equivalently, without departing from the essence of technical solution of the present invention
And range.
SEQUENCE LISTING
<110>Attached 5th hospital of Guangzhou medical university
<120>It is a kind of to be used to diagnose circular rna of rsv infection and application thereof
<130> 2018.5.25
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 1052
<212> DNA
<213>Homo sapiens（Homo sapiens）
<400> 1
ataaccacct gcctcaaaga taatctgctc aaaagacttc catttcattc tccaccccaa 60
gaagctttag aaattttctt ccttctccca gaatgtccta tgatgcatat ttccaacaac 120
tgggagagcc ttgtggttcc atttgcaaag gttgtttgta aaatgagtga ccagtcttca 180
ctggttctgg aagagtattg ggcaactctg caagaatcca ctttcagcaa actggtccag 240
atgtttaaaa cagccgtcat atgccagttg gattactggg atgaaagtgc tgaggagaat 300
ggtaatgttc aagctctcct agaaatgttg aagaagctgc acagggtaaa ccaggtgaaa 360
tgtcaactac ctgaaagtat tttccaagta gacgaactct tgcaccgtct caattttttt 420
gtagaagtat gcagaaggta cttgtggaaa atgactgtgg acgcttcaga aaatgtacaa 480
tgctgcgtca tattcagtca ctttccattt atctttaata atctgtcgaa aattaaacta 540
ctacatacag acacactttt aaaaatagag agtaaaaaac ataaagctta tcttaggtcg 600
gcagcaattg aggaagaaag agagtctgaa ttcgctttga ggcccacgtt tgatctaaca 660
gtcagaagga atcacttgat tgaggatgtt ttgaatcagc taagtcaatt tgagaatgaa 720
gacctgagga aagagttatg ggtttcattt agtggagaaa ttgggtatga cctcggagga 780
gtcaagaaag agttcttcta ctgtctgttt gcagagatga tccagccgga atatgggatg 840
ttcatgtatc ctgaaggggc ttcctgcatg tggtttcctg tcaagcctaa atttgagaag 900
aaaagatact tcttttttgg ggttctatgt ggactttccc tgttcaattg caatgttgcc 960
aaccttcctt tcccactggc actgtttaag aaacttttgg accaaatgcc atcattggaa 1020
gacttgaaag aactcagtcc tgatttggga aa 1052
<210> 2
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 2
ctatgtggac tttccctgtt c 21
<210> 3
<211> 23
<212> DNA
<213>It is artificial synthesized
<400> 3
ctttgaggca ggtggttatt ttc 23
Claims (8)
1. a kind of kit for diagnosing rsv infection, which is characterized in that include to detect circBase ID as hsa_circ_
The reagent of the expression quantity of 0001426 circular rna.
2. the kit according to claim 1 for diagnosing rsv infection, which is characterized in that the reagent includes amplification
The primer of the circular rna.
3. the kit according to claim 2 for diagnosing rsv infection, which is characterized in that the nucleotide of the primer
Sequence is as shown in SEQ ID NO.2 and SEQ ID NO.3.
4. according to claim 3 for diagnosing the kit of rsv infection, which is characterized in that the kit also includes
RNA extracts reagents, cDNA reverse transcription reagents and fluorescent dye.
The circular rna that 5.circBase ID are hsa_circ_0001426 is being screened or is being prepared for examining as molecular marker
Purposes in the reagent of disconnected rsv infection.
6. the reagent for detecting the circular rna that circBase ID are hsa_circ_0001426 is being prepared for diagnosing rsv infection
Purposes in kit.
7. purposes according to claim 6, which is characterized in that the reagent for detecting the circular rna includes expanding the ring
The primer of shape RNA.
8. purposes according to claim 7, which is characterized in that the nucleotide sequence of the primer such as SEQ ID NO.2 and
Shown in SEQ ID NO.3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810554782.1A CN108754020A (en) | 2018-05-31 | 2018-05-31 | It is a kind of to be used to diagnose circular rna of rsv infection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810554782.1A CN108754020A (en) | 2018-05-31 | 2018-05-31 | It is a kind of to be used to diagnose circular rna of rsv infection and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108754020A true CN108754020A (en) | 2018-11-06 |
Family
ID=64001837
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810554782.1A Pending CN108754020A (en) | 2018-05-31 | 2018-05-31 | It is a kind of to be used to diagnose circular rna of rsv infection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108754020A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111454950A (en) * | 2020-04-01 | 2020-07-28 | 广州医科大学附属第五医院 | Circular RNA related to RSV (respiratory syncytial virus) infection and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011008349A2 (en) * | 2009-05-26 | 2011-01-20 | Duke University | Methods of identifying infectious disease and assays for identifying infectious disease |
| CN105063210A (en) * | 2015-08-12 | 2015-11-18 | 中国农业科学院北京畜牧兽医研究所 | Circular RNA identification method |
-
2018
- 2018-05-31 CN CN201810554782.1A patent/CN108754020A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011008349A2 (en) * | 2009-05-26 | 2011-01-20 | Duke University | Methods of identifying infectious disease and assays for identifying infectious disease |
| CN105063210A (en) * | 2015-08-12 | 2015-11-18 | 中国农业科学院北京畜牧兽医研究所 | Circular RNA identification method |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111454950A (en) * | 2020-04-01 | 2020-07-28 | 广州医科大学附属第五医院 | Circular RNA related to RSV (respiratory syncytial virus) infection and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105734679B (en) | Nucleic acid target sequence captures the preparation method of sequencing library | |
| WO2017028753A1 (en) | Multiplex pcr primer and application thereof | |
| WO2018184495A1 (en) | Method for constructing amplicon library through one-step process | |
| CN111454942A (en) | Construction method for simultaneously establishing sequencing library by transcriptome and genome of same sample | |
| CN108504649B (en) | Coding PCR second-generation sequencing database building method, kit and detection method | |
| CN108138244A (en) | Virus group capture microarray dataset, design and construction method and application method | |
| WO2018133547A1 (en) | METHOD FOR CONSTRUCTING LIBRARY FOR NON-INVASIVE PRENATAL FETAL β-THALASSEMIA GENE MUTATION DETECTION, DETECTION METHOD AND KIT | |
| CN108359723B (en) | Method for reducing deep sequencing errors | |
| CN109735659A (en) | A kind of primer and kit and detection method using RPA detection Procambius clarkii picornavirus | |
| CN108754020A (en) | It is a kind of to be used to diagnose circular rna of rsv infection and application thereof | |
| TW201321520A (en) | Method and system for virus detection | |
| CN108660255A (en) | A kind of circular rna and its application for diagnosing rsv infection | |
| CN110734974B (en) | SNP locus combination and detection primer for cancer chemotherapy drugs | |
| Li et al. | Comprehensive analysis of circRNAs expression profiles in different periods of MDBK cells infected with bovine viral diarrhea virus | |
| CN116042610A (en) | Detection probe combination of dynamic mutation STR locus and sequencing analysis method | |
| Li et al. | Characterization of MicroRNA cargo of extracellular vesicles isolated from the plasma of Schistosoma japonicum-infected mice | |
| CN110938685A (en) | Gene detection probe set for neonatal hereditary metabolic disease and hemoglobinopathy and application thereof | |
| WO2022134225A1 (en) | Marker gene for identifying and classifying dpc cell, screening method therefor and use thereof | |
| CN108130366B (en) | Method for constructing human miRNA sequencing library for high-throughput sequencing | |
| US20110281774A1 (en) | Gene Cluster Diagnosis Apparatus | |
| CN102108420A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN108359746B (en) | Method and primer for detecting cell cross contamination caused by Hela cells | |
| CN109811052A (en) | A kind of kit and gene panel detecting idiopathic azoospermatism | |
| CN109517819A (en) | A kind of detection probe, method and kit modified for detecting multiple target point gene mutation, methylation modification and/or methylolation | |
| CN108070637A (en) | A kind of pre- amplification method of Circulating DNA based on from ring amplification principle |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181106 |