CN111454942A

CN111454942A - Construction method for simultaneously establishing sequencing library by transcriptome and genome of same sample

Info

Publication number: CN111454942A
Application number: CN202010181548.6A
Authority: CN
Inventors: 张晓鲁
Original assignee: 张晓鲁
Priority date: 2020-03-16
Filing date: 2020-03-16
Publication date: 2020-07-28

Abstract

The invention belongs to the technical field of biology, and particularly relates to a construction method for simultaneously establishing a sequencing library by a transcriptome and a genome of the same sample. Wherein: the sequence of the RNA primer is CGATTGAGGCCGGTAATACGACTCACTATAGGG _ GTTCAGAGTTCTACAGTCCGACGATC _ NNNNNNNN _ CATCACGC _ TTTTTTTTTV; wherein: the gene sequence of the DNA primer is CGATTGAGGCCGGTAATACGACTCACTATAGGG _ GTTCAGAGTTCTACAGTCCGACGATC _ NNNNNNNN _ CATCACGC _ CATG. The construction method for simultaneously establishing the sequencing library by the transcriptome and the genome realizes the simultaneous amplification of the transcriptome and the genome of the same sample and the construction of the sequencing library for the first time, and solves the technical problem that the sequencing library can be simultaneously established by the transcriptome and the genome of the same sample by the prior method.

Description

Construction method for simultaneously establishing sequencing library by transcriptome and genome of same sample

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a construction method for simultaneously establishing a sequencing library by a transcriptome and a genome of the same sample.

Background

The nucleic acid substances in organisms mainly comprise deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) which respectively play the functions of a storage body and a carrier of genetic substances in human cells, various nucleic acid amplification methods emerge with the implementation completion of a human genome project and the rapid development of a sequencing technology, and a lot of nucleic acid amplification methods are developed into commercial kits and widely applied.

RNA amplification is mainly used for RNA sequencing (RNAseq) to obtain transcriptome information of organisms. RNAseq was invented for over ten years. During the decades, the emerging technologies of RNA amplification and database preparation have been hundreds, most of them are applied to the second generation sequencing platform, and most of them involve large tissue blocks or large cell samples (here, "large tissue blocks or large cell samples" should include at least millions of cells).

DNA amplification is used primarily for DNA sequencing (DNAseq) to obtain genomic information of an organism. Genomic information of living cells (human cells as an example) is mainly stored in chromatin DNA in cell nuclei, and genetic material of normal human cells is in two copies. Similar to RNAseq, DNAseq has been developed to date, and a variety of amplification methods have been developed for use with second or third generation sequencing platforms, some of which can achieve single cell resolution. The DNAseq method of large tissue blocks/large samples is developed rapidly, and various kits are available in the market. These methods generally follow the same flow: genomic DNA ultrasonication-end repair-addition of poly (a) tail-ligation sequencing primer-PCR amplification.

To date, no method has been available to simultaneously construct sequencing libraries for both transcriptomes and genomes of the same sample.

Disclosure of Invention

The present invention provides a method for constructing a transcriptome library and a genomic library, which solves the technical problems of the background art.

The technical scheme adopted by the invention is as follows:

in one aspect, the present invention provides an RNA primer having a sequence of CGATTGAGGCCGGTAATACGACTCACTATAGGG _ GTTCAGAGTTCTACAGTCCGACGATCNNNNNNNN _ CATCACGCTTTTTTTTTV, wherein:

the sequence CGATTGAGGCCGGTAATACGACTCACTATAGGG is a T7 promoter;

the sequence GTTCAGAGTTCTACAGTCCGACGATC is RA5, namely IIIumina sequencing platform recognition primer two

The sequence NNNNNNNN is a specific molecular recognition code (UMI);

the sequence CATCACGC is a Sample Barcode (SB) and is a variable sequence;

sequence TTTTTTTTTV is a poly-T tail.

The invention has the beneficial effects that: constructing a sample transcriptome library, wherein a T7 promoter is a recognition binding site of RNA polymerase and starts RNA transcription; UMI is a specific molecular recognition code and helps to recognize and screen out PCR replicons; SB is the six nucleotide sequence sample identifier, which can realize multi-sample mixing and help to track the initial sample source in the final product.

In another aspect, the present invention provides a DNA primer, wherein the sequence of the DNA primer is CGATTGAGGCCGGTAATACGACTCACTATAGGG _ GTTCAGAGTTCTACAGTCCGACGATC _ nnnnnnn _ catcacgcc _ CATG, wherein:

the sequence CGATTGAGGCCGGTAATACGACTCACTATAGGG is a T7 promoter;

the sequence GTTCAGAGTTCTACAGTCCGACGATC is RA5, namely IIIumina sequencing platform recognition primer;

the sequence NNNNNNNN is a specific molecular recognition code (UMI);

the sequence CATCACGC is a Sample Barcode (SB) and is a variable sequence II

The sequence CATG is recognition sequence of endonuclease NlaIII.

The invention has the beneficial effects that: constructing a sample genome library, wherein a T7 promoter is a recognition binding site of RNA polymerase and starts RNA transcription; UMI is a specific molecular recognition code and helps to recognize and screen out PCR replicons; SB is a six-bit nucleotide sequence sample identification code, so that multi-sample mixing can be realized, and tracking of an initial sample source in a final product is facilitated; the recognition sequence of the endonuclease may complement the restriction site of the ligated DNA fragment, depending on the restriction endonuclease used. The recognition sequence of the endonuclease NlaIII is exemplified by the endonuclease NlaIII.

In another aspect of the invention, there is provided a RA3 linker, wherein the sequence of the RA3 linker is 5' TGGAATTCTCGGGTGCCAAGG.

The invention has the beneficial effects that: the method is suitable for construction of not only transcriptome libraries but also genome libraries.

In another aspect of the invention, there is provided an RTP reverse transcription primer, the RTP reverse transcription primer having a sequence of 5' GCCTTGGCACCCGAGAATTCCA.

The invention also provides a primer in a PCR amplification reaction system, which comprises an RP1 common primer and an RPI primer containing an index sequence, wherein:

the sequence of the RP1 common primer is as follows:

5’AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA；

the sequence of the RPI primer containing the index sequence is as follows:

5’CAAGCAGAAGACGGCATACGAGCTCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA。

the invention has the beneficial effects that: the method is suitable for constructing a transcriptome library and a genome library in vitro transcription. Wherein the index sequence of nucleotide 6 of the CGTGAT in the RPI index sequence-containing primer is variable.

The invention provides a construction method for simultaneously establishing a sequencing library based on a transcriptome and a genome of the same sample of the RNA primer and the DNA primer, which comprises the following steps:

first, RNA amplification

S1, placing the frozen section of the biological sample on a glass slide, and then using a hybridization chamber (Secure-Seal)^TMhybridization chamber) was overlaid on the cryosection so that the hybridization chamber was affixed to the slide;

s2, adding the RNA primer, the deoxyribonucleotide triphosphate and the nuclease-free water into a hybridization chamber, and then reverse transcribing the first strand of the cDNA;

s3, reverse transcription of the second cDNA strand in the hybridization chamber;

s4, transferring the solution in the hybridization chamber to an EP tube, and precipitating DNA;

s5, fragmenting the precipitated DNA by using an ultrasonic instrument to obtain a DNA fragment with the target length of 200-300 bp;

s6, purifying the DNA fragments by using nucleic acid purification magnetic beads, and dissolving the purified transcriptome DNA into nuclease-free water for preparing a sequencing library;

secondly, DNA amplification,

a. Collecting the frozen section of the same biological sample in the step S1 into an EP tube, and then extracting the genomic DNA of the biological sample tissue by using a phenol chloroform separation method;

b. carrying out fragmentation treatment on the genome DNA by using an ultrasonic instrument to obtain a DNA fragment with the target length of 500-1000 bp;

c. b, adding restriction endonuclease, reaction buffer solution and nuclease-free water into 60 pg-200 ng of the genomic DNA in the step b, incubating for 13-15 hours at 35-40 ℃, and then incubating for 15-30 min at 60-70 ℃ to obtain the genomic DNA subjected to restriction endonuclease digestion;

d. adding the DNA primer, T4DNA ligase reaction buffer solution, adenosine triphosphate, bovine serum albumin, T4DNA ligase and nuclease-free water into the genomic DNA subjected to restriction enzyme digestion in the step c;

e. d, carrying out DNA precipitation on the genome in the step d, then purifying by using nucleic acid purification magnetic beads, and dissolving the purified genome DNA in nuclease-free water for preparing a sequencing library;

thirdly, simultaneously establishing sequencing library by transcriptome and genome

A. Amplifying the transcriptome DNA in step S6 and the genomic DNA in step e by In Vitro Transcription (IVT) to obtain an RNA product II

B. Purifying the RNA product after IVT amplification by using purified magnetic beads, and dissolving the purified RNA product in water without nuclease;

C. then adding the RA3 connector, incubating for 2-3 min at 60-75 ℃, placing on ice, adding an RNA ligase reaction buffer solution, a ribonuclease inhibitor and T4RNA ligase, and incubating for 2-3 h at 20-30 ℃ to obtain a transcription reaction system;

D. adding the RTP reverse transcription primer into the transcription reaction system in the step C, incubating for 1-3 min at 60-80 ℃, then placing on ice, adding a first-strand reaction buffer solution, deoxyribonucleoside triphosphate, dithiothreitol, a ribonuclease inhibitor and reverse transcriptase, and incubating for 1-2 hours at 45-55 ℃ to obtain a reverse transcription system;

E. adding the RPI primer containing the index sequence, the RP1 common primer, the PCR reaction mixture and the nuclease-free water into the reverse transcription system in the step D, and then carrying out PCR amplification according to the following procedures:

obtaining amplified DNA;

F. and D, purifying the DNA amplified in the step E by using a purified magnetic bead, dissolving the purified DNA in nuclease-free water, measuring the concentration and the quality, carrying out IIIuma sequencing, and simultaneously establishing a sequencing library of a transcriptome and a genome.

The invention has the beneficial effects that: in one aspect, the invention incorporates specially designed RNA primers and DNA primers. The T7 sequence can help to realize in vitro transcription, which is a linear amplification mode different from PCR amplification and has smaller deviation, and can help to reduce the number of subsequent PCR amplification cycles and further reduce the deviation caused by PCR amplification; wherein the UMI sequence is an eight-nucleotide sequence randomly synthesized by an apparatus when a primer is synthesized, and is a specific molecular recognition code, the same sequence with the same UMI can be considered as a PCR replicon, and the UMI in a final product can help to screen out the PCR replicon so as to quantify an initial specific RNA/DNA fragment; the SB sequence is an octanucleotide sample identification code, and different samples introduce specific identification codes so as to realize multi-sample mixing, so that on one hand, the diversity of a sample library can be easily realized, and on the other hand, the library preparation and sequencing cost can be reduced. On the other hand, the invention realizes the simultaneous amplification of the transcriptome and the genome of the same sample and the construction of the sequencing library for the first time, and solves the technical problem that the method can realize the simultaneous construction of the transcriptome and the genome of the same sample and the sequencing library. In the construction of the genome library, materials can be obtained at multiple sites of a tissue slice, and the spatial position information of the sample genome is stored, so that the technical problem that the spatial position diversity information is easily covered in the preparation process of a large tissue block or a large number of cell libraries is solved, and the method is particularly important for the research of heterogeneity in a sample. In addition, the primer with the sample identification code is introduced in the early stage of library preparation, so that the diversity of the library can be easily realized, and the cost is reduced. The invention only needs to input 60 pg-200 ng of genome DNA, thereby solving the technical problems that the prior art requires large amount of DNA to be initially input and most of the DNA requires the initial amount to be 50ng or more. In step S1, the method can use the hybridization chamber to prepare a database of whole sections, or can use multi-site sampling to obtain transcriptome/genomic information of multiple sites on the same section for heterogeneity research in a sample. In step A, IVT amplification has less bias (bias) than PCR amplification, where pre-amplification can reduce the number of cycles of the final PCR step. The RNA amplification part of the second step in the method can be applied to the single cell level, and the DNA amplification part can be applied to the genome DNA of as low as 60pg (equivalent to the DNA of 10 single cells), which cannot be achieved by all the current commercial kits (except the single cell genome database preparation kit, but the single cell kit is expensive)

On the basis of the technical scheme, the invention can be further improved as follows.

Further, in step C, the volume ratio of the RNA ligase reaction buffer, the ribonuclease inhibitor and the T4RNA ligase is 2: 1.

Further, in step D, the volume ratio of the first strand reaction buffer, the deoxyribonucleoside triphosphates, the dithiothreitol, the ribonuclease inhibitor, and the reverse transcriptase is 5: 1: 2: 1: 2.

Further, in step E, the volume ratio of the RPI index sequence-containing primer, the RP1 common primer, the PCR reaction mixture and the nuclease-free water is 2: 50: 17.

Further, in the step A, the IVT amplification is performed by adding a mixture consisting of adenine, guanine, cytosine and uracil, a reaction buffer, T7 RNA polymerase and a ribonuclease inhibitor, and then incubating for 3-5 h at 35-40 ℃, wherein the dosage ratio of the mixer, the reaction buffer, the T7 RNA polymerase and the ribonuclease inhibitor is 8: 2: 1.5: 0.5.

Drawings

FIG. 1 is a schematic diagram of an RNA primer of the present invention;

FIG. 2 is a schematic diagram of a DNA primer of the present invention;

FIG. 3 is a schematic view of concentration and mass measurement in example 1 of the present invention;

FIG. 4 is a schematic flow chart of the operation of the present invention;

Detailed Description

The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.

Examples 1,

As shown in FIG. 4, a method for constructing a sequencing library by simultaneously establishing a transcriptome and a genome of the same sample comprises the following steps:

first, RNA amplification

S1, placing fresh tumor tissue frozen sections with normal thickness (4-7 μm)

Center of Plus anti-drop glass slideSelect a suitable size of Secure-Seal^TMhybridization chamber, cover as much as possible the entire section size, and stick to the slide.

S2, reverse transcription of the first strand cDNA in the hybridization chamber: the specific operation is as follows:

in the hybridization chamber, the following reaction solutions (60. mu.l total) were added:

RNA Primer (1. mu.M) (RNA Primer)	1μl
		dNTPs (10. mu.M) (deoxyribonucleant triphosphate)	5μl
Nucleic free water (Nuclease free water)	54μ\|

Incubate at 65 ℃ for 5 minutes, immediately place on ice;

wherein: the RNA primer sequence comprises a T7 promoter (T7 promoter), an RA5 (IIIumana sequencing platform recognition primer), a Unique Molecular Identifier (UMI), a Sample barcode (Sample recognition code) and a Poly (T) (poly-T tail), as shown in figure 1, the T7 sequence is used for a subsequent in vitro transcription step, the UMI can help to remove a PCR copy in an analysis process, and the barcode can help to easily realize Sample diversification and reduce the preparation cost of a database.

The following reaction solutions (40. mu.l total) were then added to the hybridization chamber:

incubate at 50-55 ℃ for 10 minutes, followed by incubation at 80 ℃ for 10 minutes, immediately on ice.

S3, reverse transcription of the second cDNA strand in the hybridization chamber; the specific operation is as follows:

in the hybridization chamber, the following reaction solutions (50. mu.l total) were added:

incubation was carried out at 16 ℃ for 2 hours,

s4, transferring the solution in the hybridization chamber into a 1.5ml EP tube, and then synthesizing DNA in the EP tube, wherein the specific operation of synthesizing DNA is that the sample is placed on ice, 2. mu.l of T4DNA synthetase is added, the incubation is continued for 5 minutes at 16 ℃, and 10. mu.l of 0.5M EDTA (ethylene diamine tetraacetic acid) is added into the sample;

s5, precipitating the DNA, and fragmenting the DNA by using an ultrasonic instrument to obtain a DNA fragment of 200-300 bp of a target fragment; wherein: the precipitation process of DNA is as follows:

the following reaction liquid was added to the reaction mixture,

glycogen from muscles (Glycogen)	3.7μl/100μl
		Sodium Acetate (3M), pH 5.5 (Sodium Acetate)	The final concentration reaches 0.3M
Ice-code ethanol	2.5 times volume

Incubating overnight at-80 ℃ and centrifuging the pellet, and redissolving the precipitated DNA in nuclease-free water;

s6, purifying the fragmented DNA by using nucleic acid purification magnetic beads, and dissolving the purified transcriptome DNA in 8 mu l of nuclease-free water for preparing a sequencing library;

secondly, DNA amplification,

a. Collecting the frozen section of the same biological sample in step S1 into a 1.5ml EP tube, and then extracting the genomic DNA of the biological sample tissue by using phenol chloroform separation method;

b. carrying out fragmentation treatment on the genome DNA by using an ultrasonic instrument to obtain a DNA fragment of 500-1000bp of a target fragment;

c. taking 60 pg-200 ng of genomic DNA in the step b, and mixing according to the following proportion:

after incubation at 37 ℃ for 14 hours and then at 65 ℃ for 20min, restriction endonuclease-cleaved genomic DNA II was obtained

d. Adding 1. mu.l of DNA primer, 3. mu.l of T4DNA ligase reaction buffer, 2.4. mu.l of adenosine triphosphate, 0.6. mu.l of bovine serum albumin, 1. mu.l of T4DNA ligase and 12. mu.l of nuclease-free water to the restriction endonuclease-cleaved genomic DNA in step c, wherein: the DNA primers comprise T7 promoter, RA5, UniqueMolecular modifier, Sample barcode and CutSite (endonuclease site) as shown in FIG. 2;

A. Amplifying the transcriptome DNA in the step S6 and the genome DNA in the step e by using IVT to obtain an RNA product; wherein, the specific reaction process of IVT expansion is as follows:

mu.l of each of the transcriptome and genomic cDNA was mixed with the following reaction solution

Incubate at 37 ℃ for 4 hours.

B. Purifying the RNA product after IVT amplification by using a purified magnetic bead, and dissolving the purified RNA product in 7.8 mu l of nuclease-free water;

C. then adding 1 mul of the RA3 conjugate, incubating at 70 ℃ for 2min, placing on ice, adding 2 mul of RNA ligase reaction buffer, 1 mul of ribonuclease inhibitor and 1 mul of T4RNA ligase, and incubating at 25 ℃ for 2h to obtain a transcription reaction system;

D. adding 2 mu l of the RTP reverse transcription primer into the transcription reaction system in the step C, incubating for 2min at 70 ℃, then placing on ice, then adding 5 mu l of first strand reaction buffer solution, 1 mu l of deoxyribonucleoside triphosphate, 2 mu l of dithiothreitol, 1 mu l of ribonuclease inhibitor and 2 mu l of reverse transcriptase, and incubating for 1 hour at 50 ℃ to obtain a reverse transcription system;

E. adding 2. mu.l of the RPI index sequence-containing primer, 2. mu.l of the RP1 common primer, 50. mu.l of the PCR reaction mixture and 17. mu.l of nuclease-free water to the reverse transcription system in step D, and then performing PCR amplification according to the following procedure:

obtaining amplified DNA;

F. and E, purifying the DNA amplified in the step E by using a purified magnetic bead, dissolving the purified DNA into 20 mu l of nuclease-free water, measuring the concentration and the quality as shown in the figure 3, carrying out IIIuma sequencing, and simultaneously establishing a sequencing library of a transcriptome and a genome.

The invention has the following beneficial effects:

1. providing clinical services such as molecular pathological diagnosis

The method is carried out on frozen sections of fresh tissues for clinical molecular pathological diagnosis. At present, the clinical molecular pathological diagnosis by gene sequencing is not widely developed and popularized, mainly because of the high database preparation and sequencing cost, and cannot be easily accepted by patients. The development of this method greatly reduces the cost of database preparation and sequencing, and patient acceptance will increase. Meanwhile, the method can be applied to a small amount of precious samples, such as needle biopsy samples, so that the method can be applied to clinical molecular pathological diagnosis, and after obtaining transcriptome and genome information of a tissue sample of a patient, the tissue sample can be fed back to the patient and a doctor through further data analysis, so as to guide clinical diagnosis (such as more accurate diagnosis of a certain tumor subtype) and clinical medication.

2. Providing health services such as genetic information analysis

The healthy people can provide peripheral blood, prepare a database by the method, obtain transcriptome and genome information, and further analyze data to obtain information such as potential risks of diseases.

Sequence listing

In the description herein, the description of the terms "one embodiment," "some embodiments," "a specific embodiment," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> Zhang Xiaolu

<120> a method for constructing a sequencing library by simultaneously establishing a transcriptome and a genome of the same sample

<141>2019-12-01

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA/RNA

<213>Artificial Sequence

<400>1

tggaattctc gggtgccaag g 21

<210>2

<211>22

<212>DNA/RNA

<213>Artificial Sequence

<400>2

gccttggcac ccgagaattc ca 22

<210>3

<211>50

<212>DNA/RNA

<213>Artificial Sequence

<400>3

aatgatacgg cgaccaccga gatctacacg ttcagagttc tacagtccga 50

<210>4

<211>63

<212>DNA/RNA

<213>Artificial Sequence

<400>4

caagcagaag acggcatacg agctcgtgat gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>5

<211>79

<212>DNA/RNA

<213>Artificial Sequence

<400>5

cgattgaggc cggtaatacg actcactata ggggttcaga gttctacagt ccgacgatcn 60

nnnnnnncat cacgccatg 79

<210>6

<211>85

<212>DNA/RNA

<213>Artificial Sequence

<400>6

cgattgaggc cggtaatacg actcactata ggggttcaga gttctacagt ccgacgatcn 60

nnnnnnncat cacgcttttt ttttv 85

Claims

1. An RNA primer having a sequence of CGATTGAGGCCGGTAATACGACTCACTATAGGG _ GTTCAGAGTTCTACAGTCCGACGATC _ NNNNNNNN _ CATCACGC _ TTTTTTTTTV, wherein:

the sequence CGATTGAGGCCGGTAATACGACTCACTATAGGG is a T7 promoter;

the sequence GTTCAGAGTTCTACAGTCCGACGATC is RA5, namely an Illumina sequencing platform recognition primer;

the sequence NNNNNNNN is a specific molecular recognition code (UMI);

the sequence CATCACGC is a Sample Barcode (SB) and is a variable sequence;

sequence TTTTTTTTTV is a poly-T tail.

2. A DNA primer having a sequence of CGATTGAGGCCGGTAATACGACTCACTATAGGG _ GTTCAGAGTTCTACAGTCCGACGATC _ nnnnnnn _ CATCACGC _ CATG, wherein:

the sequence CGATTGAGGCCGGTAATACGACTCACTATAGGG is a T7 promoter;

the sequence NNNNNNNN is a specific molecular recognition code (UMI);

the sequence CATCACGC is a Sample Barcode (SB) and is a variable sequence;

the sequence CATG is recognition sequence of endonuclease Nlalll.

3. An RA3 linker, wherein the sequence of the RA3 linker is 5' TGGAATTCTCGGGTGCCAAGG.

4. An RTP reverse transcription primer, wherein the sequence of the RTP reverse transcription primer is 5' GCCTTGGCACCCGAGAATTCCA.

5. A primer in a PCR amplification reaction system, which is characterized by comprising an RP1 common primer and an RPI primer containing an index sequence, wherein:

the sequence of the RP1 common primer is as follows:

5’AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA；

the sequence of the RPI primer containing the index sequence is as follows:

5’CAAGCAGAAGACGGCATACGAGCTCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA。

6. a method for constructing a sequencing library by simultaneously establishing a transcriptome and a genome of the same sample is characterized by comprising the following steps:

first, RNA amplification

S1, placing the frozen section of the biological sample on a glass slide, and then using a hybridization chamber (Secure-Seal)^TMhybridization chamber) covering the frozen sections to allow hybridizationThe chamber is affixed to the slide;

s2, adding RNA primer, deoxyribonucleotide triphosphate and nuclease-free water into the hybridization chamber, and then reverse transcribing the first cDNA chain;

s6, purifying the DNA fragment by using nucleic acid purification magnetic beads, and dissolving the purified transcriptome DNA in nuclease-free water for preparing a sequencing library;

second, DNA amplification

a. Collecting the frozen section of the same biological sample in the step S1 into an EP tube, and extracting the genomic DNA of the biological sample tissue by using a phenol chloroform separation method;

d. adding a DNA primer, T4DNA ligase reaction buffer solution, adenosine triphosphate, bovine serum albumin, T4DNA ligase and nuclease-free water into the genome DNA subjected to restriction enzyme digestion in the step c;

A. Amplifying the transcriptome DNA in step S6 and the genome DNA in step e by In Vitro Transcription (IVT) to obtain RNA products;

B. purifying the RNA product after IVT amplification by using a purified magnetic bead, and dissolving the purified RNA product in nuclease-free water;

C. adding RA3 conjugate, incubating at 60-75 ℃ for 2-3 min, placing on ice, adding RNA ligase reaction buffer, ribonuclease inhibitor and T4RNA ligase, and incubating at 20-30 ℃ for 2-3 h to obtain a transcription reaction system;

D. adding an RTP reverse transcription primer into the transcription reaction system in the step C, incubating for 1-3 min at 60-80 ℃, then placing on ice, adding a first-strand reaction buffer solution, deoxyribonucleoside triphosphate, dithiothreitol, a ribonuclease inhibitor and reverse transcriptase, and incubating for 1-2 hours at 45-55 ℃ to obtain a reverse transcription system;

E. adding RPl primer containing index sequence, RP1 common primer, the PCR reaction mixture and nuclease-free water into the reverse transcription system in the step D, and then carrying out PCR amplification according to the following procedures:

obtaining amplified DNA;

F. and E, purifying the DNA amplified in the step E by using purified magnetic beads, dissolving the purified DNA in nuclease-free water, measuring concentration and quality, carrying out Illumina sequencing, and simultaneously establishing a sequencing library of a transcriptome and a genome.

7. The method for constructing a sequencing library simultaneously using the transcriptome and genome of the same sample as in claim 6, wherein in step C, the volume ratio of said RNA ligase reaction buffer, said ribonuclease inhibitor and said T4RNA ligase is 2: 1.

8. The method for constructing a sequencing library according to claim 6, wherein the first-strand reaction buffer, the deoxyribonucleoside triphosphates, the dithiothreitol, the ribonuclease inhibitor, and the reverse transcriptase are present in a volume ratio of 5: 1: 2 in step D.

9. The method for constructing a sequencing library simultaneously using the transcriptome and genome of the same sample as in claim 6, wherein in step E, the volume ratio of the primer containing index sequence of RPI, the common primer of RP1, the PCR reaction mixture and the nuclease-free water is 2: 50: 17.

10. The method for constructing a sequencing library simultaneously based on the transcriptome and genome of the same sample as in any one of claims 6 to 9, wherein in step A, the IVT amplification is performed by adding a mixture of adenine, guanine, cytosine and uracil, a reaction buffer, T7 RNA polymerase and a ribonuclease inhibitor, and then incubating at 35-40 ℃ for 3-5 h, wherein the mixing machine, the reaction buffer, the T7 RNA polymerase and the ribonuclease inhibitor are used in a ratio of 8: 2: 1.5: 0.5.