CN108660234A - With the molecular labeling SIsv0362 of millet leaf color gene close linkage - Google Patents
With the molecular labeling SIsv0362 of millet leaf color gene close linkage Download PDFInfo
- Publication number
- CN108660234A CN108660234A CN201711295539.4A CN201711295539A CN108660234A CN 108660234 A CN108660234 A CN 108660234A CN 201711295539 A CN201711295539 A CN 201711295539A CN 108660234 A CN108660234 A CN 108660234A
- Authority
- CN
- China
- Prior art keywords
- molecular labeling
- millet
- primer
- leaf color
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, and in particular, to a kind of molecular labeling with millet leaf color gene close linkage, the molecular labeling contain SEQ ID NO:Nucleotide sequence shown in 1.The invention further relates to expand purposes, a kind of millet leaf color gene positioning method and a kind of Millet Breeding method of primer, the molecular labeling and the primer of the molecular labeling in the assignment of genes gene mapping of millet leaf color or millet genetic breeding.Present invention finds the molecular labeling SIsv0362 with millet leaf color gene close linkage, the hereditary close linkage distance of the molecular labeling and millet leaf color gene is 1.7cM, millet genomic dna sequence and millet leaf color genetic link are got up, the foundation of millet molecular mark system is more advantageous to.The molecular labeling and molecular labeling amplimer of the present invention can it is easy, quickly, be applied to millet assistant breeding with high throughput, there is important theory and practice directive significance for the hereditary and selection and improvement process of accelerating millet variety.
Description
Technical field
The invention belongs to technical field of molecular biology, are related to a kind of molecular labeling, and in particular, to a kind of and millet leaf
The molecular labeling SIsv0362 of piece color gene close linkage.The invention further relates to primer, the molecules for expanding the molecular labeling
Purposes in the assignment of genes gene mapping of millet leaf color or millet genetic breeding of label and primer, a kind of millet leaf color gene are fixed
Position method and a kind of Millet Breeding method.
Background technology
Millet is initiated by important cereal crops and the characteristic drought-resistant crops in China, and seed sprouting only needs to account for its heavy
The moisture of amount 26%, and the seed of sorghum, wheat and corn sprouts 40%, 45% and 48% water for being respectively necessary for its weight
Point, while millet is higher to the endurance of low soil fertility.Millet is that environmentally friendly crop and diploid self-pollination are made
Object, genome about 470M, is highly suitable as genome research object.
Plant leaf color is the general performance of various pigments in chloroplaset, and normal blade Determination of Chlorophyll is dominant, is usually showed
For green.Leaf variegation is that the frequency of mutation is higher in higher plant and is easy to the mutant character of identification.So far, rice,
Wheat, barley, corn and soybean, cotton, tobacco, corn, sunflower, tomato, cucumber, potato, mulberry tree etc. are nearly all high
Leaf color mutant has been had been found that in plant.Its mutator directly or indirectly influences the synthesis of light and pigment, especially chlorophyll
And degradation, cause the content of various pigments and ratio to change, so as to cause plant leaf variegation.
Hua Da gene studies institute started to millet genomics research project jointly early in 2009, and complete in 2011
At stage Journal of Sex Research, achievement is in May, 2012 in internationally famous magazine《Nature-biotechnology》(Nature
Biotechnology it is delivered online on).Currently, the structure of genetic linkage maps has become the assignment of genes gene mapping, map based cloning and base
Because of the important foundation of group function research, and molecular labeling is the basis for building genetic linkage maps.Leaf color is straight
It connects and is related to crop photosynthesis efficiency, be the Main Agronomic Characters of high yield and stable yields.Therefore, there is an urgent need to find and millet leaf
The molecular labeling of piece color gene close linkage.
Invention content
The present inventor provides a kind of and paddy according to millet whole genome sequence according to a large amount of data analysis and experiment
The molecular labeling SIsv0362 of sub (Setaria italica L.Beauv.) leaf color gene close linkage, and thus provide
Following inventions：
One aspect of the present invention is related to a kind of and millet leaf color gene close linkage molecular labeling SIsv0362,
The molecular labeling is SEQ ID NO：Nucleotide sequence shown in 1.It is design of primers section wherein to underline part：
CAGGTCTACTATTCAAGTCCAATCTCTTTTGACGTACAATCCAACTATAACCTAAGGACATTGCGTTTGTAATGTGT
TTGGTACTACGATTCGCACCCATCCGGGTGCCGGAAAACAAGACATGTCACGCTTGAATTTACCAAGACATACTTTT
TTTTGTAGACGAAAGCATCAAAACAAACTGGTCCGACAATCCCTGCACTTTCCCATTCTTTGCTTATTTCTCCCATC
ACCAAGTTGTCTGCACACAGAAAGAGGGAGGAAAGCACAAGACCCAGTCTCCCCAATGCCCCCCATAGACCAAGTTT GGTTAGACAAGCAAGG(SEQ ID NO:1)
In the present invention, term " molecular labeling with millet leaf color gene close linkage " refers to such molecule mark
Note, in genetic linkage maps, the genetic linkage distance of the molecular labeling and millet leaf color gene is less than 2cM or is less than
3cM；Or being more than in 400 samples in millet, the molecular labeling is contained in the sample of blade edge colour pattern.Blade edge colour pattern
It determines referring to description hereinafter.
The further aspect of the present invention is related to the primer pair of the molecular labeling SIsv0362 of the amplification present invention, the primer pair
Primer 1 is to contain SEQ ID NO:Sequence shown in 2, primer 2 are to contain SEQ ID NO:Sequence shown in 3；Preferably, primer 1 is
SEQ ID NO:Sequence shown in 2, primer 2 are SEQ ID NO:Sequence shown in 3；
SIsv0362F：5’-CCTTGCTTGTCTAACCAAAC-3’(SEQ ID NO:2)
SIsv0362R：5’-CAGGTCTACTATTCAAGTCC-3’(SEQ ID NO:3)
The molecular labeling of the present invention may be containing SEQ ID NO:The DNA fragmentation of nucleotide sequence shown in 1, the DNA
The length of segment is suitable length, but is not particularly limited, for example, less than 10,000bp, it is less than 5,000bp, less than 2,
000bp, it is less than 1,500bp, is less than 1,200bp, is less than 1,000 or is less than 800bp.
In one embodiment of the invention, the molecular labeling (contains SEQ ID NO：Nucleotide sequence shown in 1
DNA fragmentation) it is SEQ ID NO in millet genome：The DNA fragmentation of nucleotide sequence shown in 1, that is, the SEQ ID NO for being included：
Nucleotide sequence other than 15 ' ends and/or 3 ' ends is also the sequence in millet genome, it is preferable that in millet genome
SEQ ID NO：15 ' ends and/or the upstream and downstream sequence at 3 ' ends.As long as it will be understood by those skilled in the art that amplification or inspection
The molecular labeling in millet genomic DNA is surveyed, necessarily can detect or expand to obtain containing SEQ ID NO：Sequence shown in 1
Row.SEQ ID NO：The length of 15 ' ends and/or the upstream and downstream sequence at 3 ' ends is suitable length, is not particularly limited, for example,
The length for meeting molecular labeling is less than 10,000bp, is less than 5,000bp, is less than 2,000bp, is less than 1,500bp, is less than 1,
200bp, it is less than 1,000bp or is less than 800bp.
In one embodiment of the invention, the molecular labeling (contains SEQ ID NO：Nucleotide sequence shown in 1
DNA fragmentation) the SEQ ID NO that are included：15 ' ends and/or 3 ' ends, which are operably connected, artificial sequence and/or control sequence
Row, such as promoter, enhancer, terminator, restriction enzyme site, primer sequence etc..Wherein, term " operationally " is in the present invention
Defined in be a kind of following conformation, in the conformation, control sequence such as promoter is appropriately placed SEQ ID NO：The one of 1
On a position, so that the control sequence instructs SEQ ID NO：The generation of the polypeptide of 1 coding.
Another aspect of the present invention relates to a kind of recombinant vectors, contain the molecular labeling of the present invention.The recombinant vector
Can be the expression vector or cloning vector of the molecular labeling inserted with the present invention.The further aspect of the present invention is related to a kind of heavy
Group cell, contains the recombinant vector.
The further aspect of the present invention is related to a kind of method for the molecular labeling preparing the present invention, includes the following steps：It uses
The millet genomic DNA of blade edge colour pattern carries out PCR amplification as template, with above-mentioned primer pair, and obtained amplified production contains
There is the molecular labeling；Preferably, further include the steps that purifying the product of PCR amplification.In the implementation of the present invention
In scheme, the blade edge colour pattern millet is the F that No. 3 selfings of paddy No. 1, a confused flour beetle 3 or confused flour beetle generate2Leaf in generation
Piece green type.
To those skilled in the art, it will be understood that can also the chemically synthesized methods of DNA obtain the present invention molecule
Label.
The further aspect of the present invention is related to a kind of method of the detection molecular labeling, includes the following steps：
(1) the nucleotide sequence design primer of molecular labeling according to the present invention；
(2) it is expanded using the genomic DNA for being detected millet as template；
(3) judge to whether there is the molecular labeling in amplified production.
Preferably, the primer contains SEQ ID NO respectively to be above-mentioned:2 and SEQ ID NO:3 primer pair.
For example, can be using the genomic DNA of detected millet as template, with above-mentioned primer (SEQ ID NO:2 and SEQ ID
NO:3) PCR amplification is carried out, amplified production is obtained, obtained amplified production can be carried out to sequencing or gel electrophoresis.
The further aspect of the present invention is related to the molecular labeling of the present invention or the primer of the molecular labeling in millet leaf color
Purposes in the assignment of genes gene mapping or detection.
The further aspect of the present invention is related to the molecular labeling of the present invention or the primer of the molecular labeling in millet assistant breeding
In purposes.
The further aspect of the present invention is related to a kind of method of the millet leaf color assignment of genes gene mapping, including uses point of the present invention
The step of primer of son label or the molecular labeling.
The further aspect of the present invention is related to a kind of millet auxiliary breeding means, includes the molecular labeling or use of the detection present invention
The step of primer of the molecular labeling is detected.
The molecular labeling of the present invention can be used in molecular mark from now on, and those skilled in the art can manage
Solution, such as by detecting whether the molecular labeling in the presence of the present invention come whether screen millet leaf color be green (for example, can be with
With reference to, purposes of the DNA molecular marker in wheat breeding for disease resistance, Long Dong institutes journal (natural science edition), April the 16th in 2006
Roll up the 1st phase, P65-69).It detects that the millet leaf color of the molecular labeling with the present invention is green, does not have the molecule mark
The millet leaf color of note is yellow.The detection can be PCR detection method, specifically, can use the above-mentioned present invention
Molecular labeling primer.The detection can also be carried out by the method for sequencing.The millet auxiliary breeding means have quick, letter
Just, high-throughput advantage.
In the present invention, specifically, the millet can be paddy No. 1, millet A2 sterile lines, confused flour beetle 3 or open miscellaneous
The F that No. 3 selfings of paddy generate2Generation.Wherein, the part F that No. 3 millet A2 sterile lines, confused flour beetle selfings generate2On behalf of blade yellow type；
Open the part F that No. 3 selfings of paddy No. 1, confused flour beetle 3 or confused flour beetle generate2On behalf of blade edge colour pattern.
Advantageous effect of the invention
The present invention provides the molecular labelings with millet leaf color gene close linkage, and by millet genomic DNA with
Millet leaf color genetic link gets up, and is more advantageous to the foundation of millet molecular mark system；The molecule mark
Note and the hereditary close linkage distance of leaf color gene are 1.7cM.Molecular labeling, the amplimer of the present invention can be to millet
Leaf color gene carries out good parting, and the early stage identification and screening breeding to realize millet leaf color provide molecule and assist skill
Art supports, can it is easy, quickly, be applied to millet assistant breeding with high throughput, for accelerate millet variety hereditary and selection and
Improvement process has important theory and practice directive significance.
Description of the drawings
Fig. 1：Molecular labeling primer (SEQ ID NO:2 and SEQ ID NO:3) to F2The part knot of 480 single plant amplifications of generation
Fruit.Wherein：
Swimming lane 2,8,10,11,12,14,15,17,19,20,21,23,24 is F2The single plant of 13 plants of blade edge colour patterns in generation
Pcr amplification product.Swimming lane 1,3~7,9,13,16,18,22 is F2The single plant pcr amplification product of 11 plants of blade yellow types in generation.
Swimming lane M is marker, is D2000；Its molecular weight includes 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp.Knot
Fruit shows：Stripe size is 324bp in the plant of blade edge colour pattern, and stripe size is 742bp in the plant of blade yellow type.
Specific implementation mode
Embodiment of the present invention is described in detail in the following with reference to the drawings and specific embodiments, but art technology
Personnel will be understood that the following example is merely to illustrate the present invention, and should not be construed as the limitation of the present invention.In following embodiments
Experimental method be unless otherwise specified to be carried out according to the condition that normal condition or manufacturer suggest.In following embodiments
Material, reagent used etc. are unless otherwise specified commercially or the conventional products of acquisition purchased in market.
Embodiment 1：The structure of millet genetic group
Male parent is paddy No. 1：High plant type, leaf green, a kind of anti-Sethoxydin (herbicide), boot leaf is long and narrow, and bristle is red
Color, glume is red, fertile.
Female parent is A2 sterile lines：Short plant type, blade yellow, not anti-Sethoxydin, boot leaf short-wide, bristle green, glume are green
Color, partial sterility.
Male parent and hybridization of female parent obtain F1(blade edge colour pattern), F1480 F are obtained in selfing2For single plant.To 480 F2It is single
Strain carries out leaf color character analysis, finds 360 plants of blade edge colour pattern, 120 plants of blade yellow type.
Embodiment 2：Parent and F1Generation, F2For the extraction of genes of individuals group DNA
Parent, F are extracted respectively with CTAB methods1The 480 millet F obtained in generation and embodiment 12The genome of single plant
DNA, the specific method is as follows：
(1) the fresh blades of 1.0g are weighed, shreds and is put into mortar, with 3mL1.5 × CTAB is added after liquid nitrogen grinding, are ground into
Homogenate is transferred in the centrifuge tube of 15mL, and 1mL1.5 × CTAB is then added into mortar rinses, then is transferred in centrifuge tube, after mixing
In 65 DEG C of water-bath 30min, during which slowly shake up frequently.
Wherein 1.5 × CTAB formulas are following (1L)：The 1mol/L Tris.HCl (pH 8.0) of CTAB, 75mL of 15g,
0.5mol/L EDTA of 30mL, the NaCl of 61.4g, add deionized water to be settled to 1L, using the preceding mercaptoethanol that 2ml is added, make
The final concentration of 0.2ml/100ml of mercaptoethanol.
(2) it is cooled to room temperature, isometric chloroform/isoamyl alcohol (24 is added:1), gently mixing, until subnatant becomes dark green
Color.
(3) 4200rpm centrifuges 10min, and upper strata aqueous phase is moved on to new 15mL centrifuge tubes, adds 2 times of volumes to be pre-chilled anhydrous
Ethyl alcohol mixes static 5min.30min, which is placed, in -20 DEG C precipitates DNA.
(4) 4200rpm centrifuges 10min, discards supernatant, 75% ethyl alcohol of 1mL washing precipitation is added 1 time, and it is dry to be inverted centrifuge tube
200 μ L TE dissolving DNAs are added in dry DNA.
(5) genomic DNA is detected with 0.8% Ago-Gel.
(6) by obtained Parent, F1Generation and 480 millet F2The genomic DNA of single plant be stored in -20 DEG C it is spare.
Embodiment 3：The preparation of molecular labeling
With extracted in embodiment 2 male parent, F1Generation or F2The genomic DNA of blade edge colour pattern in generation is template, to divide
Sub- labeled primer (SEQ ID NO:2 and SEQ ID NO:3) PCR amplification is carried out.
A.PCR reaction systems：25 μ L systems, the content of each component substance are respectively:1 μ L template DNAs, 0.5 μ L primers Fs,
0.5 μ L primers R, 0.15 μ L dNTPs (10mM), 0.15 μ L Taq archaeal dna polymerases (5U/ μ L), 2.5 10 × PCR of μ L
Buffer、ddH225 μ L of O polishings, mixing, centrifugation.
B. amplification program：94 DEG C of pre-degenerations 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, fortune
35 cycles of row；Last 72 DEG C extend 3 minutes, and pcr amplification product can be preserved at 4 DEG C.
C. amplified production is purified, obtains molecular labeling.It is sequenced after purification, as a result such as SEQ ID NO:Shown in 1.
To those skilled in the art, it will be understood that the molecule mark can also be obtained by the chemically synthesized methods of DNA
Note.
Embodiment 4：The preliminary screening of molecular labeling amplimer
De novo sequencings (60X contig N50 are carried out to male parent:22K, scaffold N50:320K；Total
size:400Mb), female parent carries out resurveying sequence (10X).
According to Parent sequencing data, using SOAP softwares, (such as SOAP2.20, can be from http://
Soap.genomics.org.cn/ is downloaded, and can also use other sequence alignment programs) sequence that compares between Parent is poor
It is different, it is then based on the sequence of difference, at the end of male parent 5 ' and 3 ' the end outside positions about 50bp, randomly selects the sequence of 20bp or so length
Row, with primer premier software Random Design primers, 1105 pairs of primers altogether list portion therein in table 1 below
Separate sequence (the SEQ ID NO of object:2-41).
Table 1:Part primer in 1105 pairs of random primers
Parent and F to be extracted in embodiment 2 respectively1The genomic DNA in generation is template, with 1105 pairs of primers of design
PCR amplification is carried out, the other conditions of PCR reaction systems and program are similar with embodiment 3.
PCR product is subjected to agarose electrophoresis detection, with the validity and polymorphism of detection primer.Refer in this validity
Whether there is amplified production；Polymorphism refers to that the clip size of amplified production between Parent is variant.
The screening of primer is carried out according to following screening criteria：Parent and F1There is amplified production, and Parent expands
Increasing production object only has an apparent banding pattern and size variant, F1It is presented with the heterozygosis banding pattern of Parent banding pattern, that is, has male parent
With two bands of maternal banding pattern.
The selection result：616 pairs of primers are filtered out from 1105 pairs of primers of Random Design.
Embodiment 5：Millet F2Structure for genetic linkage maps and the assignment of genes gene mapping
(1) genetic map construction
Using the 616 pairs of molecular labeling primers filtered out in embodiment 4 to F2480 individuals of group carry out PCR respectively
Detection, it is template used for F obtained in embodiment 22480 individual genomic DNAs of group, other ingredients of PCR system
And PCR programs are same as Example 4.
To PCR product into row agarose gel electrophoresis, wherein molecular labeling primer (SEQ ID NO:2 and SEQ ID NO:
3) as shown in Figure 1 to the partial results of 480 individual amplifications.
Whole electrophoresis results are subjected to data statistic analysis, the specific method is as follows：By F2Group's single plant amplified band is father
This type is denoted as a, and amplified band is the b that is denoted as of maternal type, and amplified band is denoted as h containing male parent type and maternal type simultaneously, all
It is not no be denoted as-, finally obtain F2The genotype data of 480 individual 616 pair primer amplifications of group.For example, with first pair
480 individual data that primer obtains are a, b, h ,-, totally 480 data, the data obtained with second pair of primer are b ... ...
B, a, h, a ,-... ... totally 480 data, totally 616 pairs of primers count respectively, gained is the F2The genotype data of group.
With 3.0 softwares of MapMaker (Constructing genetic maps with MAPMAKER/EXP 3.0, S
Lincoln,M Daly,E Lander-Cambridge,MA:Whitehead Institute, 1992) carry out genetic linkage map
Spectrum is drawn, and genetic linkage map is obtained.The position of 616 pairs of primers and the heredity with leaf color gene are designated on genetic linkage map
Distance.
(2) assignment of genes gene mapping
It is similar with male parent type character to be denoted as a (leaf color green type) according to 480 individual leaf color phenotypes,
Similar with maternal type character to be denoted as b (leaf color yellow type), character occupy and is denoted as h between male parent and female parent, obtains 480
The phenotypic data of individual, 480 individual phenotypic datas are compared with the 480 individual genotype datas obtained before
Compared with similar Gao Ze represents the label and leaf color character close linkage.
According to the above results by the leaf color assignment of genes gene mapping on genetic linkage maps.
Embodiment 6：With the verification of the molecular labeling of millet leaf color gene close linkage
1. made from embodiment 5 on the basis of genetic linkage maps, even according to the heredity with millet leaf color gene
Distance is locked, in the hereditary close linkage with millet leaf color gene apart from the location determination for being 1.7cM molecular labeling primer
(SEQ ID NO:2 and SEQ ID NO:3), and corresponding male parent sequence location is found, the sequence between upstream and downstream primer is
Molecular labeling, nucleotide sequence such as SEQ ID NO:Shown in 1.
2. in embodiment 5 to F2In 480 individual pcr amplification product electrophoresis in generation, molecular labeling primer (SEQ
ID NO:2 and SEQ ID NO:3) amplification is：The amplified production of 453 blade edge colour patterns has the item of 324bp sizes
Band, and the pcr amplification product of 27 blade yellow types has the band of 742bp, and the nucleotide of the 324bp is proved through sequencing
Sequence and SEQ ID NO:1 is identical.
As it can be seen that molecular labeling (the SEQ ID NO of the present invention:1) it is the molecule with millet leaf color gene close linkage
Label.
Although the specific implementation mode of the present invention has obtained detailed description, it will be understood to those of skill in the art that root
According to all introductions having disclosed, these embodiments can be carry out various modifications and be replaced, these change the present invention's
Within protection domain.The full scope of the present invention is given by the appended claims and any equivalents thereof.
Sequence table
<110>Shenzhen Hua Da millet industry limited liability company
Central Plains Hua Da agricultural science and technology Co., Ltd
<120>With the molecular labeling SIsv0362 of millet leaf color gene close linkage
<130> P2017-1-0173.CN
<160> 41
<170> SIPOSequenceListing 1.0
<210> 1
<211> 324
<212> DNA
<213> Setaria italica
<400> 1
caggtctact attcaagtcc aatctctttt gacgtacaat ccaactataa cctaaggaca 60
ttgcgtttgt aatgtgtttg gtactacgat tcgcacccat ccgggtgccg gaaaacaaga 120
catgtcacgc ttgaatttac caagacatac ttttttttgt agacgaaagc atcaaaacaa 180
actggtccga caatccctgc actttcccat tctttgctta tttctcccat caccaagttg 240
tctgcacaca gaaagaggga ggaaagcaca agacccagtc tccccaatgc cccccataga 300
ccaagtttgg ttagacaagc aagg 324
<210> 2
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 2
ccttgcttgt ctaaccaaac 20
<210> 3
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 3
caggtctact attcaagtcc 20
<210> 4
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 4
gccatgccat ctgcgttctc 20
<210> 5
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 5
actctgatcg caacaaggac 20
<210> 6
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 6
cttcacactt cccacttcac 20
<210> 7
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 7
aagtttgcga gcaagcacaa 20
<210> 8
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 8
cctttgcagc atctgtacgt 20
<210> 9
<211> 19
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 9
ggtgtcacgc tcgatcgac 19
<210> 10
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 10
ctccattgtg gtttgtccac 20
<210> 11
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 11
ctcttgctat tgcgcatcct 20
<210> 12
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 12
agccagctgg agaagagaat 20
<210> 13
<211> 19
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 13
cccaagtcca actgaaggc 19
<210> 14
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 14
ctggaatagc cgtagctaat 20
<210> 15
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 15
ccaacttgca acacgcaaat 20
<210> 16
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 16
ggactgggtc atgaatactg 20
<210> 17
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 17
atggactatt ggactgtatg t 21
<210> 18
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 18
tcgtctccaa gccgtccagt 20
<210> 19
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 19
ccaatgtatt ggccctaagc 20
<210> 20
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 20
gctaaggttc cgatctgtct 20
<210> 21
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 21
cggatacgag tcgtgtttgt 20
<210> 22
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 22
ccttcaacct gactttgcac 20
<210> 23
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 23
catgacaagg atcgtcacag 20
<210> 24
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 24
ccaagtgtgt atgcgacaag 20
<210> 25
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 25
ccagcttgct taaggtatca 20
<210> 26
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 26
gcagtgtgtt tctttcatgg 20
<210> 27
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 27
gcaatggttg atagatacga t 21
<210> 28
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 28
ttcgttggct gtagcgttga 20
<210> 29
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 29
gaagaaatca ccaacataac c 21
<210> 30
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 30
caggacatcg ccatggtact 20
<210> 31
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 31
atgaagcgag caagtgaact 20
<210> 32
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 32
tggattatgt ggagccatgt 20
<210> 33
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 33
gcattggtct tcttccaagg 20
<210> 34
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 34
gtttctgcgc taatctgatc 20
<210> 35
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 35
ccgaaatggt ggcaattgct 20
<210> 36
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 36
gagtatgtcg accgtagtac t 21
<210> 37
<211> 21
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 37
gtgatggatt tgcttgtcac t 21
<210> 38
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 38
caggagcttt tgacagtgag 20
<210> 39
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 39
aggtacgctt cccttgtcat 20
<210> 40
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 40
cctacacacc gctataaacc 20
<210> 41
<211> 20
<212> DNA
<213>Artificial synthesized (Artificial Sequence)
<400> 41
atcgtgtacc cagctccgtt 20
Claims (10)
1. a kind of and millet leaf color gene close linkage molecular labeling, it is characterised in that：The molecular labeling contains SEQ
ID NO:Nucleotide sequence shown in 1；Preferably, the molecular labeling is SEQ ID NO:Nucleotide sequence shown in 1.
2. a kind of recombinant vector, it is characterised in that：Contain molecular labeling described in claim 1.
3. a kind of recombinant cell, it is characterised in that：Contain the recombinant vector described in claim 2.
4. a kind of primer pair of amplification molecular labeling described in claim 1, it is characterised in that：The primer 1 of the primer pair is
Contain SEQ ID NO:Sequence shown in 2, primer 2 are to contain SEQ ID NO:Sequence shown in 3；Preferably, primer 1 is SEQ ID
NO:Sequence shown in 2, primer 2 are SEQ ID NO:Sequence shown in 3.
5. a kind of method preparing molecular labeling described in claim 1, includes the following steps：Use blade edge colour pattern millet
Genomic DNA carries out PCR amplification as template, with the primer pair described in claim 4；Preferably, further include by PCR amplification
The step of product is purified；Specifically, the blade edge colour pattern millet is paddy No. 1, a confused flour beetle 3 or opens confused flour beetle 3 certainly
Hand over the F generated2Blade edge colour pattern in generation.
6. a kind of method that test right requires the molecular labeling described in 1, includes the following steps：It is according to claim 1
The nucleotide sequence design primer of molecular labeling；Genomic DNA to be detected millet is expanded as template；Judge amplification
It whether there is the molecular labeling in product；Preferably, the primer is the primer pair described in claim 4.
7. the primer pair of the molecular labeling described in molecular labeling described in claim 1 or claim 4 is in millet leaf color
Purposes in the assignment of genes gene mapping or detection.
8. the primer pair of the molecular labeling described in molecular labeling described in claim 1 or claim 4 is in millet assistant breeding
In purposes.
9. a kind of method of the millet leaf color assignment of genes gene mapping, it is characterised in that：The method includes using described in claim 1
Molecular labeling or claim 4 described in molecular labeling primer pair the step of.
10. a kind of millet auxiliary breeding means, it is characterised in that：The method includes test rights to require the molecule mark described in 1
The step of remembering or being detected with the primer pair of the molecular labeling described in claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711295539.4A CN108660234A (en) | 2017-12-08 | 2017-12-08 | With the molecular labeling SIsv0362 of millet leaf color gene close linkage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711295539.4A CN108660234A (en) | 2017-12-08 | 2017-12-08 | With the molecular labeling SIsv0362 of millet leaf color gene close linkage |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108660234A true CN108660234A (en) | 2018-10-16 |
Family
ID=63785039
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711295539.4A Pending CN108660234A (en) | 2017-12-08 | 2017-12-08 | With the molecular labeling SIsv0362 of millet leaf color gene close linkage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660234A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046458A (en) * | 2019-12-27 | 2021-06-29 | 深圳华大三生园科技有限公司 | Molecular marker closely linked with millet leaf angle gene, detection method and application |
| CN113278719A (en) * | 2020-02-20 | 2021-08-20 | 深圳市华大农业应用研究院 | Molecular marker SIsv0523 closely linked with millet leaf angle gene |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154282A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet |
| CN102154285A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0737 closely linked with millet leaf color gene |
| CN102690811A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv1363 closely linked with Setaria italica L. Beauv. leaf color gene |
| CN102690810A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv0690 closely linked with Setaria italica L. Beauv. leaf color gene |
-
2017
- 2017-12-08 CN CN201711295539.4A patent/CN108660234A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154282A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet |
| CN102154285A (en) * | 2011-03-24 | 2011-08-17 | 深圳华大基因科技有限公司 | Molecular marker SIsv0737 closely linked with millet leaf color gene |
| CN102690811A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv1363 closely linked with Setaria italica L. Beauv. leaf color gene |
| CN102690810A (en) * | 2011-03-24 | 2012-09-26 | 深圳华大基因科技有限公司 | Molecular marker SIsv0690 closely linked with Setaria italica L. Beauv. leaf color gene |
Non-Patent Citations (1)
| Title |
|---|
| GENGYUN ZHANG等: "Genome sequence of foxtail millet (Setaria italica) provides insights into grass evolution and biofuel potential", 《NATURE BIOTECHNOLOGY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046458A (en) * | 2019-12-27 | 2021-06-29 | 深圳华大三生园科技有限公司 | Molecular marker closely linked with millet leaf angle gene, detection method and application |
| CN113046458B (en) * | 2019-12-27 | 2023-05-23 | 深圳华大三生园科技有限公司 | Molecular marker closely linked with millet leaf included angle gene, detection method and application |
| CN113278719A (en) * | 2020-02-20 | 2021-08-20 | 深圳市华大农业应用研究院 | Molecular marker SIsv0523 closely linked with millet leaf angle gene |
| CN113278719B (en) * | 2020-02-20 | 2024-01-30 | 深圳市华大农业应用研究院 | Molecular marker SIsv0523 closely linked with millet leaf angle gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN102154282B (en) | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN102031259B (en) | Molecular marker SIsv0641 closely linked with millet plant height genes | |
| CN109735648B (en) | Method for screening wheat with different thousand grain weights and special kit thereof | |
| CN108660234A (en) | With the molecular labeling SIsv0362 of millet leaf color gene close linkage | |
| CN102690812A (en) | Molecular marker SIsv0067 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN102002497B (en) | Molecular mark SIsv0115 tightly interlinked with millet plant height gene | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| CN110129479A (en) | Detect the Bi-PASA labeled primer and method of tobacco eIF4E-1 gene single base insertion mutation | |
| CN102154285B (en) | Molecule marker SIsv0737 closely linked with millet leaf color gene | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN108660237A (en) | A kind of molecular labeling SIsv1099 and application with millet Plant height gene close linkage | |
| CN108660230A (en) | A kind of molecular labeling SIsv0163 with millet anti-imazethapyr herbicide resistance gene close linkage | |
| CN110819638B (en) | Rice FL1 gene and molecular marker and application thereof | |
| CN108660233A (en) | A kind of molecular labeling SIsv0456 with millet anti-imazethapyr herbicide resistance gene close linkage | |
| CN102154284B (en) | Molecular marker SIsv0408 capable of being closely linked to Setaria italica pollen color gene | |
| CN102690818A (en) | Molecular marker SIsv0832 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN107190093B (en) | Functional molecular marker for screening late flowering characteristics of corn under long-day conditions and application of functional molecular marker | |
| CN109913579A (en) | A kind of barley phosphorus element efficiently utilizes molecular labeling and the application of QTL site | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN108660232A (en) | A kind of molecular labeling SIsv0338 and application with millet Plant height gene close linkage | |
| CN108660231A (en) | With the molecular labeling SIsv1208 of the anti-Sethoxydin herbicide resistance gene close linkage of millet | |
| CN106350514B (en) | With the molecular labeling OSblb-SV4 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181016 |
|
| WD01 | Invention patent application deemed withdrawn after publication |