CN108660222B - KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof - Google Patents
KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof Download PDFInfo
- Publication number
- CN108660222B CN108660222B CN201810673123.XA CN201810673123A CN108660222B CN 108660222 B CN108660222 B CN 108660222B CN 201810673123 A CN201810673123 A CN 201810673123A CN 108660222 B CN108660222 B CN 108660222B
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- pig
- kpna7
- individuals
- traits
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of pig molecular marker screening, and particularly relates to a KPNA7 gene fragment serving as a molecular marker related to pig reproduction traits and application thereof. The molecular marker is associated with the pig breeding traits such as the number born alive, the effective number born alive, the birth weight average evenness of piglets and the number traits of mummy. The molecular marker is obtained by cloning from a gene KPNA7 which influences the development of porcine oocytes, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO:1, a C/T mutation exists at 47bp of the sequence, and the mutation causes Hpy166II-RFLP polymorphism. The invention also discloses application of the molecular marker in association of pig breeding traits, particularly the number born alive, the effective number born alive, the birth weight average uniformity of piglets and the number trait of mummy.
Description
Technical Field
The invention belongs to the technical field of pig molecular marker screening, and particularly relates to a KPNA7 gene as a molecular marker related to pig reproduction traits and application thereof, wherein the pig reproduction traits comprise traits such as pig live litter size (NBA), effective live litter size (ENBA), piglet birth weight average uniformity (CV), Mummy number (Mummy) and the like. The molecular marker is obtained by cloning from a pig KPNA7 gene, and comprises the detection of a mutation site in a 6 th exon sequence of a pig KPNA7 gene and the application thereof.
Background
In the pig industry, the number born alive and the like are important economic traits, the traits belong to low heritability traits (Schneider et al 2012), and the breeding traits are improved by using the traditional breeding means, so that the time is long and the process is slow. In modern breeding work, molecular breeding becomes a new way for effectively improving reproductive traits, so that identification of regulatory genes or markers related to the porcine reproductive traits can lay a foundation for improving the porcine reproductive traits by applying a molecular breeding technology.
Researchers at home and abroad find that the high litter size performance of the pig species in the Taihu lake basin in China is related to the high ovulation capacity of the pig species, and the ovulation number is the first element for determining the litter size (Zhang 1991; Tergui et al 1992). Later studies found that the number of corpus luteum is in positive correlation with the number of embryos and litter size of Tianjin white pigs and Changbai pigs at 30 days of gestation (Zhoudhai et al 2001). Foxccroft et al (2006) believe that a high ovulation rate may lead to negative consequences such as a reduced fetal survival rate, an impact on fetal weight and carcass quality, in addition to increased litter size, possibly due to uterine tolerance stress. Therefore, the development and maturation of porcine oocytes may affect the number of ovulatory cells and thus the number of born and other reproductive traits.
Guo et al (2016) discovered that intron 6 and intron 8 of the KPNA7 gene are located in QTL regions associated with swine litter size and 5-day live litter size traits using a whole genome association analysis approach. The KPNA7 gene belongs to the nuclear transport protein family (Kayopterin), mainly mediates the transport of macromolecular substances inside and outside the nucleus, and participates in important biological processes such as gene expression, cell division, apoptosis, cell polarity establishment and the like (Yangjing and Zhu Yu Song 2003). The research finds that KPNA7 is expressed in bovine oocytes, and the KPNA7 gene is knocked out, so that early embryo dysplasia is caused (Tejomura et al 2009). In mice, the KPNA7 gene was expressed in mouse oocytes, and after mutation of this gene, partial embryo death and reduced mouse fertility were found after 8.5 days of gestation (Hu et al 2010). Recent studies have found that the expression of the KPNA7 gene in porcine GV, MII oocytes, 2-cell embryos and 4-cell embryos may regulate porcine oocyte maturation and early embryo division (Xin Wang et al 2012). In view of the above research results, the applicant believes that the KPNA7 gene may play an important role in the development, maturation and early embryo development of porcine oocytes, thereby affecting the reproductive traits of sows. The association analysis of polymorphic sites of gene mutation in a population is a powerful method for researching gene functions, so that the applicant performs polymorphic association analysis on KPNA7 genes to provide new molecular markers for the reproductive traits of pigs.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, and the KPNA7 gene fragment is used as a molecular marker related to the porcine reproductive traits and the application. The breeding traits of the pig mainly comprise the traits of live birth Number (NBA), effective live birth number (ENBA), piglet birth weight average uniformity (CV), Mummy number (Mummy) and the like. The molecular marker is obtained by cloning from the 6 th exon of KPNA7 gene, and provides a related marker for detecting characters such as sow born alive litter size, effective alive litter size, piglet birth weight average uniformity, mummy number and the like by establishing a polymorphism detection method of mutation sites.
The technical scheme of the invention is as follows:
the applicant obtains a molecular marker related to the pig breeding traits, particularly the traits of born alive litter size, effective alive litter size, piglet birth weight average uniformity and mummy number, and the nucleotide sequence of the molecular marker is as follows:
TTGTTGCCTAGCTCGGTGAGCTCATTTAAAGACACTCACTGGTACAY(C/T)TTGAGGAAGCCAGGGCCAGCAGATGTGGGATGGCATTGCTGGAGATAACGATGTCTCTGAATTCTGCGCCATCACCTACAAATAGGGGAGAACATGACACTCAAAGAGGGAACACAGGGAACCCGGGGTGGGTGACGAATTCTT，
y at position 47 in the above sequence is C or T, and the mutation results in Hpy166II-RFLP polymorphism.
The applicant has designed a primer pair for detecting the above molecular marker, whose DNA sequence is shown below:
a forward primer: TTGTTGCCTAGCTCGGTGAG the flow of the air in the air conditioner,
reverse primer: AAGAATTCGTCACCCACCCC are provided.
The applicant provides a screening method of molecular markers (namely KPNA7 gene exon 6) related to pig breeding traits, particularly to the traits of live litter size, effective live litter size, piglet primary weight average uniformity and mummy number and an application method of PCR-Hpy166II-RFLP in association analysis of the traits of live litter size, effective live litter size, piglet primary weight average uniformity and mummy number of pigs, wherein the method comprises the following specific steps:
(1) by consulting in the Ensemble database (see: http:// www.ensembl.org/Sus _ scrofa/Gene/Summary), applicants found a candidate SNP in exon 6 of the KPNA7 Gene (accession number rs326578619, Sscofa 10.2);
(2) designing a primer according to the genome sequence (Gene Bank Accession: NC-010445.4) of the porcine KPNA7 Gene in an NCBI database (Sscofa 10.2) to clone the mutation site, wherein the forward primer is: 5' -
TTGTTGCCTAGCTCGGTGAG-3', the reverse primer is: 5'-AAGAATTCGTCACCCACCCC-3' (SEQ ID NO:2 and SEQ ID NO:3), extracting genome DNA from the ear tissue sample of the sow of the white pig as a template, cloning to obtain a partial DNA sequence of KPNA7 gene, wherein the sequence is shown as follows (the length is 191bp, the sequence of SEQ ID NO:1 in the sequence table is as follows, but the 47 th sequence is a sequence which is replaced after mutation):
TTGTTGCCTAGCTCGGTGAGCTCATTTAAAGACACTCACTGGTACAYTTGAGGAAGCCAGGGCCAGCAGATGTGGGATGGCATTGCTGGAGATAACGATGTCTCTGAATTCTGCGCCATCACCTACAAATAGGGGAGAACATGACACTCAAAGAGGGAACACAGGGAACCCGGGGTGGGTGACGAATTCTT，
y in the sequence is T or C, and the mutation causes Hpy166II-RFLP polymorphism;
wherein: the 1 st-20 th sequence in the above sequences is the forward primer for amplifying the fragment, and the 172 nd-191 th sequence is the reverse primer for amplifying the fragment (the above primer sequences are also the primer sequences for detecting the molecular marker polymorphism screened by the present invention);
(3) and (3) detecting the 47 th base of the sequence by using a PCR-RFLP method:
the SNP detection method comprises the following steps: an Hpy166II enzyme cutting site exists on the 191bp fragment obtained by amplification, electrophoresis detection is carried out on a PCR product after enzyme cutting, and a sequencing detection result shows that 3 genotypes exist at the C/T site of the KPNA7 gene (shown in figure 3): namely: CC (44bp, 147bp) genotype, CT (191bp, 147bp, 44bp) genotype, TT (191bp) genotype. The enzyme cutting electrophoresis result confirms that the mutation site exists in the 6 th exon of KPNA7 gene.
(4) The application of the mutation site (rs326578619) in the breeding traits of the sows is not clear, so that the site genotype and the breeding traits of the sows are subjected to correlation analysis.
The molecular marker can be applied to the marker-assisted selection of the porcine reproductive traits, particularly the number born alive, the effective number born alive, the birth weight average uniformity of piglets and the number traits of mummy.
The primer pair can be applied to marker-assisted selection of pig breeding traits, particularly the number born alive, the effective number born alive, the birth weight average uniformity of piglets and the number of mummy.
The detailed technical scheme and the effect are shown in the detailed description.
Drawings
The sequence table SEQ ID NO 1 is a nucleotide sequence of the molecular marker screened by the invention, the sequence length is 191bp, an allelic gene pattern (C or T mutation) exists at the 47bp position of the sequence, and the mutation causes Hpy166II-RFLP polymorphism.
SEQ ID NO. 2 of the sequence Listing is the forward primer sequence for detecting molecular markers (also the forward primer sequence for amplifying KPNA7 gene fragments).
The sequence table SEQ ID NO3 is a reverse primer sequence for detecting molecular markers (also a reverse primer sequence for amplifying KPNA7 gene fragments).
FIG. 1: the technical flow chart of the invention.
FIG. 2: the nucleotide sequence of the molecular marker screened by the invention (the underlined part sequence is a primer sequence, wherein an English letter Y represents a mutation site, and the site is positioned at the 47 th base).
FIG. 3: the KPNA7 gene Hpy166II-RFLP has three genotypes (namely CC CT TT) electrophoresis results. Description of reference numerals: m in fig. 3: DNA molecular weight standards (DL2000, available from Bao bioengineering, Dalian, Inc.). Lane 1: PCR product, lane 2: type CC, lane 3: CT type, lane 4: TT type
Detailed Description
EXAMPLE 1 establishment of PCR-RFLP diagnostic method
(1) The primer sequence is as follows:
a forward primer: 5 'TTGTTGCCTAGCTCGGTGAG 3' of the composition,
reverse primer: 5 'AAGAATTCGTCACCCACCCC 3';
PCR amplification conditions:
the total volume of PCR reaction was 10. mu.L, wherein the pig genome DNA was about 100ng, 5. mu.L of PCR Mix, and the forward primer and the reverse primer were 0.2. mu.L each. The PCR amplification procedure was: at 94 ℃ for 5min, cycle 32 times at 94 ℃ for 30s, 60 ℃ for 30s, then 72 ℃ for 25s, and finally 72 ℃ extension for 5 min. The PCR reaction product was detected by 2% agarose gel electrophoresis to obtain a 191bp (SEQ ID NO:3) specific amplified fragment.
(2) PCR-RFLP detection conditions
The volume of the PCR product digested was 10. mu.L, 1 XBuffer 1. mu.L, the PCR product 3. mu.L, the restriction enzyme Hpy166II was 0.5. mu.L (1U), and the digestion reaction was performed with H2And supplementing the amount of the obtained product to 10 mu l, mixing the obtained mixture uniformly, centrifuging the mixture, carrying out water bath at 37 ℃ for 1h, detecting the enzyme digestion result by using 2% agarose gel electrophoresis, recording the genotype, and taking a picture under an ultraviolet lamp. The sequencing results of two homozygotes at the site show that when the 47bp position is T, the Hpy166II enzyme cutting site does not exist, the detection result after Hpy166II enzyme cutting is only 1 fragment, and the length is 191bp (which is determined as allele T). However, when there is a T47 → C47 substitution, this results in the generation of a Hpy166II cleavage site at the 47bp position, resulting in 2 fragments with lengths of 44bp and 147bp, respectively (designated as allele C), and the three genotypes CC, CT and TT are shown in FIG. 3.
Example 2 application of the molecular marker of the invention in correlation analysis of pig litter size marker traits
The experimental swine herd used in the correlation analysis of this example was 530 big white swine from a certain pig farm in the south of China, and all sows were genotyped. The Dan line white pig live litter size (NBA) character was taken from the breeding record of pig farm 2016-2017.
According to the reproduction record information and the population structure of the collected sample, the invention applies a general linear model to statistically analyze the genotype effect of the SNP site of the KPNA7 gene and the relationship between the genotype effect and the birth survival number trait.
Adopting SAS software to carry out character association analysis on the polymorphism of the mutation site, wherein the specific model is as follows:
Yilm＝μ+genei++mate_seasonl+number_of_littermatem+eilm
y is the trait value, μ is the overall mean, the fixation effect: genotype effect geneiAnd mate _ search in mating seasonl(ii) a Covariates: number of piglets in same litter of sow _ of _ littermatem；eilmIs a random error.
The character association analysis is carried out on the Dan-line big white pig KPNA7 gene Hpy166II-RFLP polymorphic site, and the result of the mutation site typing is as follows: dan is big white pig CC type 207, CT type 151, TT type 172. The character and the genotype of the number of live piglets of the Dan line Bai sow are subjected to correlation analysis, and the mutation is found to be remarkably related to the number of live piglets of the head fetus of the Dan line Bai sow (P is less than 0.05), the number of live piglets of a CT type individual and a TT type individual is remarkably higher than that of a CC type individual (P is less than 0.05), and the number of live piglets of the CT type sow and the number of live piglets of the TT type sow have no remarkable difference. The results are shown in Table 1.
TABLE 1 correlation analysis result of SNP locus of pig KPNA7 gene and pig head litter size of Dan-series white pig
Note: in table 1, the property values are the least squares means ± standard error, and P <0.05 represents significant difference.
Example 3 application of the molecular marker of the present invention in correlation analysis of marker traits of effective number of born alive piglets
The experimental herd used for association analysis in this example was a big white pig from a pig farm in south China, 262 big white sows in the American line, and all sows were genotyped to determine their genotypes. The character of effective live born number (ENBA) of the American white pig is obtained from the breeding record data of 2016-.
According to the reproduction record information and the population structure of the collected sample, the invention uses a general linear model to statistically analyze the genotype effect of the SNP site of the KPNA7 gene and the relationship between the genotype effect and the character of effective survival number.
Adopting SAS software to carry out character analysis on the polymorphism of the mutation site, wherein the specific model is as follows:
Yijlm＝μ+genei+Parityj+mate_seasonl+number_of_littermatem+eijlm
y is the trait value and μ is the overall mean, where the fixation effects include: genotype effect geneiPrime effect of fetal rhythmjAnd mate _ search in mating seasonl(ii) a Covariates: number of piglets in same litter of sow _ of _ littermatem；eijlmIs a random error.
Performing character association analysis on the Hpy166II-RFLP polymorphic site of KPNA7 gene of the big white pig, wherein the CC type is 34 heads, the CT type is 90 heads and the TT type is 138 heads in the American white pig. The correlation analysis of the effective number of live piglets of the sow and the genotype shows that the mutation is obviously correlated with the effective number of live piglets of the big white pigs of the American line (P <0.05), the effective number of live piglets of CT type individuals and TT type individuals is obviously more than that of CC type individuals (P <0.05), and the effective number of live piglets of CT type individuals and TT type individuals has no obvious difference. The results are shown in Table 2.
TABLE 2 correlation analysis of SNP site of KPNA7 gene in pig and effective number of born alive piglets of Dabai pig of Mei-Produced line
Note: in table 2, the property values are the least squares means ± standard error, and P <0.05 represents significant difference.
Example 4 application of the molecular marker of the present invention in correlation analysis of piglet birth weight uniformity marker traits
The experimental swine herd used in the correlation analysis of this example was 530 big white sows in Dan line from a certain pig farm in south China, and all sows were genotyped to determine their genotypes. The piglet birth weight average uniformity (CV) character was taken from the breeding record of pig farm 2016-.
According to the reproduction record information and the group structure of the collected sample, the invention applies a general linear model to statistically analyze the genotype effect of the KPNA7 gene SNP site and the relationship between the genotype effect and the birth weight average evenness of the piglets.
Adopting SAS software to carry out character association analysis on the polymorphism of the mutation site, wherein the specific model is as follows:
Yilm＝μ+genei+mate_seasonl+number_of_littermatem+eilm
y is the trait value and μ is the overall mean, where the fixation effects include: genotype effect geneiAnd mate _ search in mating seasonl(ii) a Number of covariate sows litter: number _ of _ bitmapm；eilmIs a random error.
Performing character association analysis on the polymorphism sites Hpy166II-RFLP of KPNA7 gene of big white pig, wherein the genotyping result of the mutation sites is as follows: dan is Dabai pig CC type, 207 head, CT type, 151 head, TT type, 172 head. Correlation analysis is carried out on piglet birth weight average evenness and genotype, and the mutation is found to be very obviously correlated with the birth weight average evenness of the second piglet of the Dan-line large white sow (P is less than 0.01), wherein the piglet birth weight average evenness of the CC type individual is obviously superior to that of the CT type individual (P is less than 0.05), and the piglet birth weight average evenness of the CC type individual is very superior to that of the TT type individual (P is less than 0.01). The results are shown in Table 3.
TABLE 3 correlation analysis results of SNP sites of KPNA7 gene of pig and the birth weight average uniformity of the second piglet of Dan-system Bai sow
Note: in table 3, the property values are least squares ± sd, P <0.05 represents significant difference, and P <0.01 represents very significant difference.
Example 5 application of the molecular marker of the invention in correlation analysis of the mummy number marker traits of sows
The experimental swine herd used in the correlation analysis of this example was from 530 Dan line Dabai sows from a certain pig farm in south China, and all the sows from the Dabai pigs were genotyped and their genotypes were determined. The Mummy number character is obtained from the reproduction record data of the pig farm 2016-2017, and the Mummy number (Mummy) produced by the multiparous sow is recorded.
According to the reproduction record information and the population structure of the collected sample, the invention applies a general linear model to statistically analyze the genotype effect of the SNP site of the KPNA7 gene and the relationship between the genotype effect and the mummy character.
Adopting SAS software to carry out character analysis on the polymorphism of the mutation site, wherein the specific model is as follows:
Yijlm＝μ+genei+parityj+mate_seasonl+number_of_littermatem+eijlm
y is the trait value and μ is the overall mean, where the fixation effects include: genotype effect geneiParity effect of fetal rhythmjAnd mate _ search in mating seasonl(ii) a Covariates: number of piglets in same litter of sow _ of _ littermatem；eijlmIs a random error.
The polymorphism sites of the KPNA7 gene Hpy166II-RFLP of the big white pig are subjected to character association analysis, and the results are shown in Table 4.
TABLE 4 correlation analysis results of SNP sites of pig KPNA7 gene and the number of mummy produced by large white pigs of multiparous Dan line
Note: in table 4, the property values are the least square mean ± sem, P <0.05 represents significant difference, and P <0.01 represents very significant difference.
The mutation site typing results are as follows: dan is big white pig CC type, 207 head, CT type, 151 head and TT type, 172 head. The correlation analysis of the birth weight average uniformity and the genotype of the piglets shows that the mutation is obviously related to the mummy production character of the Dan-line large white pigs (P <0.05), wherein the mummy production number of CC type individuals is obviously more than that of CT type individuals (P <0.05), and the mummy production number of CC type individuals is obviously more than that of TT type individuals (P < 0.01).
Sequence listing
<110> university of agriculture in Huazhong
<120> KPNA7 gene fragment as molecular marker related to porcine reproductive traits and application thereof
<141> 2018-06-25
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 191
<212> DNA
<213> pig (Sus scrofa)
<220>
<221> gene
<222> (1)..(191)
<220>
<221> mutation
<222> (47)..(47)
<400> 1
ttgttgccta gctcggtgag ctcatttaaa gacactcact ggtacatttg aggaagccag 60
ggccagcaga tgtgggatgg cattgctgga gataacgatg tctctgaatt ctgcgccatc 120
acctacaaat aggggagaac atgacactca aagagggaac acagggaacc cggggtgggt 180
gacgaattct t 191
<210> 2
<211> 20
<212> DNA
<213> pig (Sus scrofa)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 2
ttgttgccta gctcggtgag 20
<210> 3
<211> 20
<212> DNA
<213> pig (Sus scrofa)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 3
aagaattcgt cacccacccc 20
Claims (1)
1. Is located atKPNA7The application of Hpy166II-RFLP molecular marker of gene exon 6 in sow breeding trait marker assisted selection, wherein sow breeds comprise Dan line white pigs and Mei line white pigs, the Dan line white pig breeding traits comprise sow live litter size, second piglet primary weight average uniformity and Mummy number production traits, the Mei line white pig breeding traits comprise effective live litter size, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, a C or T allelic gene mutation is positioned at 47 of the sequence shown as SEQ ID NO. 1, and the mutation causes Hpy166II-RFLP polymorphism; wherein: the number of born alive piglets of the Dan-line big white pig is significantly higher than that of the Dan-line big white pig in the 47 th position of the molecular marker, namely CT type individuals and TT type individuals; the newborn weight-average evenness of the piglets of the CC type individual is obviously superior to that of the piglets of the CT type individual and that of the piglets of the TT type individual; the number of mummy produced by CC individuals is obviously more than that of CT individuals and TT individuals; the number of effective born alive piglets of the big white pigs with the birth beauty system is significantly more than that of CC individuals in CT individuals and TT individuals at the 47 th position of the molecular marker.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810673123.XA CN108660222B (en) | 2018-06-26 | 2018-06-26 | KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810673123.XA CN108660222B (en) | 2018-06-26 | 2018-06-26 | KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108660222A CN108660222A (en) | 2018-10-16 |
| CN108660222B true CN108660222B (en) | 2021-05-11 |
Family
ID=63773165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810673123.XA Active CN108660222B (en) | 2018-06-26 | 2018-06-26 | KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660222B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263154A (en) * | 1999-01-25 | 2000-08-16 | 日本化学研究株式会社 | Human tumor suppressor gene |
| CN103421768A (en) * | 2012-07-02 | 2013-12-04 | 华中农业大学 | Molecular marker related to piglet birth weight and use thereof |
| CN107779516A (en) * | 2017-09-12 | 2018-03-09 | 华南农业大学 | A kind of SNP marker for influenceing pig birth weight character and its application |
| CN107967409A (en) * | 2017-11-24 | 2018-04-27 | 中国农业大学 | One boar full-length genome low-density SNP chip and preparation method thereof and application |
| KR20180049486A (en) * | 2016-11-03 | 2018-05-11 | 전북대학교산학협력단 | A breeding pig economic trait prediction using SNP chip and related business model |
-
2018
- 2018-06-26 CN CN201810673123.XA patent/CN108660222B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263154A (en) * | 1999-01-25 | 2000-08-16 | 日本化学研究株式会社 | Human tumor suppressor gene |
| CN103421768A (en) * | 2012-07-02 | 2013-12-04 | 华中农业大学 | Molecular marker related to piglet birth weight and use thereof |
| KR20180049486A (en) * | 2016-11-03 | 2018-05-11 | 전북대학교산학협력단 | A breeding pig economic trait prediction using SNP chip and related business model |
| CN107779516A (en) * | 2017-09-12 | 2018-03-09 | 华南农业大学 | A kind of SNP marker for influenceing pig birth weight character and its application |
| CN107967409A (en) * | 2017-11-24 | 2018-04-27 | 中国农业大学 | One boar full-length genome low-density SNP chip and preparation method thereof and application |
Non-Patent Citations (4)
| Title |
|---|
| "Molecular characterization of thyroid peroxidase gene in porcine(sus scrofa)";Ying Wang等;《JOURNAL OF Genetics and Genomics》;20100630;第37卷(第6期);第381-388页 * |
| "rs326578619";dbSNP;《Ensembl》;20180430;第1-2页 * |
| "猪3号染色体上与产仔性状和窝内仔猪初生重整齐度显著关联的标记鉴定";王围围等;《中国畜牧兽医》;20201116;第47卷(第11期);第3546-3554页 * |
| "猪繁殖性状全基因组关联分析及拷贝数变异检测";王源;《中国博士学位论文全文数据库 农业科技辑》;20190115(第12期);D050-75 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108660222A (en) | 2018-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9856531B2 (en) | Methods and compositions for genetically detecting improved milk production traits in cattle | |
| CN103757003A (en) | Litter size related SNP (Single Nucleotide Polymorphism) locus of swine 13# chromosome and primers thereof | |
| CN110541038A (en) | SNP molecular marker located on pig No.1 chromosome and related to daily gain of pig and application | |
| CN108866206B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN113564264A (en) | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirths and litter size of sow and application thereof | |
| CN110079613B (en) | Molecular marker of heat stress tolerance of Holstein cattle and detection method | |
| Terman et al. | The effect of a SNP in ESR gene on the reproductive performance traits in Polish sows | |
| CN108660222B (en) | KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof | |
| CN116590433A (en) | Molecular marker, primer, kit, identification method and application of reproductive performance of large white sow | |
| CN112011623B (en) | Molecular marker related to sow live litter size and effective live litter size traits | |
| CN115011704A (en) | SNP molecular marker influencing litter interval traits and application thereof | |
| CN113736889B (en) | SNP molecular marker related to pig stillbirth number and live litter rate on chromosome 7 and application thereof | |
| CN108796093B (en) | Molecular marker associated with characters of number born alive piglets and number born alive piglets at 5 days of age and application of molecular marker | |
| CN114717329A (en) | SNP molecular marker related to sow stillbirth traits and application thereof | |
| CN113736890A (en) | SNP molecular marker related to Jian' er number and survival rate and application thereof | |
| CN103757005A (en) | Litter size related molecular marker of swine 11# chromosome and primers thereof | |
| CN113637768A (en) | SNP molecular marker on pig No. 13 chromosome related to number of malformed piglets born by sow and application thereof | |
| CN112280874A (en) | Copy number variation molecular marker influencing pig backfat thickness on pig chromosome 11 and application | |
| CN111139305A (en) | Molecular marker related to total litter size trait of pigs and combined application thereof | |
| CN111808974B (en) | SNP molecular marker located on pig chromosome 9 and related to scrotal hernia and application | |
| CN103757011A (en) | Litter size related molecular marker of swine 5# chromosome and primers thereof | |
| Trakovická et al. | Impact of SNPs in candidate genes on economically important traits in Pinzgau cattle | |
| CN112251517B (en) | Genetic marker using DIS3L2 gene as litter size of growing binary sow as well as detection method and application thereof | |
| CN114525350B (en) | SNP (Single nucleotide polymorphism) marker related to Hu sheep melatonin character and application thereof | |
| CN112266968B (en) | Copy number variation molecular marker influencing weight age in days and daily gain on pig chromosome 13 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |