CN108660222A - KPNA7 genetic fragments are as the relevant molecular labeling of pig reproductive trait and application - Google Patents
KPNA7 genetic fragments are as the relevant molecular labeling of pig reproductive trait and application Download PDFInfo
- Publication number
- CN108660222A CN108660222A CN201810673123.XA CN201810673123A CN108660222A CN 108660222 A CN108660222 A CN 108660222A CN 201810673123 A CN201810673123 A CN 201810673123A CN 108660222 A CN108660222 A CN 108660222A
- Authority
- CN
- China
- Prior art keywords
- kpna7
- pig
- molecular labeling
- sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the molecular marker screening technical fields of pig, and in particular to KPNA7 genetic fragments are as the relevant molecular labeling of pig reproductive trait and application.The molecular labeling and pig reproductive trait such as number born alive, young number effectively living, the piglet birth weight uniformity, mummy number trait associations.The molecular labeling is to clone to obtain from the gene KPNA7 for influencing porcine oocytes development, the nucleotide sequence such as SEQ ID NO of the molecular labeling：Shown in 1, there are a C/T to be mutated at the 47bp of the sequence, which leads to Hpy166II RFLP polymorphisms.The invention also discloses application of the molecular labeling in pig reproductive trait especially number born alive, young number effectively living, the piglet birth weight uniformity and mummy number trait associations.
Description
Technical field
The invention belongs to the molecular marker screening technical fields of pig, and in particular to KPNA7 genes are as pig reproductive trait phase
The molecular labeling of pass and application, the pig reproductive trait include pig number born alive (NBA), young number (ENBA) effectively living, piglet
The characters such as the birth weight uniformity (CV), mummy number (Mummy).The molecular labeling is cloned from pig KPNA7 genes
It arrives, it includes the detection and its application in mutational site in the 6th exon sequence of pig KPNA7 genes.
Background technology
In pig breeding industry, number born alive, young number effectively living etc. are important economic characters, these characters belong to low genetic force
Character (Schneider et al 2012), carrying out improvement to these reproductive traits using traditional breeding method means, time-consuming, process
Slowly.In modern breeding work, molecular breeding becomes the new way of effectively improvement reproductive trait, therefore pig reproductive trait is related
Controlling gene or identifying for label can be to improve pig reproductive trait with molecular breeding technology to lay the foundation.
Domestic and international researcher finds that the high Farrowing Traits of Chinese Taihu Lake basin pig kind are related to its high ovulability, ovulation
Number is to determine that the first element of litter size (is opened and shines 1991；Tergui et al 1992).Afterwards again studies have found that corpus luteum number and day
The white pig in Tianjin, Landrace gestation be positively correlated between embryo number, litter size within 30 days (Zhou Shuanhai etc. 2001).Foxcroft etc.
(2006) number of eggs ovulated is thought mostly in addition to litter size can be improved, and can also may bring negative results because of uterine receptivity anxiety,
It such as reduces fetus survival rate, influence fetal weight and carcass quality.Therefore, the developing of porcine oocytes, maturation may influence
Number of eggs ovulated, to influence the related reproductive trait such as litter size.
Guo etc. (2016) has found that the 6th introne and the 8th of KPNA7 genes includes using whole-genome association means
Son, which is located at, lives with litter size of pig, 5 days in the relevant regions QTL of young number character.KPNA7 genes belong to importin family
(Kayopherin), transhipment of the macromolecular substances inside and outside nucleus is mainly mediated, gene expression, cell division, cell are participated in
The important biomolecule process (Fan Jing and Zhu Yun pines 2003) such as apoptosis, cell polarity foundation.Research finds KPNA7 in bovine oocyte
Middle expression knocks out KPNA7 genes, causes early embryonic development abnormal (Tejomurtula et al 2009).In mouse,
KPNA7 genes are expressed in oocyte of mouse, after being mutated the gene, find the part embryonic death after 8.5 days pregnant, mouse
Reproductive capacity reduces (Hu et al 2010).Recently studies have found that KPNA7 genes pig II egg mother cell of GV, M, 2-cell
It is expressed in embryo and 4-cell embryos, porcine oocytes maturation and embryo's early stage division (Xin Wang et al may be regulated and controled
2012).In view of the above result of study, applicant thinks that KPNA7 genes may be in porcine oocytes development, ripe and body early embryo
It plays a significant role in growth course, to influence the reproductive trait of sow.To the polymorphic site of gene mutation in group
It is to study a powerful approach of gene function to be associated analysis, so applicant has carried out polymorphism pass to KPNA7 genes
Connection analysis, to provide new molecular labeling for the reproductive trait of pig.
Invention content
The defect for aiming to overcome that the prior art of invention is related using KPNA7 genetic fragments as pig reproductive trait
Molecular labeling and application.The reproductive trait of pig of the present invention includes mainly number born alive (NBA), young number effectively living
(ENBA), the characters such as the piglet birth weight uniformity (CV) and mummy number (Mummy).The molecular labeling of the present invention is from KPNA7
It clones and obtains in the 6th exon of gene, be sow number born alive, effective by establishing the pleiomorphism detecting method in mutational site
The characters detections such as son's number, the piglet birth weight uniformity and mummy number living provide connective marker.
Technical scheme is as follows：
Applicant screen to obtain it is a kind of with pig reproductive trait especially with number born alive, young number effectively living, piglet birth weight
The uniformity and the relevant molecular labeling of mummy number character, the nucleotide sequence of the molecular labeling are as follows：
TTGTTGCCTAGCTCGGTGAGCTCATTTAAAGACACTCACTGGTACAY(C/T)
TTGAGGAAGCCAGGGCCAGCAGATGTGGGATGGCATTGCTGGAGATAACGATGTCTCTGAATTCTGCGCCATCACCT
ACAAATAGGGGAGAACATGACACTCAAAGAGGGAACACAGGGAACCCGGGGTGGGTGACGAATTCTT,
47 Y are C or T in above-mentioned sequence, which leads to Hpy166II-RFLP polymorphisms.
Applicant devises a kind of primer pair of the above-mentioned molecular labeling of detection, the DNA sequence dna of the primer pair of the molecular labeling
As follows：
Forward primer：TTGTTGCCTAGCTCGGTGAG,
Reverse primer：AAGAATTCGTCACCCACCCC.
It applicant provides a kind of especially equal with number born alive, young number effectively living, piglet birth weight with pig reproductive trait
The screening technique and PCR- of evenness and the relevant molecular labeling of mummy number character (i.e. KPNA7 gene extrons 6)
Associations of the Hpy166II-RFLP in pig number born alive, in young number effectively living, the piglet birth weight uniformity, mummy number character
Application process is analyzed, the method is as follows described：
(1) by Ensemble (see：http://www.ensembl.org/Sus_scrofa/Gene/Summary)
It is consulted in database, applicant finds a candidate SNP in the 6th exon of KPNA7 genes, and (number is
rs326578619,Sscrofa10.2)；
(2) according to genome sequence (the Gene Bank of pig KPNA7 genes in ncbi database (Sscrofa10.2)
Accession:NC_010445.4) design primer clones mutational site, and wherein forward primer is：5’-
TTGTTGCCTAGCTCGGTGAG-3 ', reverse primer are：5’-AAGAATTCGTCACCCACCCC-3’(SEQ ID
NO:2 and SEQ ID NO:3) genomic DNA, is then extracted from Large White sow ear tissue sample as template, clone obtains
KPNA7 Gene Partial DNA sequence dnas, sequence (length 191bp, sequence table SEQ ID NO as follows：1 sequence is as follows, but
47th sequence is the sequence replaced after being mutated)：
TTGTTGCCTAGCTCGGTGAGCTCATTTAAAGACACTCACTGGTACAYTTGAGGAAGCCAGGGCCAGCAGATGTGGGA
TGGCATTGCTGGAGATAACGATGTCTCTGAATTCTGCGCCATCACCTACAAATAGGGGAGAACATGACACTCAAAGA
GGGAACACAGGGAACCCGGGGTGGGTGACGAATTCTT,
Y in above-mentioned sequence is T or C, which leads to Hpy166II-RFLP polymorphisms；
Wherein：1-20 sequences are to expand the forward primer of the segment in above-mentioned sequence, and 172-191 bit sequences are amplifications
(above-mentioned primer sequence is also the primer for the molecular labeling polymorphism that the detection present invention screens simultaneously to the reverse primer sequences of the segment
Sequence)；
(3) the 47th bit base of above-mentioned sequence is detected using PCR-RFLP methods：
Wherein, SNP detection method is：In the obtained 191bp segments of amplification, there are a Hpy166II restriction enzyme site,
PCR product is detected through digestion rear electrophoresis, and sequencing assay result is shown in the sites C/T of KPNA7 genes, and there are 3 kinds of genotype
(as shown in Figure 3)：I.e.：CC (44bp, 147bp) genotype, CT genotype (191bp, 147bp, 44bp), TT genotype
(191bp).Restriction enzyme digestion and electrophoresis result confirms that the mutational site exists in the 6th exon of KPNA7 genes.
(4) application of the mutational site (rs326578619) in sow reproductive trait is still not clear, therefore, the present invention
Loci gene type and sow reproductive trait are associated analysis.
The molecular labeling of the present invention can be equal in pig reproductive trait especially number born alive, young number effectively living, piglet birth weight
It is applied in evenness and mummy number character marker assisted selection.
The primer pair of the present invention can be uniform in pig reproductive trait especially number born alive, young number effectively living, piglet birth weight
It is applied in degree and mummy number character marker assisted selection.
More detailed technical solution and effect are such as《Specific implementation mode》It is shown.
Description of the drawings
Sequence table SEQ ID NO:1 is the nucleotide sequence of molecular labeling that the present invention screens, sequence length 191bp,
There are the pattern of an allele (C or T mutation) at the 47bp of the sequence, which causes Hpy166II-RFLP more
State property.
Sequence table SEQ ID NO:2 be detection molecules label (and forward primer sequence of amplification KPNA7 genetic fragments)
Forward primer sequence.
Sequence table SEQ ID NO3 are detection molecules label (and reverse primer sequences of amplification KPNA7 genetic fragments)
Reverse primer sequences.
Fig. 1：The technology of the present invention flow chart.
Fig. 2：(underscore partial sequence is primer sequence to the nucleotide sequence for the molecular labeling that the present invention screens, Sino-British
Word mother Y represents mutational site, which is located at the 47th base).
Fig. 3：In the present invention KPNA7 genes Hpy166II-RFLP there are three kinds of genotype (i.e.：CC CT TT) electrophoresis knot
Fruit.Reference sign：M in Fig. 3：DNA molecular amount standard (DL2000, purchased from precious bioengineering Dalian Co., Ltd).Swimming lane
1：PCR product, swimming lane 2：CC types, swimming lane 3：CT types, swimming lane 4：TT types
Specific implementation mode
The foundation of embodiment 1PCR-RFLP diagnostic methods
(1) primer sequence：
Forward primer：5 ' TTGTTGCCTAGCTCGGTGAG3 ',
Reverse primer：5’AAGAATTCGTCACCCACCCC3’；
PCR amplification condition：
PCR react total volume be the μ L PCR Mix of 10 μ L, wherein pig genomic DNA about 100ng, 5, above-mentioned forward primer,
Each 0.2 μ L of reverse primer.PCR amplification program is：94 DEG C of 5min recycle 32 94 DEG C of 30s, 60 DEG C of 30s, then 72 DEG C of 25s, most
72 DEG C of extension 5min afterwards.PCR reaction products are detected with 2% agarose gel electrophoresis, obtain 191bp (SEQ ID NO:3) special
Amplified fragments.
(2) PCR-RFLP testing conditions
PCR product endonuclease reaction volume is 10 μ L, wherein 1 × buffer, 1 μ L, 3 μ L of PCR product, restriction enzyme
Hpy166II is 0.5 μ l (1U), uses H2O complements to 10 μ l, will be centrifuged after sample blending, 37 DEG C of water-bath 1h, solidifying with 2% agarose
Gel electrophoresis detects digestion as a result, record genotype, takes pictures in the UV lamp.It is aobvious to the homozygous sequencing result in two, the site
Show, when the positions 47bp are T, then the Hpy166II restriction enzyme sites are not present, and testing result only has 1 after Hpy166II digestions
Segment, length are 191bp (being set to allele T).But when being replaced there are T47 → C47, result leads at 47bp one
The generation of Hpy166II restriction enzyme sites, obtains 2 segments, and length is respectively 44bp and 147bp (being set to allele C), three kinds
Genotype CC, CT, TT are as shown in Figure 3.
Application of the molecular labeling of 2 present invention of embodiment in pig number born alive mark property association analysis
Large White of the experiment swinery from certain southern pig farm used in the present embodiment association analysis, is pellet system Large White sow
530, and genotype detection is carried out to whole sows, determine its genotype.Pellet system Large White number born alive (NBA) character is derived from
The Breeding notes data of pig farm 2016-2017.
According to the Breeding notes information and group structure of collecting sample, the present invention carrys out statistical analysis with general linear model
The genotype effects of KPNA7 gene SNP sites and its relationship with number born alive character.
Character association analysis is carried out to the polymorphism in the mutational site using SAS softwares, concrete model is as follows：
Yilm=μ+genei++mate_seasonl+number_of_littermatem+eilm
Y is character value, and μ is population mean, fixed effect：Genotype effects genei, mating season mate_seasonl；Association
Variable：Sow is brood piglet number number_of_littermatem；eilmFor random error.
Character association analysis, the mutation position are carried out to pellet system Large White KPNA7 gene Hpy166II-RFLP polymorphic sites
Point parting result be：207, pellet system Large White CC types, 151, CT types, 172, TT types.By pellet system large white sow number born alive
Character and genotype make association analysis, it is found that this mutation is significantly associated with (P with pellet system Large White the first-born number born alive<0.05), CT
Type individual and TT type individual number born alives are significantly higher than CC type individuals (P<0.05), CT types sow number born alive and the production of TT type sows
Son's number living is not significantly different.It the results are shown in Table 1.
1 pig KPNA7 gene SNP sites of table and the association analysis result that pellet is Large White the first-born number born alive
Note：Character value is least squares means ± standard error, P in table 1<0.05 represents significant difference.
Application of the molecular labeling of 3 present invention of embodiment in the effective number born alive mark property association analysis of pig
Experiment Large White of the swinery from southern china pig farm used in the present embodiment association analysis, U.S.A is large white sow
There are 262, and genotype detection has been carried out to whole sows, to determine its genotype.Through production (triplet or more), U.S.A is great Bai
The effective number born alive of pig (ENBA) character is derived from the Breeding notes data of pig farm 2016-2017.
According to the Breeding notes information and group structure of collecting sample, the present invention carrys out statistical analysis with general linear model
The genotype effects of KPNA7 gene SNP sites and its relationship with effective number born alive character.
Character analysis is carried out to the polymorphism in the mutational site using SAS softwares, concrete model is as follows：
Yijlm=μ+genei+Parityj+mate_seasonl+number_of_littermatem+eijlm
Y is character value, and μ is population mean, and wherein fixed effect includes：Genotype effects genei, parity effect Prityj、
Mating season mate_seasonl；Covariant：Sow is brood piglet number number_of_littermatem；eijlmFor with chance error
Difference.
Character association analysis is carried out to Large White KPNA7 gene Hpy166II-RFLP polymorphic sites, in American Large White pigs
34, CC types, 90, CT types, 138, TT types.The effective number born alive character of sow is found that this dashes forward with genotype as association analysis
Become and is significantly associated with (P with through producing the effective number born alive of American Large White pigs<0.05), CT types individual and the effective number born alive of TT type individuals
Significantly more than CC types individual (P<0.05), CT types individual and TT type individuals effectively number born alive are not significantly different.It the results are shown in Table
2。
2 pig KPNA7 gene SNP sites of table with through produce the effective number born alive trait associations analysis result of American Large White pigs
Note：Character value is least squares means ± standard error, P in table 2<0.05 represents significant difference.
Application of the molecular labeling of 4 present invention of embodiment in piglet birth weight uniformity mark property association analysis
Experiment Large White of the swinery from southern china pig farm used in the present embodiment association analysis, pellet system large white sow
530, and genotype detection is carried out to whole sows, determine its genotype.The piglet birth weight uniformity (CV) character is derived from pig
The Breeding notes data of field 2016-2017.
According to the Breeding notes information and group structure of collecting sample, the present invention carrys out statistical analysis with general linear model
The genotype effects of KPNA7 gene SNP sites and its relationship with the piglet birth weight uniformity.
Character association analysis is carried out to the polymorphism in the mutational site using SAS softwares, concrete model is as follows：
Yilm=μ+genei+mate_seasonl+number_of_littermatem+eilm
Y is character value, and μ is population mean, and wherein fixed effect includes：Genotype effects genei, mating season mate_
seasonl；Covariant sow is brood piglet number：number_of_littermatem；eilmFor random error.
Character association analysis, the mutational site base are carried out to Large White KPNA7 gene Hpy166II-RFLP polymorphic sites
Because type genotyping result is：Pellet system Large White CC types, 207, CT types, 151, TT types, 172.By the piglet birth weight uniformity
Make association analysis with genotype, it is found that the mutation is extremely significantly associated with the pellet system Large White sow second fetus piglet birth weight uniformity
(P<0.01), wherein the CC types individual piglet birth weight uniformity is significantly better than CT type individuals (P<0.05), at the beginning of CC types individual piglet
Raw weight uniformity pole is significantly better than TT type individuals (P<0.01).It the results are shown in Table 3.
3 pig KPNA7 gene SNP sites of table and the association analysis knot that pellet is the large white sow second fetus piglet birth weight uniformity
Fruit
Note：Character value is least square method ± standard error, P in table 3<0.05 represents significant difference, P<0.01 represents
There is pole significant difference.
Application of the molecular labeling of 5 present invention of embodiment in the analysis of sow mummy number indicia trait associations
Experiment Large White of the swinery from southern china pig farm used in the present embodiment association analysis, pellet system great Bai used
Sow 530, and genotype detection is carried out to the sow of whole Large Whites, determine its genotype.Mummy number character is derived from
The Breeding notes data of pig farm 2016-2017, record Suprapubic arch sling production mummy number (Mummy).
According to the Breeding notes information and group structure of collecting sample, the present invention carrys out statistical analysis with general linear model
The genotype effects of KPNA7 gene SNP sites and its relationship with mummy character.
Character analysis is carried out to the polymorphism in the mutational site using SAS softwares, concrete model is as follows：
Yijlm=μ+genei+parityj+mate_seasonl+number_of_littermatem+eijlm
Y is character value, and μ is population mean, and wherein fixed effect includes：Genotype effects genei, parity effect
parityj, mating season mate_seasonl；Covariant：Sow is brood piglet number number_of_littermatem；eijlmFor
Random error.
Character association analysis is carried out to Large White KPNA7 gene Hpy166II-RFLP polymorphic sites, the results are shown in Table 4.
4 pig KPNA7 gene SNP sites of table produce mummy number association analysis result with through producing pellet system Large White
Note：Character value is least squares means ± standard error, P in table 4<0.05 represents significant difference, P<0.01 generation
Table has pole significant difference.
The mutational site genotyping result is：Pellet system Large White CC types, 207, CT types, 151 and TT types, 172.It will be young
The pig birth weight uniformity makees association analysis with genotype, it is found that the mutation is significantly closed with through producing pellet system Large White production mummy character
Join (P<0.05), wherein CC types individual production mummy number is significantly more than CT type individuals (P<0.05), CC types individual produces mummy
Number pole is significantly more than TT type individuals (P<0.01).
Sequence table
<110>Hua Zhong Agriculture University
<120>KPNA7 genetic fragments are as the relevant molecular labeling of pig reproductive trait and application
<141> 2018-06-25
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 191
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> gene
<222> (1)..(191)
<220>
<221> mutation
<222> (47)..(47)
<400> 1
ttgttgccta gctcggtgag ctcatttaaa gacactcact ggtacatttg aggaagccag 60
ggccagcaga tgtgggatgg cattgctgga gataacgatg tctctgaatt ctgcgccatc 120
acctacaaat aggggagaac atgacactca aagagggaac acagggaacc cggggtgggt 180
gacgaattct t 191
<210> 2
<211> 20
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 2
ttgttgccta gctcggtgag 20
<210> 3
<211> 20
<212> DNA
<213>Pig (Sus scrofa)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 3
aagaattcgt cacccacccc 20
Claims (3)
1. the Hpy166II-RFLP positioned at a kind of molecular labeling of KPNA7 gene extrons 6 lives in sow number born alive, effectively
Application in young number, the piglet birth weight uniformity and the analysis of mummy number trait associations, which is characterized in that the molecule mark
The nucleotide sequence of note such as SEQ ID NO:Described in 1, in SEQ ID NO:There are one the equipotential bases of C or T by 47 of 1 sequence
Because of mutation, which leads to Hpy166II-RFLP polymorphisms.
2. a kind of detection SEQ ID NO:The molecule with Hpy166II-RFLP of the KPNA7 gene extrons 6 of 1 sequence
The primer pair of label, which is characterized in that the DNA sequence dna of the primer pair is as follows：
Forward primer：TTGTTGCCTAGCTCGGTGAG,
Reverse primer：AAGAATTCGTCACCCACCCC.
3. the primer pair described in claim 2 is in sow number born alive, young number, the piglet birth weight uniformity and mummy effectively living
Application in the analysis of number trait associations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810673123.XA CN108660222B (en) | 2018-06-26 | 2018-06-26 | KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810673123.XA CN108660222B (en) | 2018-06-26 | 2018-06-26 | KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108660222A true CN108660222A (en) | 2018-10-16 |
| CN108660222B CN108660222B (en) | 2021-05-11 |
Family
ID=63773165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810673123.XA Active CN108660222B (en) | 2018-06-26 | 2018-06-26 | KPNA7 gene segment as molecular marker related to pig reproduction traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660222B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115044666A (en) * | 2022-06-13 | 2022-09-13 | 天津市农业科学院 | SNP molecular marker for predicting sow second-birth syndrome and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263154A (en) * | 1999-01-25 | 2000-08-16 | 日本化学研究株式会社 | Human tumor suppressor gene |
| CN103421768A (en) * | 2012-07-02 | 2013-12-04 | 华中农业大学 | Molecular marker related to piglet birth weight and use thereof |
| CN107779516A (en) * | 2017-09-12 | 2018-03-09 | 华南农业大学 | A kind of SNP marker for influenceing pig birth weight character and its application |
| CN107967409A (en) * | 2017-11-24 | 2018-04-27 | 中国农业大学 | One boar full-length genome low-density SNP chip and preparation method thereof and application |
| KR20180049486A (en) * | 2016-11-03 | 2018-05-11 | 전북대학교산학협력단 | A breeding pig economic trait prediction using SNP chip and related business model |
-
2018
- 2018-06-26 CN CN201810673123.XA patent/CN108660222B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263154A (en) * | 1999-01-25 | 2000-08-16 | 日本化学研究株式会社 | Human tumor suppressor gene |
| CN103421768A (en) * | 2012-07-02 | 2013-12-04 | 华中农业大学 | Molecular marker related to piglet birth weight and use thereof |
| KR20180049486A (en) * | 2016-11-03 | 2018-05-11 | 전북대학교산학협력단 | A breeding pig economic trait prediction using SNP chip and related business model |
| CN107779516A (en) * | 2017-09-12 | 2018-03-09 | 华南农业大学 | A kind of SNP marker for influenceing pig birth weight character and its application |
| CN107967409A (en) * | 2017-11-24 | 2018-04-27 | 中国农业大学 | One boar full-length genome low-density SNP chip and preparation method thereof and application |
Non-Patent Citations (4)
| Title |
|---|
| DBSNP: ""rs326578619"", 《ENSEMBL》 * |
| YING WANG等: ""Molecular characterization of thyroid peroxidase gene in porcine(sus scrofa)"", 《JOURNAL OF GENETICS AND GENOMICS》 * |
| 王围围等: ""猪3号染色体上与产仔性状和窝内仔猪初生重整齐度显著关联的标记鉴定"", 《中国畜牧兽医》 * |
| 王源: ""猪繁殖性状全基因组关联分析及拷贝数变异检测"", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115044666A (en) * | 2022-06-13 | 2022-09-13 | 天津市农业科学院 | SNP molecular marker for predicting sow second-birth syndrome and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108660222B (en) | 2021-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504752A (en) | A kind of and the associated molecular labeling of sow reproductive trait and application | |
| CN107022604B (en) | Pig NTF3 promoter region SNP as boar breeding character molecular marker and application | |
| CN110004236A (en) | SNP marker relevant to the more lamb characters of sheep and its detection ESR1 genotyping primer group, kit and application | |
| CN110484636B (en) | Molecular marker related to pig total papilla number characters and application thereof | |
| CN103757003A (en) | Litter size related SNP (Single Nucleotide Polymorphism) locus of swine 13# chromosome and primers thereof | |
| CN107475412A (en) | A kind of molecular labeling related to chicken egg-laying deseription and its application in chicken breeding | |
| CN107828894B (en) | IGF1R gene fragment as molecular marker of pig immune trait and growth trait and application | |
| CN104946643B (en) | Molecular labeling, detection method and its application of the NR5A2 gene promoter areas of one influence Sheep Reproductive Characters | |
| Pang et al. | Genetic effect and combined genotype effect of ESR, FSH β, CTNNAL1 and miR-27a loci on litter size in a large White population | |
| CN110468212B (en) | SNP (single nucleotide polymorphism) site related to content of fatty acid C14:0 on chromosome 19 of meat Simmental cattle and application | |
| CN106755371B (en) | Method for detecting sheep PCNP gene single nucleotide polymorphism by PCR-RFLP and application thereof | |
| CN113564264B (en) | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirth and litter size of sow and application thereof | |
| CN107022544B (en) | Pig ESR1 gene as molecular marker related to immune traits and application thereof | |
| CN108866206B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN113637768A (en) | SNP molecular marker on pig No. 13 chromosome related to number of malformed piglets born by sow and application thereof | |
| CN108660222A (en) | KPNA7 genetic fragments are as the relevant molecular labeling of pig reproductive trait and application | |
| CN110079613B (en) | Molecular marker of heat stress tolerance of Holstein cattle and detection method | |
| CN112011623B (en) | Molecular marker related to sow live litter size and effective live litter size traits | |
| CN114250307B (en) | Molecular marker for evaluating age of pigs reaching 100kg body weight and application thereof | |
| CN111139305B (en) | Molecular marker related to total litter size trait of pigs and combined application thereof | |
| CN110760593B (en) | SNP (single nucleotide polymorphism) site related to spleen weight on chromosome 6 of meat Simmental cattle and application | |
| CN108796093B (en) | Molecular marker associated with characters of number born alive piglets and number born alive piglets at 5 days of age and application of molecular marker | |
| CN103757009A (en) | Litter size related molecular marker of swine 13# chromosome and primers thereof | |
| CN103757005A (en) | Litter size related molecular marker of swine 11# chromosome and primers thereof | |
| CN113736890A (en) | SNP molecular marker related to Jian' er number and survival rate and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |