CN108660157B - DNA vector-based in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus - Google Patents
DNA vector-based in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus Download PDFInfo
- Publication number
- CN108660157B CN108660157B CN201810535576.6A CN201810535576A CN108660157B CN 108660157 B CN108660157 B CN 108660157B CN 201810535576 A CN201810535576 A CN 201810535576A CN 108660157 B CN108660157 B CN 108660157B
- Authority
- CN
- China
- Prior art keywords
- seq
- carrying
- sac
- bombyx mori
- enzyme digestion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12051—Methods of production or purification of viral material
- C12N2720/12052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/103—Plasmid DNA for invertebrates
- C12N2800/105—Plasmid DNA for invertebrates for insects
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus based on a DNA vector. Specifically, the method of the present invention comprises the steps of: 1) obtaining the genome of the bombyx mori cytoplasmic polyhedrosis virus; 2) designing and synthesizing primers; 3) obtaining cDNA of virus genome fragments S1-S10; 4) carrying out PCR amplification on the cDNA; 5) carrying out enzyme digestion on the amplified product, and then cloning the product into a plasmid vector to obtain a recombinant plasmid; 6) carrying out enzyme digestion and linearization on the recombinant plasmid; and 7) equimolar mixing the linearized plasmids, wrapping the mixture by using liposome, and transfecting host cells expressing T7RNA polymerase to obtain the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro. The in vitro construction method of the bombyx mori cytoplasmic polyhedrosis virus based on the DNA vector not only has a promoting effect on the function research of each segment of the bombyx mori cytoplasmic polyhedrosis virus genome, provides a new method for obtaining the bombyx mori cytoplasmic polyhedrosis virus in vitro, but also can provide theoretical guidance and technical support for the research and development of constructing recombinant cytoplasmic polyhedrosis virus biological insecticides.
Description
Technical Field
The invention belongs to the field of virus genetic engineering, and particularly relates to an in-vitro construction method of bombyx mori cytoplasmic polyhedrosis virus based on a DNA vector.
Background
Reoviridae (Reoviridae) viruses are a class of double-stranded rna (dsrna) viruses that infect a variety of hosts, including animals, plants, and fungi. Cytoplasmic polyhedrosis virus (abbreviated as cytomegalovirus)CPVs) belong in the reoviridae family genus of polyhedrosis virus (cyprovirus) in classification, the genome of which usually consists of 9 to 11 dsRNA segments of different molecular weights. CPVs infect plants belonging to the order Lepidoptera: (Lepidoptera) From the order of hymenoptera (Hymenoptera) And Coleoptera (Coleoptera) The agricultural and forestry pests are a biological pesticide with great development potential. However, due to technical bottlenecks, no recombinant polyhedrosis virus insecticide has been obtained by gene recombination.
CPVs can be divided into 20 different types according to the difference of migration patterns when CPVs genome is subjected to dsRNA electrophoresis. Bombyx mori cytoplasmic polyhedrosis virus (Bombyx moricytoplasmic polyhedrosis virus, BmCPV) is a typical species in CPV1 type, and can specifically infect columnar cells in the midgut of silkworms, so that the silkworms generate cytoplasmic polyhedrosis (also called midgut type pyosis), and further the silkworms are failed to breed. The genome of bombyx mori cytoplasmic polyhedrosis virus consists of 10 dsRNA fragments in total from S1 to S10, and the sequence of each fragment is clear.
In general, the method for obtaining a polyhedrosis virus is to extract it from a naturally occurring host infected with the polyhedrosis virus or an artificially infected host or cultured cells suffering from the polyhedrosis virus, but this method must utilize a natural host or sensitive cells of the polyhedrosis virus. In addition, the genome of the polyhedrosis virus is a segmented double-stranded RNA virus, and the genome is difficult to modify by using a conventional genetic manipulation technology so as to obtain a recombinant virus, so that the functional research of each segment of the CPVs genome is slow, and a recombinant CPVs pesticide cannot be obtained. The prior art discloses an in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus, which is basically characterized in that RNA of S1-S10 fragments obtained by in vitro transcription is transfected into bombyx mori cells, and the virus can be obtained after the cells are diseased; the main technical characteristic is that the coding sequence of the red fluorescent protein gene is used for replacing the open reading frame of the polyhedrin gene in the S10 fragment, and then the existing in vitro construction method of the silkworm cytoplasmic polyhedrin virus is utilized to obtain the recombinant silkworm cytoplasmic polyhedrin virus expressing the red fluorescent protein.
In the prior art, an in vitro transcription technology is required, and due to technical bottlenecks, complete RNA molecules with longer sequences are sometimes difficult to obtain by in vitro transcription, and the RNA molecules are easy to degrade, so that the virus obtaining efficiency is influenced. For some viruses, the viral RNA obtained by in vitro transcription through cell transfection cannot save the virus in vitro. Therefore, the development of the in vitro construction method of the novel bombyx mori cytoplasmic polyhedrosis virus not only can provide a new method for obtaining the bombyx mori cytoplasmic polyhedrosis virus in vitro, but also can provide theoretical guidance and technical support for the research and development of the construction of the recombinant CPVs biological insecticide.
Disclosure of Invention
In view of the above circumstances, the present invention aims to provide a method for constructing a silkworm cytoplasmic polyhedrosis virus based on a DNA vector, which omits an in vitro transcription step compared with the prior art, efficiently and successfully constructs the silkworm cytoplasmic polyhedrosis virus, and achieves unexpected technical effects.
In order to achieve the above object, the technical solution adopted by the present invention is as follows:
an in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus based on DNA carrier, which comprises the following steps:
(1) obtaining the genome of the bombyx mori cytoplasmic polyhedrosis virus;
(2) based on the terminal sequences of double-stranded RNAs of fragments S1, S2, S3, S4, S5, S6, S7, S8, S9 and S10 of the genome of Bombyx mori cytoplasmic polyhedrosis virus, 10 pairs of primers are designed and synthesized: PS1F/PS1R, PS2F/PS2R, PS3F/PS3R, PS4F/PS4R, PS5F/PS5R, PS6F/PS6R, PS7F/PS7R, PS8F/PS8R, PS9F/PS9R and PS10F/PS10R, wherein the numbering of the primers is as follows:
primer PS1F corresponds to SEQ ID NO. 1, primer PS1R corresponds to SEQ ID NO. 2,
primer PS2F corresponds to SEQ ID NO. 3, primer PS2R corresponds to SEQ ID NO. 4,
primer PS3F corresponds to SEQ ID NO. 5, primer PS3R corresponds to SEQ ID NO. 6,
primer PS4F corresponds to SEQ ID NO. 7, primer PS4R corresponds to SEQ ID NO. 8,
primer PS5F corresponds to SEQ ID NO 9, primer PS5R corresponds to SEQ ID NO 10,
primer PS6F corresponds to SEQ ID NO. 11, primer PS6R corresponds to SEQ ID NO. 12,
primer PS7F corresponds to SEQ ID NO 13, primer PS7R corresponds to SEQ ID NO 14,
primer PS8F corresponds to SEQ ID NO. 15, primer PS8R corresponds to SEQ ID NO. 16,
primer PS9F corresponds to SEQ ID NO:17, primer PS9R corresponds to SEQ ID NO:18,
primer PS10F corresponds to SEQ ID NO:19, primer PS10R corresponds to SEQ ID NO:20,
the sequences of the individual primers are shown below:
| SEQ ID NO:1： | 5'-TTCGAGCTCTAATACGACTCACTATAGCTAAGTAAAGTGTATGTTTATACC-3'； |
| SEQ ID NO:2： | 5'-TATCCGCGGGGCTAACGGTCGTGTATG-3'； |
| SEQ ID NO:3： | 5'-TTCGAGCTCTAATACGACTCACTATAGCTAAGTAAGAGCAGCACTTGTACG-3'； |
| SEQ ID NO:4： | 5'-TATCCGCGGGGCTAACGGTGAACAGCGTA-3'； |
| SEQ ID NO:5： | 5'-TTCGAGCTCTAATACGACTCACTATAGCTAAGTAAAGACACATGACGAGAAACTAATGTAGTAGGAAAAGATGGAAATAAATAGAGCTGA-3'； |
| SEQ ID NO:6： | 5'-TATCCGCGGGGCTAACGGTCGACACATGTTCATGCTCCACGCATGCCAGCATATAGGCTCCTCATCGTGGATGCATAACG-3'； |
| SEQ ID NO:7： | 5'-TTCGGTACCTAATACGACTCACTATAGCTAAGTAATTTCCACCATGTGGC-3'； |
| SEQ ID NO:8： | 5'-TATCCGCGGGGCTAACGTTTCCCACCGC-3'； |
| SEQ ID NO:9： | 5'-TCGAATTTAAAGCTTGGTACCTAATACGACTCACTATAGCTAAGTAATTTCCCCTTACC-3'； |
| SEQ ID NO:10： | 5'-ATAGGCTTACCTTCGAACCGCGGCTAACCATCTCCCCGTG-3'； |
| SEQ ID NO:11： | 5'-TTCGGTACCTAATACGACTCACTATAGCTAAGTAAGATTCCGTAATATCC-3'； |
| SEQ ID NO:12： | 5'-TATCCGCGGGGCTAACGTTGACTCCGC-3'； |
| SEQ ID NO:13： | 5'-TTCGGTACCTAATACGACTCACTATAGCTAAGTAATTTGGTCATAACAGC-3'； |
| SEQ ID NO:14： | 5'-GGCTCTAGAGGCTAACGTTTGGTCACTCCG-3'； |
| SEQ ID NO:15： | 5'-TTCGGTACCTAATACGACTCACTATAGCTAAGTAAAGTCCAGTACTAG-3'； |
| SEQ ID NO:16： | 5'-TATCCGCGGGGCTAACGGTAGTCCGCCGC-3'； |
| SEQ ID NO:17： | 5'-TTCGGTACCTAATACGACTCACTATAGCTAAGTAAATCCCAGGCGTAAACCG-3'； |
| SEQ ID NO:18： | 5'-TATCCGCGGGGCTAACGACCCGAGTGCCC-3'； |
| SEQ ID NO:19： | 5'-TTCGGTACCTAATACGACTCACTATAGCTAAGTAAAAGTCAGTATCTTACCGGC-3'； |
| SEQ ID NO:20： | 5'-TATCCGCGGGGCTAACGGTCAGTCAGTACCGC-3'； |
(3) obtaining cDNA of fragments S1 to S10;
(4) performing PCR amplification by using the cDNAs of the S1 to S10 fragments obtained in the step (3) as templates and correspondingly using 10 pairs of primers synthesized in the step (2) to obtain amplification products of the full-length cDNAs of the S1 to S10 fragments;
(5) subjecting the amplification products of the full-length cDNA of the S1-S10 fragments obtained in step (4) to enzyme digestion with restriction enzymes respectively, and then cloning into plasmid vectors to obtain recombinant plasmids pT-S1, pT-S2, pT-S3, pT-S4, pT-S5, pT-S6, pT-S7, pT-S8, pT-S9 and pT-S10 respectively carrying the full-length cDNA of the S1-S10 fragments, wherein the restriction enzymes are used as follows:
amplification product of full-Length cDNA of fragment S1SacI andSacII carrying out the enzymeCutting;
amplification product of full-Length cDNA of fragment S2SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S3SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S4kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S5kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S6kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S7kpnI andXbai, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S8kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S9kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S10kpnI andSacII, carrying out enzyme digestion;
(6) performing enzyme digestion on the pT-S1-pT-S10 recombinant plasmids obtained in the step (5) by using restriction enzymes respectively to obtain linearized plasmids of pT-S1-pT-S10, wherein the restriction enzymes are used as follows:
recombinant plasmid pT-S1 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S2 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S3 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S4 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S5 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S6 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S7 for useXbaI, carrying out enzyme digestion;
recombinant plasmid pT-S8 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S9 for useSacII, carrying out enzyme digestion;
recombinationFor plasmid pT-S10SacII, carrying out enzyme digestion;
(7) equimolar mixing the pT-S1-pT-S10 linearized plasmids obtained in step (6), wrapping and transfecting host cells expressing T7RNA polymerase by using liposome, collecting and crushing the cells when formation of polyhedra in cytoplasm is observed, and carrying out centrifugal purification to obtain the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro.
Preferably, in the above technical solution, the obtaining of the bombyx mori cytoplasmic polyhedrosis virus genome in step (1) can be achieved by a method of laboratory extraction or commercial purchase. In the case of extraction in the laboratory, the viral genome may be extracted from bombyx mori cytoplasmic polyhedrosis virus particles, or the viral genome may be extracted from bombyx mori cytoplasmic polyhedrosis, preferably the viral genome is extracted from bombyx mori cytoplasmic polyhedrosis.
Preferably, in the above technical scheme, 10 upstream primers PS1F to PS10F in the primers in step (2) have the following characteristics: the 5' end is sequentially provided with restriction enzyme cutting sites of restriction enzymes shown by underlining lines and a T7 promoter sequence shown in bold italics; the 10 downstream primers PS 1R-PS 10R in the primers have the following characteristics: the 5' -end carries restriction sites for restriction enzymes which are underlined.
Preferably, in the above embodiment, the cDNA of the fragment S1 to S10 obtained in step (3) can be obtained by a method based on total artificial synthesis of RNA sequences or reverse transcription.
Preferably, in the above embodiment, in the case of reverse transcription, the genome of bombyx mori cytoplasmic polyhedrosis virus obtained in step (1) is boiled at 100 ℃ for 10 minutes, and then ice-cooled for 2 minutes, and then reverse transcription is performed using primers PS1R, PS2R, PS3R, PS4R, PS5R, PS6R, PS7R, PS8R, PS9R, and PS10R synthesized in step (2), respectively, as templates, to obtain cDNA of fragments S1 to S10.
Preferably, in the above technical solution, in the case of reverse transcription, the genome of bombyx mori cytoplasmic polyhedrosis virus obtained in step (1) may be separated by agarose gel electrophoresis and the double-stranded RNA fragments S1 to S10 recovered from the agarose gel, and then boiled for 10 minutes and ice-cooled for 2 minutes, and then used as a template for future use.
Preferably, in the above technical scheme, the plasmid vector in step (5) may be pIZT-V5/His vector (Invitrogen), pUC series vector (TAKATA) or pBluescript SK II vector (Novagen), preferably pIZT-V5/His vector.
In the technical scheme, the host cell for transfecting in the step 7) and expressing the T7RNA polymerase is a host culture cell which is transfected with a recombinant vector pIZT-V5/His-T7RNApol containing a T7RNA polymerase gene expression cassette in advance. Preferably, the recombinant vector pIZT-V5/His-T7RNApol transfects silkworm BmN cultured cells, and then the transformed cells expressing T7RNA polymerase are obtained by continuous screening of Zeocin antibiotics.
Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:
1. the conventional method for obtaining the silkworm cytoplasmic polyhedrosis virus is to purify the naturally occurring silkworm cytoplasmic polyhedrosis virus midgut or artificially infected silkworm midgut suffering from the cytoplasmic polyhedrosis virus and cultured cells, but the method needs to utilize the silkworm as a host or the cultured cells, and the method can be obtained by transfecting the cultured cells with plasmids containing the full-length cDNA of each genome segment of the virus;
2. in the prior art, the RNA of the S1-S10 fragment obtained by in vitro transcription is used for transfecting silkworm cells, the method needs to obtain the full-length complete RNA molecule of the virus by in vitro transcription, and in addition, the RNA molecule is easy to degrade, so the method reduces the efficiency of obtaining the virus; the present invention omits the step of in vitro transcription, and obtains virus by transcribing viral RNA in cells using plasmids containing full-length cDNA of each genomic fragment of virus transfected by cells expressing T7RNA polymerase.
3. The conventional method is difficult to transform the genome of the bombyx mori cytoplasmic polyhedrosis virus through genetic manipulation so as to obtain the recombinant virus, and the method disclosed by the invention can realize the change of the genome of the bombyx mori cytoplasmic polyhedrosis virus through in vitro genetic manipulation so as to obtain the recombinant virus required by people.
Drawings
FIG. 1 is a diagram of linearized plasmid electrophoretograms of pT-S1-pT-S10 in example I; lane M is the DNA standard molecular weight, lanes 1 to 10 are linearized pT-S1 to pT-S10, respectively;
FIG. 2 shows the transfection of silkworm culture cells with linearized plasmids pT-S1-pT-S10 in example I; arrows indicate cells forming polyhedra;
FIG. 3 is a Western blotting identification electrophoresis chart of the first embodiment, in which a lane M represents a standard molecular weight protein, and a lane 1 represents cultivated silkworm cells infected with a bombyx mori cytoplasmic polyhedrosis virus constructed in vitro;
FIG. 4 is a graph showing the growth of cultivated cells of in vitro-constructed Bombyx mori cytoplasmic polyhedrosis virus according to example I;
FIG. 5 is a diagram showing the electrophoretic separation of the genomes of Bombyx mori cytoplasmic polyhedrosis virus in example III; from bottom to top, the nucleic acid bands are respectively fragments S1 to S10.
Detailed Description
The invention will be further described with reference to the accompanying drawings and specific embodiments.
The first embodiment is as follows: in vitro construction and characteristic detection of bombyx mori cytoplasmic polyhedrosis virus
1. In vitro construction of the virus:
(1) extracting the bombyx mori cytoplasmic polyhedrosis virus genome:
collecting the midgut tissue of the silkworm with cytoplasmic polyhedrosis disease according to the ratio of 1g midgut tissue: adding double distilled water (UPT-III-5T ultra pure water machine, made by Software super pure science and technology Limited company, made by self) in a proportion of 10mL, homogenizing, filtering with gauze, and centrifuging the filtrate with a CF15D2 type centrifuge (KuBoTa company, Japan) at a differential speed to obtain pure bombyx mori cytoplasmic polyhedra; suspending purified Bombyx mori cytoplasmic polyhedrosis in water, and adjusting concentration to at least 10 per mL water8A plurality of polygons; adding equal volume of Tris-equilibrium phenol (Beijing Solebao science and technology Co., Ltd.) into 0.5mL of polyhedron suspension, shaking and mixing for 5min in a QL-901 type oscillator (Qin Beier apparatus manufacturing Co., Haimen) at 12000rpmCentrifuging at 4 deg.C for 10 min; taking the supernatant, adding equal volume of Tris equilibrium phenol, shaking and mixing uniformly for 5min, and centrifuging at the rotating speed of 12000rpm and 4 ℃ for 10 min; collecting supernatant, adding equal volume of chloroform (Jiangsu Qiangsheng functional chemistry Co., Ltd.), shaking and mixing for 5min, and centrifuging at 4 deg.C at 12000rpm for 10 min; taking the supernatant, adding 1/10 volume of 3mol/L sodium acetate aqueous solution (self-made, Shanghai national drug group chemical reagent Co., Ltd.) and 2.5 volume times of-20 ℃ precooled 99% ethanol (Jiangsu Qiangsheng functional chemical Co., Ltd.), shaking, mixing uniformly, placing at-20 ℃ for 30min, centrifuging at 4 ℃ for 10min at 12000rpm, discarding the supernatant, washing the precipitate with 75% ethanol (Jiangsu Qiangsheng functional chemical Co., Ltd.), dissolving with 50 μ L double distilled water to obtain the silkworm cytoplasmic polyhedrosis virus genome, and freezing at-20 ℃ for standby.
(2) Design and synthesis of primers:
the following primers were designed and synthesized based on the terminal sequences of double-stranded RNA of the Bombyx mori cytoplasmic polyhedrosis virus genomes S1, S2, S3, S4, S5, S6, S7, S8, S9, and S10 fragments (accession numbers GU323605, GQ924586, GQ924587, GU323606, GQ294468, GQ294469, GQ150538, GQ 53915088, GQ924588, and GQ 459289, respectively, in GenBank):
PS1F（SEQ ID NO:1）：TTCGAGCTC TAATACGACTCACTATAGCTAAGTAAAGTGTATGTTTATACC, underlinedSacI, enzyme cutting site, wherein italics represents T7 promoter sequence;
PS1R（SEQ ID NO:2）：TATCCGCGGGGCTAACGGTCGTGTATG, underlinedSacII, enzyme cutting sites;
PS2F（SEQ ID NO:3）： TTCGAGCTC TAATACGACTCACTATAGCTAAGTAAGAGCAGCACTTGTACG, underlinedSacI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS2R（SEQ ID NO:4）：TATCCGCGGGGCTAACGGTGAACAGCGTA, underlinedSacII, enzyme cutting sites;
PS3F（SEQ ID NO:5）：TTCGAGCTC TAATACGACTCACTATAGCTAAGTAAAGACACATGACGAGAAACTAATGTAGTAGGAAAAGATGGAAATAAATAGAGCTGA, underlineTo representSacI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS3R（SEQ ID NO:6）：TATCCGCGGGGCTAACGGTCGACACATGTTCATGCTCCACGCATGCCAGCATATAGGCTCCTCATCGTGGATGCATAACG, underlinedSacII, enzyme cutting sites;
PS4F（SEQ ID NO:7）：TTCGGTACC TAATACGACTCACTATAGCTAAGTAATTTCCACCATGTGGC, underlinedKpnI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS4R（SEQ ID NO:8）：TATCCGCGGGGCTAACGTTTCCCACCGC, underlinedSacII, enzyme cutting sites;
PS5F（SEQ ID NO:9）：TCGAATTTAAAGCTTGGTACC TAATACGACTCACTATAGCTAAGTAATTTCCCCTTACC, underlinedKpnI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS5R（SEQ ID NO:10）：ATAGGCTTACCTTCGAACCGCGGCTAACCATCTCCCCGTG, underlinedSacII, enzyme cutting sites;
PS6F（SEQ ID NO:11）：TTCGGTACC TAATACGACTCACTATAGCTAAGTAAGATTCCGTAATATCC, underlinedKpnI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS6R（SEQ ID NO:12）：TATCCGCGGGGCTAACGTTGACTCCGC, underlinedSacII, enzyme cutting sites;
PS7F（SEQ ID NO:13）：TTCGGTACC TAATACGACTCACTATAGCTAAGTAATTTGGTCATAACAGC, underlinedKpnI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS7R（SEQ ID NO:14）：GGCTCTAGAGGCTAACGTTTGGTCACTCCG, underlinedXbaI, enzyme digestion site;
PS8F（SEQ ID NO:15）：TTCGGTACC TAATACGACTCACTATAGCTAAGTAAAGTCCAGTACTAG, underlinedKpnI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS8R（SEQ ID NO:16）：TATCCGCGGGGCTAACGGTAGTCCGCCGC, underlinedSacII, enzyme cutting sites;
PS9F（SEQ ID NO:17）：TTCGGTACC TAATACGACTCACTATAGCTAAGTAAATCCCAGGCGTAAACCG, underlinedKpnI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS9R（SEQ ID NO:18）：TATCCGCGGGGCTAACGACCCGAGTGCCC, underlinedSacII, enzyme cutting sites;
PS10F（SEQ ID NO:19）：TTCGGTACC TAATACGACTCACTATAGCTAAGTAAAAGTCAGTATCTTACCGGC, underlinedKpnI, enzyme cutting site, wherein the bold italics represents T7 promoter sequence;
PS10R（SEQ ID NO:20）：TATCCGCGGGGCTAACGGTCAGTCAGTACCGC, underlinedSacII enzyme cutting site.
The above primers were synthesized by Shanghai Bioengineering Co., Ltd.
(3) Reverse transcription gave cDNA of fragments S1 to S10:
20. mu.L of the Bombyx mori cytoplasmic polyhedrosis virus genome obtained in step (1) was boiled at 100 ℃ for 10min, then ice-cooled for 2min, and 1. mu.L of the Bombyx mori cytoplasmic polyhedrosis virus genome obtained in step (1) was subjected to Reverse transcription using primers PS1R, PS2R, PS3R, PS4R, PS5R, PS6R, PS7R, PS8R, PS9R, and PS10R obtained in step (2) according to the product instructions using a Reverse transcription kit (Transcriptor Reverse Transcriptase Transcriptase, Roche, Switzerland Co.) to obtain cDNA of fragments S1 to S10. The reverse transcription system is as follows: bombyx mori cytoplasmic polyhedrosis virus genome RNA 1 muL, downstream primer of each fragment 1 mu L, RNase-free H2O11. mu.L, first at 65 ℃ for 10min, then placed on ice for 5min, and then added with 5 × Reaction Buffer 4. mu.L, RT Enzyme 0.5. mu.L, 10 × dNTP 2. mu.L, 30min at 55 ℃ and then 5min at 85 ℃.
(4) PCR amplification of full-length cDNA of fragments S1 to S10:
PCR was performed using 1. mu.L of the cDNA of the S1 to S10 fragments in step (3) as templates, respectively, using the primer pair synthesized in step (2), that is, the cDNA of the S1 fragment was amplified with the primer pair PS1F/PS1R, and so on. The PCR amplification conditions were as follows: pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 50s, annealing at 55 ℃ for 50s, extension at 72 ℃ for 1-5 min, and re-extension at 72 ℃ for 10min, wherein the reaction is carried out for 35 cycles. And (3) detecting the amplification product through agarose gel electrophoresis, and recovering the amplification product by adopting a DNA gel recovery kit according to a product instruction.
(5) Construction of recombinant plasmid:
taking the PCR amplification products obtained in the step (4), and performing enzyme digestion by using restriction enzymes respectively, wherein:
amplification product of full-Length cDNA of fragment S1SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S2SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S3SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S4kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S5kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S6kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S7kpnI andXbai, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S8kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S9kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S10kpnI andSacII, carrying out enzyme digestion.
The amplified products of the full-length cDNA of the fragments S1-S10 are cut by the restriction enzyme in the following way: the full-length cDNA of the fragment is 8 mu L,kpnI Buffer 2μL，kpnI 1μL、SacII orXbaI1 mu L and 8 mu L of sterile water, wherein the enzyme digestion conditions are as follows: 3h at 37 ℃. The above enzyme-digested product is usedkpnI andSacII orkpnI andXbai ligation of the cleaved pIZT-V5/His vector (product of Invitrogen) was carried out, and the ligation product was transformed into E.coli. Taking positive clones, sending to Shanghai Biotechnology engineering Co., Ltd for sequencing verification, and obtaining recombinant plasmids pT-S1, pT-S2, pT-S3, pT-S4, pT-S5 and pT with correct sequences-S6、pT-S7、pT-S8、pT-S9、pT-S10。
(6) And (3) carrying out plasmid digestion linearization:
taking the recombinant plasmids pT-S1 to pT-S10 in the step (5), and carrying out enzyme digestion and linearization by using restriction enzymes, wherein the use conditions of the restriction enzymes are as follows:
recombinant plasmid pT-S1 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S2 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S3 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S4 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S5 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S6 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S7 for useXbaI, carrying out enzyme digestion;
recombinant plasmid pT-S8 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S9 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S10 for useSacII, carrying out enzyme digestion.
After each enzyme digestion product is respectively extracted by Tris equilibrium phenol (Beijing Solebao science and technology Co., Ltd.) and chloroform (Jiangsu Qiangsheng functional chemical Co., Ltd.), the DNA is precipitated by ethanol (Jiangsu Qiangsheng functional chemical Co., Ltd.), the precipitated DNA is dissolved by 20 mu L double distilled water, and the linearization effect of the plasmid is detected by electrophoresis, and the result is shown in figure 1, wherein a lane M is the standard molecular weight of the DNA, and lanes 1 to 10 are respectively linearized pT-S1 to pT-S10. A single band was observed in each lane, indicating good linearization. Thereafter, the concentration of the linearized plasmid DNA was determined with an ultraviolet spectrophotometer (Picoprop, USA, Pico 200).
(7) Construction of cultivated silkworm cell expressing T7RNA polymerase gene
Cloning of the T7RNA polymerase Gene into pIZT-V5/HisKpnI、EcoRI locus to obtain recombinant plasmid pIZT-V5/His-T7RNApol, and transfecting bombyx mori BmN cell and recombinant plasmid via liposomeThe amount of the particles and the liposome was 2. mu.g and 8. mu.L, respectively. Fluorescence observation is carried out 24 hours after cell transfection, and if the cells can be observed to show fluorescence, the transfection is successful. Cells were transfected for 72 hours and then screened with Zeocin antibiotic at a working concentration of 400. mu.g/. mu.L for 2-3 weeks to obtain transformed cells expressing the T7RNA polymerase gene.
(8) Obtaining the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro:
equimolar mixing of pT-S1 to pT-S10 linear plasmid DNA in step (6), wrapping the mixture containing 10. mu.g with 10. mu.L of liposome Lipofectamine 2000 (Invitrogen corporation), transfecting the wrapped mixture into the cultivated silkworm BmN cells obtained in step (7), and culturing at 27 ℃ for 1 week to observe formation of polyhedra in cytoplasm; the image thereof under a microscope is shown in FIG. 2, in which the object indicated by an arrow represents a cell forming Bombyx mori cytoplasmic polyhedrosis virus. Collecting and crushing the cells, centrifuging to take the supernatant, infecting the BmN cells, collecting and crushing the cells after 5 days, and centrifuging to obtain the in vitro constructed bombyx mori cytoplasmic polyhedrosis virus. The recombinant virus obtained by the invention has infection and replication capacity, and the titer of the virus can be improved by reinfection.
2. And (3) detecting the performance of the virus:
the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro is transferred to normal bombyx mori cultured cells, diseased cells are collected and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with the gel concentration of 10%, Western blotting detection (shown in figure 3) is carried out by adopting antiserum with primary antibody BmCPV VP7 and rabbit anti-mouse IgG with secondary antibody labeled with HRP, and virus protein VP7 can be detected, which indicates that the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro has replication expression capability.
The bombyx mori cytoplasmic polyhedrosis virus constructed in vitro is transferred to normal cultivated bombyx mori cells, the cells are collected 12, 24, 48 and 72 hours after virus inoculation, total RNA is extracted and is reversely transcribed into cDNA, the expression level of BmCPV VP1 gene (shown in figure 4) is detected by qPCR (quantitative polymerase chain reaction) through primers Revp1(SEQ ID NO:21) (GGTCTCGACGTGAATACCGA) and Revp2(SEQ ID NO:22) (TCGTCTGCTTCACTAGCACG), and the expression level of VP1 gene is obviously improved along with the extension of inoculation time, which indicates that the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro has replication expression capability.
In the field, it is crucial to be able to recombinantly construct viruses in vitro, and after obtaining recombinant viruses by recombinant construction in vitro, a large number of viruses can be conveniently obtained by amplification in sensitive cells or organisms.
Example two: in vitro construction of Bombyx mori cytoplasmic polyhedrosis virus.
1. Synthesizing cDNA of S1 to S10 by full chemistry according to the RNA sequence of the S1 to S10 fragments;
2. construction of recombinant plasmid:
taking the cDNA which is subjected to the total chemical synthesis from S1 to S10 in the step (1), and respectively cloning the cDNA into pIZT-V5/His vectors, wherein:
cloning the full-length cDNA of the S1 fragment to SacI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S2 fragment to SacI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S3 fragment to SacI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S4 fragment to the KpnI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S5 fragment to the KpnI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S6 fragment to the KpnI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S7 fragment to KpnI and XbaI sites of pIZT-V5/His;
cloning the full-length cDNA of the S8 fragment to the KpnI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S9 fragment to the KpnI and SacII sites of pIZT-V5/His;
cloning the full-length cDNA of the S10 fragment to the KpnI and SacII sites of pIZT-V5/His;
thus, pT-S1 to pT-S10 plasmids were obtained, respectively.
3. Same as step (6) in the in vitro construction of the virus of example one;
4. same procedure as in example (7) for in vitro construction of the virus
5. Equimolar mixing of pT-S1 to pT-S10 linear plasmid DNA in step (4), and taking a mixture containing 10. mu.g, wrapping the mixture with 10. mu.L of liposome Lipofectamine 2000 (Invitrogen corporation) and transfecting the wrapped mixture into the cultivated silkworm BmN cells obtained in step (7) in the in vitro construction of the virus of example I, and after culturing at 27 ℃ for 1 week, formation of polyhedra in cytoplasm was observed; collecting and crushing the cells, centrifuging to take the supernatant, infecting the BmN cells, collecting and crushing the cells after 5 days, and centrifuging to obtain the in vitro constructed bombyx mori cytoplasmic polyhedrosis virus. Further, the virus is spread on the surface of mulberry leaves, silkworm larvae of 3 rd instar are fed for 8 hours, then normal mulberry leaves are fed to the middle and later 5 th instar, the midgut tissue of the diseased silkworm is taken, homogenized and filtered by gauze, and the filtrate is subjected to differential centrifugation by a CF15D2 type centrifuge (KuBoTa company, Japan), so that a large amount of pure silkworm cytoplasmic polyhedra can be obtained.
The bombyx mori cytoplasmic polyhedrosis virus constructed in vitro is transferred to normal cultivated bombyx mori cells, the cells are collected 12, 24, 48 and 72 hours after virus inoculation, total RNA is extracted and is reversely transcribed into cDNA, the expression level of BmCPV VP1 gene is detected by qPCR with primers Revp1(SEQ ID NO:21 GGTCTCGACGTGAATACCGA) and Revp2(SEQ ID NO:22 TCGTCTGCTTCACTAGCACG), and the expression level of VP1 gene is obviously improved along with the extension of inoculation time, which indicates that the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro has the replication expression capability.
Example three: in vitro construction of Bombyx mori cytoplasmic polyhedrosis virus
(1) Same as step (1) in the in vitro construction of the virus of example one;
(2) the genome of Bombyx mori cytoplasmic polyhedrosis virus was separated by 0.75% agarose gel electrophoresis, and the nucleic acid bands from bottom to top were S1 to S10 fragments, respectively, as shown in FIG. 5. Recovering RNA of each fragment by using a nucleic acid gel recovery kit, and using the RNA in double distilled water without RNase-free to respectively obtain RNA of S1-S10;
(3) mu.L of each of the RNAs from S1 to S10 in step (2) was boiled at 100 ℃ for 10min, ice-washed for 2min, and 1. mu.L of each of the RNAs was used as a template, and Reverse transcription was performed using primers PS1R, PS2R, PS3R, PS4R, PS5R, PS6R, PS7R, PS8R, PS9R, and PS10R in step (2) in the in vitro construction of the virus of example I according to the product instructions using a Reverse transcription kit (Transcriptor Reverse Transcriptase Transcriptase, Switzerland Co.) to obtain cDNAs of fragments from S1 to S10.
The remaining steps were the same as in steps (4) to (8) in the in vitro construction of the virus of example one.
The bombyx mori cytoplasmic polyhedrosis virus constructed in vitro is transferred to normal cultivated bombyx mori cells, the cells are collected 12, 24, 48 and 72 hours after virus inoculation, total RNA is extracted and is reversely transcribed into cDNA, the expression level of BmCPV VP1 gene is detected by qPCR with primers Revp1(SEQ ID NO:21) (GGTCTCGACGTGAATACCGA) and Revp2(SEQ ID NO:22) (TCGTCTGCTTCACTAGCACG), and the expression level of VP1 gene is obviously improved along with the extension of inoculation time, which indicates that the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro has replication expression capability.
Sequence listing
<110> Suzhou university
<120> DNA vector-based in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttcgagctct aatacgactc actatagcta agtaaagtgt atgtttatac c 51
<210> 2
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tatccgcggg gctaacggtc gtgtatg 27
<210> 3
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttcgagctct aatacgactc actatagcta agtaagagca gcacttgtac g 51
<210> 4
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tatccgcggg gctaacggtg aacagcgta 29
<210> 5
<211> 90
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ttcgagctct aatacgactc actatagcta agtaaagaca catgacgaga aactaatgta 60
gtaggaaaag atggaaataa atagagctga 90
<210> 6
<211> 80
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tatccgcggg gctaacggtc gacacatgtt catgctccac gcatgccagc atataggctc 60
ctcatcgtgg atgcataacg 80
<210> 7
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttcggtacct aatacgactc actatagcta agtaatttcc accatgtggc 50
<210> 8
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tatccgcggg gctaacgttt cccaccgc 28
<210> 9
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tcgaatttaa agcttggtac ctaatacgac tcactatagc taagtaattt ccccttacc 59
<210> 10
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ataggcttac cttcgaaccg cggctaacca tctccccgtg 40
<210> 11
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ttcggtacct aatacgactc actatagcta agtaagattc cgtaatatcc 50
<210> 12
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tatccgcggg gctaacgttg actccgc 27
<210> 13
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ttcggtacct aatacgactc actatagcta agtaatttgg tcataacagc 50
<210> 14
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ggctctagag gctaacgttt ggtcactccg 30
<210> 15
<211> 48
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
ttcggtacct aatacgactc actatagcta agtaaagtcc agtactag 48
<210> 16
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tatccgcggg gctaacggta gtccgccgc 29
<210> 17
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ttcggtacct aatacgactc actatagcta agtaaatccc aggcgtaaac cg 52
<210> 18
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tatccgcggg gctaacgacc cgagtgccc 29
<210> 19
<211> 54
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
ttcggtacct aatacgactc actatagcta agtaaaagtc agtatcttac cggc 54
<210> 20
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
tatccgcggg gctaacggtc agtcagtacc gc 32
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
Claims (7)
1. An in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus based on DNA carrier, which comprises the following steps:
1) obtaining the genome of the bombyx mori cytoplasmic polyhedrosis virus;
2) based on the terminal sequences of double-stranded RNAs of fragments S1, S2, S3, S4, S5, S6, S7, S8, S9 and S10 of the genome of Bombyx mori cytoplasmic polyhedrosis virus, 10 pairs of primers are designed and synthesized: PS1F/PS1R, PS2F/PS2R, PS3F/PS3R, PS4F/PS4R, PS5F/PS5R, PS6F/PS6R, PS7F/PS7R, PS8F/PS8R, PS9F/PS9R and PS10F/PS10R, wherein the numbering of the primers is as follows:
primer PS1F corresponds to SEQ ID NO. 1, primer PS1R corresponds to SEQ ID NO. 2,
primer PS2F corresponds to SEQ ID NO. 3, primer PS2R corresponds to SEQ ID NO. 4,
primer PS3F corresponds to SEQ ID NO. 5, primer PS3R corresponds to SEQ ID NO. 6,
primer PS4F corresponds to SEQ ID NO. 7, primer PS4R corresponds to SEQ ID NO. 8,
primer PS5F corresponds to SEQ ID NO 9, primer PS5R corresponds to SEQ ID NO 10,
primer PS6F corresponds to SEQ ID NO. 11, primer PS6R corresponds to SEQ ID NO. 12,
primer PS7F corresponds to SEQ ID NO 13, primer PS7R corresponds to SEQ ID NO 14,
primer PS8F corresponds to SEQ ID NO. 15, primer PS8R corresponds to SEQ ID NO. 16,
primer PS9F corresponds to SEQ ID NO:17, primer PS9R corresponds to SEQ ID NO:18,
primer PS10F corresponds to SEQ ID NO:19, primer PS10R corresponds to SEQ ID NO:20,
the nucleotide sequence of the primer is shown as SEQ ID NO. 1-SEQ ID NO. 20;
3) obtaining cDNA of fragments S1 to S10;
4) performing PCR amplification by respectively using the cDNAs of the S1 to S10 fragments obtained in the step 3) as templates and correspondingly using 10 pairs of primers synthesized in the step 2) to obtain amplification products of the full-length cDNAs of the S1 to S10 fragments;
5) subjecting the amplification products of the full-length cDNA of the S1-S10 fragments obtained in step 4) to enzyme digestion with restriction enzymes, respectively, and then cloning into plasmid vectors to obtain recombinant plasmids pT-S1, pT-S2, pT-S3, pT-S4, pT-S5, pT-S6, pT-S7, pT-S8, pT-S9 and pT-S10, which carry the full-length cDNA of the S1-S10 fragments, respectively, wherein the restriction enzymes are used as follows:
amplification product of full-Length cDNA of fragment S1SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S2SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S3SacI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S4kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S5kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S6kpnI andSacII by enzyme digestion；
Amplification product of full-Length cDNA of fragment S7kpnI andXbai, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S8kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S9kpnI andSacII, carrying out enzyme digestion;
amplification product of full-Length cDNA of fragment S10kpnI andSacII, carrying out enzyme digestion;
6) digesting the pT-S1-pT-S10 recombinant plasmids obtained in the step 5) by using restriction enzymes respectively to obtain linearized plasmids of pT-S1-pT-S10, wherein the restriction enzymes are used as follows:
recombinant plasmid pT-S1 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S2 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S3 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S4 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S5 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S6 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S7 for useXbaI, carrying out enzyme digestion;
recombinant plasmid pT-S8 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S9 for useSacII, carrying out enzyme digestion;
recombinant plasmid pT-S10 for useSacII, carrying out enzyme digestion;
7) equimolar mixing the pT-S1-pT-S10 linearized plasmids obtained in step 6), wrapping and transfecting host cells expressing T7RNA polymerase by using liposome, collecting and crushing the cells when the formation of polyhedra in cytoplasm is observed, and carrying out centrifugal purification to obtain the bombyx mori cytoplasmic polyhedrosis virus constructed in vitro.
2. The method for in vitro construction of bombyx mori cytoplasmic polyhedrosis virus based on DNA vector of claim 1, wherein the step 1) of obtaining the genome of bombyx mori cytoplasmic polyhedrosis virus is performed by laboratory extraction or commercial purchase.
3. The method for in vitro construction of Bombyx mori cytoplasmic polyhedrosis virus based on DNA vector of claim 2, wherein the viral genome is extracted from Bombyx mori cytoplasmic polyhedrosis virus particles or Bombyx mori cytoplasmic polyhedrosis virus in the case of laboratory extraction.
4. The method for in vitro construction of bombyx mori cytoplasmic polyhedrosis virus based on DNA vector of claim 1, wherein the cDNA of the S1 to S10 fragment in step 3) is obtained by total artificial synthesis or reverse transcription based on RNA sequences.
5. The method for in vitro construction of DNA vector-based Bombyx mori cytoplasmic polyhedrosis virus according to claim 4, wherein the DNA vector-based Bombyx mori cytoplasmic polyhedrosis virus genome obtained in step 1) is boiled at 100 ℃ for 10 minutes in the case of reverse transcription, and then is subjected to ice bath for 2 minutes, and then is used as a template for future use, and reverse transcription is performed using the primers PS1R, PS2R, PS3R, PS4R, PS5R, PS6R, PS7R, PS8R, PS9R, and PS10R synthesized in step 2), respectively, to obtain cDNA corresponding to fragments S1 to S10.
6. The method for in vitro construction of Bombyx mori cytoplasmic polyhedrosis virus based on DNA vector according to claim 1, wherein the plasmid vector in step 5) is selected from any one of pIZT-V5/His vector, pUC series vector, pBluescript SK II vector.
7. The method for in vitro construction of bombyx mori cytoplasmic polyhedrosis virus based on DNA vector according to claim 1, wherein the host cell expressing T7RNA polymerase used for transfection in step 7) is a host culture cell previously transfected with recombinant vector pzt-V5/His-T7 RNApol containing T7RNA polymerase gene expression cassette; the host cell is cultivated cell of bombyx mori BmN.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810535576.6A CN108660157B (en) | 2018-05-30 | 2018-05-30 | DNA vector-based in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810535576.6A CN108660157B (en) | 2018-05-30 | 2018-05-30 | DNA vector-based in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108660157A CN108660157A (en) | 2018-10-16 |
| CN108660157B true CN108660157B (en) | 2020-12-04 |
Family
ID=63774275
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810535576.6A Active CN108660157B (en) | 2018-05-30 | 2018-05-30 | DNA vector-based in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660157B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN85104701A (en) * | 1984-06-21 | 1986-12-17 | 第一制药株式会社 | Produce the method for useful matter |
| CN1706939A (en) * | 2004-05-28 | 2005-12-14 | 独立行政法人农业生物资源研究所 | Antinuclear polyhedron virus transgenic silkworm and generating method thereof |
| CN104789597A (en) * | 2015-04-28 | 2015-07-22 | 苏州大学 | In vitro construction method of cytoplasmic polyhedrosis virus of Bombyx mori |
| CN104789598A (en) * | 2015-04-28 | 2015-07-22 | 苏州大学 | Method for constructing recombinant bombyx mori cypovirus for expressing red fluorescence protein |
-
2018
- 2018-05-30 CN CN201810535576.6A patent/CN108660157B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN85104701A (en) * | 1984-06-21 | 1986-12-17 | 第一制药株式会社 | Produce the method for useful matter |
| CN1706939A (en) * | 2004-05-28 | 2005-12-14 | 独立行政法人农业生物资源研究所 | Antinuclear polyhedron virus transgenic silkworm and generating method thereof |
| CN104789597A (en) * | 2015-04-28 | 2015-07-22 | 苏州大学 | In vitro construction method of cytoplasmic polyhedrosis virus of Bombyx mori |
| CN104789598A (en) * | 2015-04-28 | 2015-07-22 | 苏州大学 | Method for constructing recombinant bombyx mori cypovirus for expressing red fluorescence protein |
Non-Patent Citations (2)
| Title |
|---|
| An improved reverse genetics system for mammalian orthoreoviruses;TakeshiKobayashi等;《Virology》;20100315;第 398卷(第2期);摘要 * |
| BmBDV、BmCPV反向遗传学系统的建立及不同抗性家蚕对BmCPV的感染应答;郭睿;《中国博士学位论文全文数据库农业科技辑》;20151016(第 11 期);第D051-4页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108660157A (en) | 2018-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| CN108603176A (en) | Virus-free cell line and the method for obtaining it | |
| CN106755089B (en) | Cell line for expressing goat lymphocyte activating molecules and construction method and application thereof | |
| CN107090453A (en) | The composition of expressing gene product, organism, system and method in plant | |
| Hashimoto et al. | Complete study demonstrating the absence of rhabdovirus in a distinct Sf9 cell line | |
| CN107164409A (en) | CDV sensitive cell line SLAM MDCK and its construction method and application | |
| CN108517323B (en) | Salvia miltiorrhiza AP2 transcription factor SmERF128 coding sequence, cloning method and application | |
| CN111187756A (en) | Areca-nut yellows-related virus and detection method thereof | |
| CN113774081B (en) | Gene editing vector and method and application for editing genes by using same | |
| Reed et al. | Shotgun sequencing of the negative-sense RNA genome of the rhabdovirus Maize mosaic virus | |
| CN112011518A (en) | Construction and application of Zika virus ZG01 strain reverse genetic system | |
| CN104593331B (en) | Express pig pCD163 cell line, its preparation method and application | |
| CN108660157B (en) | DNA vector-based in vitro construction method of bombyx mori cytoplasmic polyhedrosis virus | |
| CN104789597B (en) | A kind of vitro construction method of silkworm cytoplasmic polyhedrosis virus | |
| CN104789598A (en) | Method for constructing recombinant bombyx mori cypovirus for expressing red fluorescence protein | |
| CN116790508A (en) | Recombinant BHK-21 cell line for stably expressing akabane virus nucleocapsid protein, construction method and application thereof | |
| CN109136200B (en) | Recombinant infectious hematopoietic necrosis virus and construction method and application thereof | |
| CN114507277B (en) | Beet armyworm gene with antiviral effect and application thereof | |
| CN115466711A (en) | Method for obtaining virus-free cell line and virus-free cell line obtained by method | |
| CN105793427A (en) | Zea mays metallothionein-like regulatory elements and uses thereof | |
| CN1037278C (en) | Exogenous genes products made from tussah chrysalis | |
| CN113061625A (en) | Replication-defective canine parvovirus packaging vector, replication-defective recombinant canine parvovirus, preparation and application | |
| CN111808858A (en) | Application of siRNA sequence and target thereof in increasing PEDV (porcine reproductive and respiratory syndrome Virus) poison value | |
| CN110904056A (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
| CN116064412B (en) | Tobacco mosaic virus double-site mutant attenuated vaccine and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |